pSEVA438: this medium copy number vector was used as a backbone for almost all our constructs. It contains a streptomycin/spectinomycin resistance gene, m-toluic acid inducible promoter Pm and a multiple cloning site (MCS). It was a kind gift from the Standard European Vector Architecture (SEVA) platform. See the plasmid map on Snapgene here.

pSEVA244: it contains a kanamycin/neomycin resistance gene, IPTG inducible promoter Ptrc and MCS. This is a medium copy number vector and was a kind gift from the Standard European Vector Architecture (SEVA) platform.See the plasmid map on Snapgene here.

pBx-Spas-sgRNA-Kan: this vector was used as a backbone for the insertion of guide RNA in CRISPRi experiments. It contains S. pasteurianus sgRNA without the 20-bp target (Empty control) from the anhydrotetracycline inducible Ptet promoter and a kanamycin/neomycin resistance gene.See the plasmid map on Snapgene here.

pUC18-mini-Tn7T-Plac-dCas9: this vector was used for the expression of S. pasteurianus deadCas9 in the CRISPRi experiments. It contains the IPTG inducible promoter Plac, gentamycin and ampicillin resistance genes. See the plasmid map on Snapgene here.

pHD_SS9_PLtetO1_TLt0_eutC-GFP: this plasmid was used for the amplification of the anhydrotetracycline inducible promoter Ptet for cloning into pSEVA438. It was kindly provided by our supervisor Denis Jallet.

Escherichia coli Stellar: HST08 strain [F-, endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔ M15, Δ(lacZYA-argF) U169, Δ(mrr-hsdRMS-mcrBC), ΔmcrA, λ-]. This strain was used in all transformations for In-Fusion® cloning (Stellar Competent cells from Takara, ref: 638952). See the strain here.

Pseudomonas fluorescens SBW25 strain: this strain was used as the BioMoon chassis strain. It was kindly provided by Patricia Bordes (Laboratoire de Microbiologie et Génétique Moléculaires, Toulouse, France).

The following genes were codon optimized for expression in Pseudomonas putida (the closest microorganism for our strain Pseudomonas fluorescens) using the Codon Optimization Tool from Integrated DNA Technologies (IDT) and gBlocks were obtained from the same company.

• creA-crnA
  
  



• hfq-rpoS
  
  

List of primers used for gBlocks amplification:

DNA origins	DNA templates	Primers	Sequences (5’ to 3’)
gBlocks	creA-crnA	creA-crnA overhang backbone FWD	ggccgcggccgcgcgaattccattgattacaaggaagtgtgtttat
gBlocks	creA-crnA	creA-crnA overhang Ptet REV	tagagatactgagcacatcatgtgggtctaggtaggcgg
gBlocks	hfq-rpoS	hfq-rpoS FWD	ggccgcggccgcgcgaattcttcatttttcacggatgaacccac
gBlocks	hfq-rpoS	hfq-rpos REV	tagagatactgagcacatcaaaacacacattgattacaaggaagtg
Genomic	P. fluorescens SBW25 genome	KatB FWD	ggccgcggccgcgcgaattcaaaaaaaccagaggaaaccctgatg
Genomic	P. fluorescens SBW25 genome	KatB REV	cacgacgcggccgcaagctttcagtcagtcagtttttcagcca

List of primers used for plasmid linearization:

Plasmids	Primers	Sequences (5’ to 3’)
pSEVA438	pSEVA backbone FWD	aagcttgcggccgcgtcg
pSEVA438	pSEVA backbone REV	gaattcgcgcggccgcg
pSEVA244	pSEVA backbone FWD	aagcttgcggccgcgtcg
pSEVA244	pSEVA backbone REV	gaattcgcgcggccgcg
pSEVA438-Ptet	pSEVA438-Ptet backbone FWD	tgatgtgctcagtatctctatcac
pSEVA438-Ptet	pSEVA backbone REV	gaattcgcgcggccgcg

List of primers used for colony PCR and sequencing:

Constructions	Primers	Sequences (5’ to 3’)
pSEVA438-Ptet pSEVA438-Ptet-creA-crnA pSEVA438-Ptet-hfq-rpoS	Control pSEVA438 FWD	aggcctaccccttaggcttt
pSEVA244-katB	Control pSEVA244 FWD	tgcgccgacatcataacggt
pSEVA438-Ptet pSEVA438-Ptet-creA-crnA pSEVA438-Ptet-hfq-rpoS pSEVA244-katB	Control pSEVA REV	gccagggttttcccagtcac