| Plasmid | Relevant Characteristics |
|---|---|
| pJL1 | basic part used to be derived |
| PSB1C3 | high copy BioBrick assembly plasmid |
| Pairs Name | 5' to 3' Primer Sequence | Purpose |
|---|---|---|
| T7 promoter | atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaacttt | the in vitro sfGFP expression of cell-free protein synthesis (CFPS); use for the construction of three composite parts (BBa_K5133004, BBa_K5133006, BBa_K5133008) |
| Ribosome binding site (RBS) | aagaaggagatatacat | used for the construction of composite part BBa_K5133004 |
| sfGFP | atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaatttatctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctatgtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggccataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcagaataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggtattacgtggagccatccgcagttcgaaaaataa | used for the construction of composite part BBa_K5133004 and demonstrate the feasibility of CFPS in our project. |
| T7 terminator | gtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaagccaattctga | used for the construction of BBa_K5133004, BBa_K5133006, BBa_K5133008 |
| sfGFP generator | atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacat atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaatttatctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctatgtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggccataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcagaataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggtattacgtggagccatccgcagttcgaaaaataa | sfGFP generator for CFPs (cell-free protein synthesis) |
| Microcin H47 | atgcgagaaataacagaatcacagttaagatatatttccggggcgggaggtgcgccagcgacttcagctaatgctgcaggtgctgcagctattgttggagctctcgccggaatacctggtggtccacttggggttgtagttggagccgtatctgccggtttgacaacagcaattggctcgaccgtgggaagtggtagtgccagttcttctgctggtggcggtagccatcatcatcatcatcactaa | used for the construction of composite part BBa_K5133006 to demonstrate the feasibility of in vitro antimicrobial peptide production by CFPS. |
| Microcin H47 generator | atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacat atgcgagaaataacagaatcacagttaagatatatttccggggcgggaggtgcgccagcgacttcagctaatgctgcaggtgctgcagctattgttggagctctcgccggaatacctggtggtccacttggggttgtagttggagccgtatctgccggtttgacaacagcaattggctcgaccgtgggaagtggtagtgccagttcttctgctggtggcggtagccatcatcatcatcatcactaa gtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaagccaattctga | used as microcin H47 generator for CFPs (cell-free protein synthesis) |
| Microcin M | atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacat atgagaaaactatctgaaaatgaaataaaacaaatatctggaggtgacgggaatgacgggcaggcagaattaattgctattggttcacttgctggtacgtttattagcccgggatttggttctattgcaggggcttat ataggtgataaagtacattcatgggcaacgactgcgacggttagtccctccatgtctccctcaggtataggattatcatcccagtttggatccggcagaggtacatcaagtgcctcttcgtctgcggggagtggaagt catcatcatcatcatcactaagtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaagccaattctga |
used for the construction of composite part BBa_K5133008 (Microcin M generator) to demonstrate the feasibility of in vitro antimicrobial peptide production by CFPS. |
| Microcin M generator | atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacat atgagaaaactatctgaaaatgaaataaaacaaatatctggaggtgacgggaatgacgggcaggcagaattaattgctattggttcacttgctggtacgtttattagcccgggatttggttctattgcaggggcttat ataggtgataaagtacattcatgggcaacgactgcgacggttagtccctccatgtctccctcaggtataggattatcatcccagtttggatccggcagaggtacatcaagtgcctcttcgtctgcggggagtggaagt catcatcatcatcatcactaagtcgaccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaagccaattctga | used as microcin M generator for CFPs (cell-free protein synthesis) |
KOD One™ PCR Master Mix is a PCR master mix based on genetically modified KOD DNA polymerase (UKOD).
Advantages: It can increase the rate of PCR and provides greater efficiency than traditional PCR enzymes. Its efficiency is higher.
dNTPs are substrates for DNA synthesis. It has been suggested that their availability affects cell cycle progression in pathological situations such as development and tumour growth.
PCR-grade Water is intended for use in molecular biology applications including PCR and RT-PCR. The ultra-pure and sterile filtered water is manufactured free of detectable inhibitors, contaminants or enzymatic activity. PCR Grade is specially purified, double-distilled, deionized, and autoclaved.
The reaction buffer is a 10-fold concentrate that contains Tris-HCl, pH 8.0, sodium chloride, magnesium chloride and protein stabilizers. Used for polyacrylamide and agarose gel electrophoresis. This product is optimized for use in DNA applications.
PCR is based on using the ability of DNA polymerase to synthesize new strands of DNA complementary to the offered template strand. Taq polymerase can work at high temperatures with high efficiency and amplification capacity, which other bodily enzymes cannot.
Acting as a cofactor, it enhances the enzymatic activity of DNA polymerase, thereby boosting DNA amplification.
A standard PCR uses two primers, often called the “forward” and “reverse” primers. Are oriented on opposite strands of the DNA. During a PCR run, the primers will bind to the DNA, bookending the sequence you wish to amplify.
Nucleic acid fragments are separated by their length while moving through an agarose matrix. By adding a dye or an intercalating agent like ethidium bromide (EtBr), these fragments can be visualized under ultraviolet light.
A series of restriction endonucleases that have undergone genetic engineering recombination and can accurately cut DNA within 5-15 minutes. Suitable for fast digestion of plasmid DNA, PCR products, genomic DNA, etc. Has a common enzyme digestion buffer that greatly simplified the enzyme digestion reaction system.
Specifically designed for the chemical transformation of DNA. It permits a transformation efficiency of over 108 cfu/μg DNA.
Features: High transformation efficiency: >108 cfu/μg (pUC19 DNA). Reduced recombination of cloned DNA. Blue/white selection.
A technology used to amplify DNA sequences effectively. It is based on the principle of enzymatic replication of nucleic acids.
A series of restriction endonucleases that have undergone genetic engineering recombination and can accurately cut DNA within 5~15 minutes. It can separate liquids and sediments.
Used to measure the DNA concentration. Its mechanism is to measure the absorbance at 260nm in a spectrophotometer using a quartz cuvette. (uncertainty ±0.1~1.0)
Allows direct pipetting off samples onto the optical measurement surface. When the measurement is complete, simply wipe the surface with a lint-free lab wipe. The NanoDrop 2000c integrates a sample retention system with cuvette functionality.
A technique used to separate DNA fragments according to their size and mass. DNA samples are loaded into walls (indentations) at one end of a gel, and an electric current is applied to pull them through the gel. DNA fragments are negatively charged, so they move towards the positive electrode because of the attraction.
It used in molecular biology labs for imaging and documentation of protein suspended within polyacrylamide or agarose gels and nucleic acid. The porous gel is used in this technique acting as a molecular sieve that separates bigger molecules from the smaller ones. As smaller molecules move faster through the gel, larger molecules are left behind.
It is used to protect specimens (DNA fragments) and reagents mentioned above. It also maintains the environment and prevents the experiment samples from infectious hazards.
Allow us to rapidly draw and disperse liquids at accurate and extremely small volumes.
The lysis buffer allows the adsorption of DNA onto the silica membrane in the presence of high salt.