OVERVIEW
For this year, we have added 12 new parts to the registry, which together make up our three main composites. In addition, we have also submitted PCR primers for the amplification of each of these parts. These new parts were developed with the aim of optimizing the production of CBDA based on the accumulation of the precursor of our pathway: the GPP.
| Part Name | Description |
|---|---|
| BBa_K5452132 | This part codes for ERG20, responsible for converting GPP into FPP |
| BBa_K5452101 | This part codes for Argonaute 1, enzyme present in the RISC system |
| BBa_K5452102 | This part codes for Dicer, enzyme present in the RISC system |
| BBa_K5452105 | This part codes for non-transcribed region (5’UTR) used for RISC device |
| BBa_K5452106 | This part codes for non-transcribed region (3’UTR) used for RISC device |
| BBa_K5452103 | This part codes for non-transcribed region (5’UTR) used for RNAi device |
| BBa_K5452104 | This part codes for non-transcribed region (3’UTR) used for RNAi device |
| BBa_K5452133 | Device coding sequence for the enzymes needed for the synthesis of RISC system |
| BBa_K5452107 | This part codes for non-transcribed region (5’UTR) used for overexpression composite and the strong promoter of Hexokinase |
| BBa_K5452108 | This part codes for non-transcribed region (3’UTR) used for overexpression device |
| BBa_K5452128 | Device coding the RNAi cassette for ERG20 |
| BBa_K5452134 | Device coding the overexpression cassette for GPPS |
PART BBa_K5452133
Part BBa_K5452133 is our first device. It’s a combination of the coding sequences of the two enzymes responsible for the RISC system, interspersed by IRES (Internal ribosomal entry site). This part was built with the aim of inducing the S. cerevisiae RISC system, thus making it possible to use the interference RNA for the ER20 enzyme
This device contains: CDS for DICER and Argonaute 1 intercalated by the IRES, gapdh constitutive promoter and cyc1 terminator, the both have already been cataloged by iGEM08_Brown team and iGEM18_Tianjin, respectively. We have chosen a constitutive promoter to build this circuit because we want its expression to be strong and continuous in the cell associated with its genome
A Dicer belongs to the RNase III family of nucleases that process long dsRNA into 21- to 26-nucleotide (nt)-long RNA duplexes, which are fundamental specificity determinants in the RNA interference mechanism (MOAZED, 2009). The Argonaute protein is responsible for cleaving target messenger RNA in the RNAi pathway (NAKAYASHIKI; KADOTANI; MAYAMA, 2006). Both proteins are key parts of the RNA interference mechanism and it is from them that the target gene is silenced
The IRES (Internal Ribosome Entry Site) (BBa_K1993016) element is a sequence present in mRNA, normally found in eukaryotes, which allows translation to be initiated independently of the 5' end, as part of the protein synthesis process. This part have already been cataloged by iGEM16_SYSU-MEDICINE
In addition, the RISC system is flanked by non-coding regions (UTR) of the pep4 protease locus. We chose this region because deletion of this gene does not alter yeast growth, which is of paramount importance for good production (Schoborg, Clark, Choudhury, C. Eric Hodgman, & Jewett, 2016).
PART BBa_K5452128
Part BBa_K5452128 is our second composite with only one enzyme: ERG20. This composite is responsible for forming our dsRNA, which will be recognized by the Dicer and Argonaute 1 enzymes present in the RISC system, generating the silencing mechanism.
This device contains: CDS for ERG20 intercalated by the tet promoter, which has already been cataloged by iGEM18_Peking team. For this case, we chose a tetracycline-induced promoter since we don't want to have constant production of this interference RNA, as ERG20 is an important enzyme for the terpenoid pathway, which can affect cell growth. In this way, our team thought that the best strategy would be to induce the production of this “silencing” when the yeast is close to the stationary phase, so that we don't interfere with its growth
The RNAi composite is mediated by non-coding regions found after the ERG20 enzyme gene. In this way, we ensured that ERG20 expression was reduced, but not completely silenced, since this enzyme also plays a role in converting IPP to GPP and its total silencing could impair cell growth since FPP is part of the terpenoid metabolism in S. cerevisiae, which is responsible for the production of important lipids and hormones for the cell (Liu, J., Zhang, W., Du, G., Chen, J., & Zhou, J, 2013).
PART BBa_K5452131
Part BBa_K5452128 is our third composite with only one enzyme: GPPS. This composite is responsible for overexpressing the enzyme responsible for converting IPP into GPP, generating its accumulation in the cell. In this way, we think it would be a good alternative, combined with the RNAi strategy for ERG20, to optimize our final production of CBDA.
This device contains: CDS for GPPS with the hexokinase promoter and the TEF1 terminator. The GPPS CDS have already been cataloged by Scott Pownall, Open Yeast, and the TEF1 came from iGEM12_TU_Munich team. For this case, we chose to use a strong promoter, such as that of the hexokinase gene, in order to produce more copies of GPPS, and thus increase its production, generating greater accumulation of GPP.
The overexpression composite is mediated by non-coding regions found on the hexokinase locus. We decided to knock out this region because decided to silence the HXK2 enzyme that, when deleted, allowed for increased expression in the HXK1 enzyme - which can possibly be attributed to the fact that the “deletion of one HXK isoenzyme might trigger a marked increase in the expression of the other, causing reinforcement of the glycolysis flux to the MVA pathway” (Sun et al., 2014).
OUR PRIMES
This year our team has also developed primers for each of the parts worked on in our cassettes, allowing a follow-up PCR reaction for different cloning strategies, such as cloning into different devices, plasmids, adding restriction sites or protrusions.
| Part Name | Amplified part | Description | Ringing temperature | CG content | Primer sequence |
|---|---|---|---|---|---|
| BBa_K5452110 | BBa_K5452103 | Forward primer for amplifying part BBa_K5452103 | 57,3°C | 30,4% | CAAATAGATAAAACTGTCCATCA |
| BBa_K5452111 | BBa_K5452103 | Reverse primer for amplifying part BBa_K5452103 | 57,9°C | 66% | GGCAACAATGGCGAAGGCA |
| BBa_K5452112 | BBa_K5452104 | Forward primer for amplifying part BBa_K5452104 | 53,6°C | 30% | GACCTAAATCCAAAATACAT |
| BBa_K5452113 | BBa_K5452104 | Reverse primer for amplifying part BBa_K5452104 | 54,5°C | 30% | AAGCATTATAGTCTACGAAA |
| BBa_K5452114 | BBa_K5452100 | Forward primer for amplifying part BBa_K5452100 | 56,5°C | 30% | ATGGCTTCAGAAAAAGAAAT |
| BBa_K5452115 | BBa_K5452100 | Reverse primer for amplifying part BBa_K5452100 | 56,9°C | 31,8% | CTATTTGCTTCTCTTGTAAACT |
| BBa_K5452116 | BBa_K5452105 | Forward primer for amplifying part BBa_K5452105 | 56,1°C | 42,1% | GAAGAGGCTCATATCATGA |
| BBa_K5452117 | BBa_K5452105 | Reverse primer for amplifying part BBa_K5452105 | 54°C | 25% | TTATAAAGCCAATGACAAAT |
| BBa_K5452118 | BBa_K5452101 | Forward primer for amplifying part BBa_K5452101 | 59,1°C | 40% | ATGTCATCCAATAGCGAAGA |
| BBa_K5452119 | BBa_K5452101 | Reverse primer for amplifying part BBa_K5452101 | 53,2°C | 20,8% | TCATATATAGTACATTATATCAGT |
| BBa_K5452120 | BBa_K5452102 | Forward primer for amplifying part BBa_K5452102 | 59,3°C | 45% | ATGAACAGAGAGAAGTCTGC |
| BBa_K5452121 | BBa_K5452102 | Reverse primer for amplifying part BBa_K5452102 | 58°C | 40% | TCAAAGGTTGTTACAGTGAC |
| BBa_K5452122 | BBa_K5452107 | Forward primer for amplifying part BBa_K5452107 | 55,3°C | 38,9% | CCATTCCACAACTTTCAT |
| BBa_K5452123 | BBa_K5452107 | Reverse primer for amplifying part BBa_K5452107 | 54,5°C | 16% | TTTATTTAATTAGCGTACTTATTAT |
| BBa_K5452124 | BBa_K5452109 | Forward primer for amplifying part BBa_K5452109 | 56°C | 44,4% | TAATGGAGCATAAGGACG |
| BBa_K5452125 | BBa_K5452109 | Reverse primer for amplifying part BBa_K5452109 | 55,6°C | 33,3% | GCCTTGGAAGATATACTAAAA |
| BBa_K5452126 | BBa_K5452108 | Forward primer for amplifying part BBa_K5452108 | 56,1°C | 35% | ATGTTATTCACTAGGAGTGT |
| BBa_K5452127 | BBa_K5452108 | Reverse primer for amplifying part BBa_K5452108 | 56,6°C | 35% | TCACTTGTTCCTGGTTATAA |
REFERENCES
Liu, J., Zhang, W., Du, G., Chen, J., & Zhou, J. (2013). Overproduction of geraniol by enhanced precursor supply in Saccharomyces cerevisiae. Journal of biotechnology, 168(4), 446-451.
Schoborg, J. A., Clark, L. G., Choudhury, A., Hodgman, C. E., & Jewett, M. C. (2016). Yeast knockout library allows for efficient testing of genomic mutations for cell-free protein synthesis. Synthetic and Systems Biotechnology, 1(1), 2–6. https://doi.org/10.1016/j.synbio.2016.02.004
Sun, Z., Meng, H., Li, J., Wang, J., Li, Q., Wang, Y., & Zhang, Y. (2014). Identification of Novel Knockout Targets for Improving Terpenoids Biosynthesis in Saccharomyces cerevisiae. PLoS ONE, 9(11), e112615–e112615. https://doi.org/10.1371/journal.pone.0112615