Materials
This section provides a comprehensive catalog of the key biological materials including strains, plasmids, primers and antibodies that formed the foundation of our experiments. Each component was carefully selected or engineered to ensure precision and efficiency at every stage of our research, playing a critical role in the success of our project.
STRAINS
1.Pseudomonas putida KT2440: A well-characterised strain derived from the wild-type Pseudomonas putida mt-2 with rmo-mod+ genotype.
2.Pseudomonas putida TA7: A derivative strain of Pseudomonas putida KT2440, engineered for the uptake of terephthalic acid (TPA) as a carbon source.
3.Pseudomonas putida TA7-EG: TA7 EG is a derivative strain of Pseudomonas putida KT2440, engineered for the utilisation of both terephthalic acid (TPA) and ethylene glycol as carbon sources.
We gratefully acknowledge the receipt of these strains from Dr. Oliver Brandenberg, whose contributions have been instrumental to our work in utilising these strains for carbon source engineering.
PLASMIDS
1. pCDFDuet: This plasmid was used to express and produce santalene. It incorporates resistance genes for both streptomycin and spectinomycin, enabling selective pressure during bacterial culture. The expression system is controlled by a lac promoter, which was activated through IPTG induction. This setup allowed for efficient regulation of santalene biosynthesis under controlled experimental conditions.
2. pSEVA 631_SaSSy_FPPS: The plasmid served as the backbone for the integration of our (Santalene Synthase)SaSSy and Farnesyl pyrophosphate synthase(FPPS) fragments responsible for santalene production. It confers gentamicin resistance and features an araBAD promoter, which was activated through L-arabinose induction.
3. pSEVA 241_CPR_p450: The plasmid served as the backbone for the integration of our CPR-P450 fragments, which are essential for the biosynthesis of santalol. It is equipped with a kanamycin resistance gene and the expression system is controlled by a tet promoter. The induction was done by anhydrous tetracycline.
4. pSEVA 424_DXS_DXR: This plasmid was used as backbone for DXS-DXR that increase the flux towards IPP/DMAP. It confers streptomycin and spectinomycin resistance with lac promoter. The induction was done by IPTG.
PRIMERS
| Sr. no. | Primer information | Primer sequence | 1st round Tm(°C) | Tm(°C) |
|---|---|---|---|---|
| 1 | Forward primer for the amplification of araBAD-SaSSy-FPPS | 5’ CGC CTA GGC CGC GGC CGC GCG AAT TCT TAG TGG 3’ | 71.3 | 77.7 |
| 2 | Reverse primers for amplification of araBAD-SaSSy-FPPS | 5’ TTT TCC CAG TCA CGA CGC GGC CGC AAG CTT TTA TGA CAA CTT GAC GGC TAC ATC ATT CAC 3’ | 74.9 | 76.8 |
| 3 | Forward primer for amplification of CPR-P450 | 5’ CGC CTA GGC CGC GGC CGC GCG AAT TCT TAG TGA TG 3’ | 69.2 | 76.8 |
| 4 | Reverse primer for the amplification of CPR-P450 | 5’ TTT TCC CAG TCA CGA CGC GGC CGC AAG CTT TTA AGA CCC 3’ | 70.8 | 75.7 |
| 5 | Forward primer to replace tet promoter with araBAD promoter | 5’ ATATGCATATATCTCCTTCTTAAAAGATC 3’ | 49.5 | 56.9 |
| 6 | Reverse primer to replace tet promoter with araBAD promoter | 5’ CGCAAGCTTTTATGACAAC 3’ | 54.9 | same |
ANTIBODIES
| ANTIBODY | CATALOG NUMBER/SUPPLIER | DILUTION FOR BLOT |
|---|---|---|
| His Tag (rabbit) | Santa Cruz, sc-804 | 1:1000 (primary), 1:2000 (secondary) |
| His Tag (mouse) | Santa Cruz, sc-8036 | 1:1000 (primary), 1:2000 (secondary) |
Protocols
This section compiles the protocols we followed and refined throughout our laboratory experimentation. This section serves as both a guide and a resource for future experimentation, offering insights into the thought process behind protocol selection and development, as well as a testament to the collaborative effort that drove our success in the laboratory.
1. M9 MINIMAL MEDIA PREPARATION
1.1 SOLUTIONS
1.1.1 M9 media
1.Measure 64g Na2HPO4.7H2O in a sterilised plastic boat (previously tared) using a digital weighing scale and transfer to a 1L conical flask
2. Weigh out 15g KH2PO4 in the same way and add it to the conical flask.
3. Measure 2.5g NaCl and 5g NH4Cl similarly and transfer to the same conical flask.
4. Make up the 1000mL of the volume by adding MilliQ to the conical flask.
5. Gently close the lid. Autoclave the M9 media bottle at 121 degrees Celsius for 20 minutes.
6. On completion, gently tighten the lid and mix the media if required.
7. Use the required amount and keep it at 4 degrees Celsius until further use.
1.1.2 MgSO4 solution
1. Measure 12.325g of MgSO4 in a sterilised plastic boat (previously tared) using a digital weighing scale and transfer it to a 100 ml conical flask.
2. Add 50ml milliQ to the conical flask.
3. Gently close the lid. Now proceed to autoclave the flask at 121 degrees Celsius for 20 minutes.
4. On completion, tighten the lid and mix gently if required.
5. Use the required amount and keep it at 4 degrees Celsius until further use.
1.1.3 CaCl2 solution
1. Measure 7.350g CaCl2 in a sterilised plastic boat(previously tared) using a digital weighing scale and transfer to a 100 ml conical flask.
2. Add 50ml milliQ to the conical flask.
3. Gently close the lid. Now proceed to autoclave the flask at 121 degrees Celsius for 20 minutes.
4. On completion, tighten the lid and mix gently if required.
5. Use the required amount and keep it at 4 degrees Celsius until further use.
1.2 TPA+EG LIQUID MEDIA PREPARATION
1. Take a few clean, empty 50 mL Borosil bottles and rinse them with MilliQ.
2.Measure 3mL M9 media using a 1ml pipette and transfer it to the bottle.
3.Measure 30ul of freshly prepared MgSO4 using a 2-20ul pipette and transfer to the same bottle.
4.Measure 1.5ul CaCl2, transfer and mix well.
5. Add the required amount of Ethylene Glycol, depending on the different bottles' concentrations.
6. Make up the remaining 15ml of the volume by adding milliQ to the bottle.
7. Gently close the lid. Autoclave the M9 media bottle at 121 degrees Celsius for 20 minutes. On completion, everything will be dissolved.
8. Tighten the lid.
9. Add the mentioned amount of TPA to the bottles once the temperature is bearable.
10. Now pipette 15ul of previously prepared trace metals and add to each bottle.
11. Pick single colonies of Pseudomonas putida TA-7 EG from the freshly streaked agar plate and inoculate to all the EG and TPA+EG media, and pick single colonies from P. putida TA-7 and inoculate to the TPA media.
12. Let it grow overnight.
| MEDIA | TPA CONCENTRATION | EG CONCENTRATION |
|---|---|---|
| 5mM TPA | 0.375ml | |
| 5mM EG | 4.2ul | |
| 5mM TPA+5mM EG | 0.375ml | 4.2ul |
| 10mM TPA | 0.750ml | |
| 10mM EG | 8.4ul | |
| 10mM TPA+10mM EG | 0.750ml | 8.4ul |
| 15mM TPA | 1.125ml | |
| 15mM EG | 12.6ul | |
| 15mM TPA+15mM EG | 1.125ml | 12.6ul |
| 20mM TPA | 1.5ml | |
| 20mm EG | 16.8ul | |
| 20mM TPA+20mM EG | 1.5ml | 16.8ul |
2. GLYCEROL STOCK PREPARATION
1. Inoculate the bacteria into an appropriate liquid medium, preferably LB broth, and let it grow overnight at the required temperature and shaking.
2. Using a sterile pipette, transfer an appropriate amount of 100% glycerol to a sterile cryo vial.
3. Add an equal amount of bacterial culture to the same cryo vial.
4. Gently mix by pipetting up and down.
5. Store the vials in -80°C.
1. COMPETENT CELL PREPARATION
(E. coli)
1. Pick a single colony of E. coli from a freshly streaked agar plate and inoculate it into 5 ml of autoclaved LB broth.
2. Let the culture grow overnight at 37 degrees Celsius in a shaker incubator at 250 rpm.
3. Inoculate 3 ml of the overnight culture in 200 ml of autoclaved LB broth.
4. Incubate the secondary culture at 37 degrees Celsius at around 250rpm
5. Monitor the absorbance using a spectrophotometer every 1 hour or 30 minutes till it reaches an O.D of 0.5 at 600nm.
6. Once the OD reaches 0.5, plunge it into an ice bath for 10 minutes.
7. Make sure to pre-chill the falcons, pipette tips and maintain the centrifuge at 4 degree celsius.
8. Transfer the culture(45 ml) into a pre-chilled 50 ml falcon tube under sterile conditions and keep in ice for 30 minutes.
9. Pellet down the culture at 4 degrees Celsius for 10 minutes at 4000 rpm.
10. Carefully discard the supernatant formed.
11. Add 30ml of pre-chilled 0.1M CaCl2 into the falcon, gently flick it around 15 times, and flash freeze for 40 seconds.
12. Again, centrifuge at 4 degrees for 10 minutes at 4000 rpm.
13. Remove 25ml of the supernatant carefully and add 30ml of CaCl2 again.
14. Repeat the CaCl2 wash 5-6 times until all the debris is removed.
15. Carefully measure the volume of the remaining pellet and make it to 400ul using the prepared stock solution.
16. Transfer it into eight vials of 50ul each under sterile conditions.
17. Freeze the aliquots in liquid nitrogen and store them at -80 degrees celsius until further use.
2. COMPETENT CELL PREPARATION
(Pseudomonas putida)
1. Inoculate a single colony of Pseudomonas putida into 5 mL of LB medium.
2. Incubate the culture overnight at 30°C with shaking at 200-250 rpm.
3. Add 1 mL of the overnight culture to 100 mL of fresh LB medium.
4. Incubate the diluted culture at 30°C with shaking until the OD₆₀₀ reaches approximately 0.5.
5. Once the culture reaches the desired OD₆₀₀, place the culture on ice for 10-15 minutes to chill and transfer to pre-cooled centrifuge tubes.
6. Pellet down at 3000g for 8 minutes at 4 degrees Celsius.
7. Carefully discard the supernatant.
8. Resuspend the cell pellet in 20ml of sterile 10% ice-cold glycerol.
9. Transfer to 50ml tubes, centrifuge again at 3000g for 8 minutes at 4°C, and discard the supernatant.
10. Repeat this washing step two more times for a total of three washes with ice-cold sterile 10% glycerol.
11. After the final centrifugation, resuspend the cell pellet in 1ml of ice-cold sterile 10% glycerol.
12. Aliquot the electrocompetent cells into sterile, pre-cooled 100ul microcentrifuge tubes.
13. Immediately freeze the aliquots in liquid nitrogen and store the electrocompetent cells at -80°C.
1. HEAT SHOCK TRANSFORMATION
1. Take the competent cells from -80°C and thaw the vial in ice for 5-10 mins.
2.Take 1ng/ul of plasmid DNA in a pre-chilled 1.5ml tube and add 50ul of competent cells.Tap mix 3-5 times.
3. Incubate in ice for 30 minutes.
4. Heat shock for 1 minute at 40°C.
5. Immediately transfer back to ice for 5 minutes.
6. Add 1 ml of room temperature LB and incubate at 37 degrees Celsius and 200 rpm for 1 hour.
7. Spin down at 3000 rpm for 5 minutes at 37 degrees Celsius, aspirate 900ul.
8. Resuspend the bacteria in the remaining 100ul LB broth and plate on the selective media.
9. Dry the plates for 2 minutes.
2. ELECTROPORATION
1. Keep cells and plasmid on ice before electroporation to maintain cell viability and transformation efficiency.
2.Mix 50-100 µL of electrocompetent cells in a sterile tube with 1-2 µL of plasmid. Gently mix without pipetting excessively.
3.Keep it on ice for 30 seconds.
4.Transfer the cell-plasmid mixture to a pre-chilled electroporation cuvette.
5. Set the electroporator to the appropriate settings. Place the cuvette in the electroporator and pulse.
6. Add 1 mL of recovery medium (pre-heated LB broth) to the cuvette and gently mix to resuspend the cells. Transfer the cells to a sterile tube.
7. Incubate the cells in the recovery medium at 37°C with shaking for 1 hour to allow cells to recover and express antibiotic resistance genes.
8. Spin down at 4000 rpm for 5 minutes.
9. Discard 700 ul of the supernatant and plate the rest of the volume of the electroporated cells onto selective agar plates.
3. GIBSON ASSEMBLY
An advanced molecular cloning technique that enables the seamless joining of multiple DNA fragments in a single reaction without the requirement for restriction enzyme sites or traditional DNA ligation. Gibson Assembly was selected over traditional restriction enzyme-based cloning methods for several key reasons that align with our project’s requirements. The following is the protocol we employed for the assembly of our three-fragment plasmid insert, SaSSy-FPPS.
1. Make each fragment's concentration 100 ng/ul by adding the required amount of Nuclease Free Water (NFW) in each vial.
2.Ensure that the DNA fragments to be assembled have overlapping sequences (20-40 bp).
3. Combine the DNA fragments in a reaction tube according to the required volumes.
4. Add the required amount of NFW and make it upto 10 ul.
5. Use 10 ul of 10x Gibson Assembly Master Mix and mix it with the DNA fragments.
6. Incubate the mixture in a thermocycler at 50°C for 60 minutes. The time can vary depending on the complexity and number of fragments.
7. Following incubation, store samples on ice or at –20 °C for subsequent transformation.
8. After the assembly reaction, the assembled product is transformed into electrocompetent cells using standard electroporation protocols.
9. Plate the transformed cells on selective media and incubate overnight at 37°C.
4. POLYMERASE CHAIN REACTION
1.Take 2 µL of the assembled fragments for amplification and dilute with 8 µL of nuclease-free water (NFW).
2. In a PCR tube, mix the following components, ensuring that the DNA polymerase is added last.
3. All components should be on ice during the preparation of the PCR reaction mixture.
| COMPONENT | 64°C w/ DMSO | 68°C w/o DMSO |
|---|---|---|
| NFW | 8.4 ul | 10.4 ul |
| BUFFER | 4 ul | 4 ul |
| TEMPLATE | 2.4 ul | 2.4 ul |
| dNTP | 1.6 ul | 1.6 ul |
| FORWARD PRIMER | 0.6 ul | 0.6 ul |
| REVERSE PRIMER | 0.6 ul | 0.6 ul |
| POLYMERASE | 0.4 ul | 0.4 ul |
| DMSO | 2 ul | nil |
4. Set the PCR machine to the required temperatures and cycle conditions, then place the PCR vial in the machine for the appropriate duration.
CYCLING CONDITIONS
| Initial Denaturation | 5 min (95°C) |
| Denaturation | 30s (95°C) |
| Annealing | 1 min (57°C) |
| Extension | 1 min for 1kb (72°C) |
| Final Extension | 5 min (72°C) |
5. RESTRICTION DIGESTION
| REACTION COMPONENT | AMOUNT |
|---|---|
| Enzyme Buffer | Upto 1X |
| DNA sample | 2-20 ng |
| Enzyme 1 | 10 units/ul |
| Enzyme 2 | 10 units/ul |
| Nuclease Free Water | Make up to 25 ul |
5.1 For a 25 ul reaction
1. Thaw all components (DNA, enzymes, buffer) on ice.
2. Ensure all reagents and tubes are kept on ice during setup to prevent enzyme degradation.
3. In a PCR tube, add water as calculated above.
4. Add the DNA sample to be digested.
5. Add the required amount of restriction buffer.
6. Select the appropriate enzymes required for the digestion of the desired DNA.
7.Add the enzyme(s).
8. Briefly spin the tube to ensure all components are mixed at the bottom of the tube.
9. Incubate the reaction mixture at the temperature recommended for the restriction enzyme (usually 37°C) for 2-3 hours.
10. Verify the digestion by running an aliquot of the reaction mixture on an agarose gel electrophoresis.
6. CLONING
1. Digest both the vector DNA and insert DNA with the same restriction enzymes to create compatible ends.
2. Purify the digested products using the PCR cleanup kit.
3. Mix the digested vector and insert in a suitable molar ratio (typically 1:3 vector to insert).
4. Add buffer and DNA ligase (5 ul each for 50 ul reaction).
5. Make it upto 50 ul using NFW and incubate the mixture at 16°C overnight or at room temperature for 1-2 hours.
6. Add the ligation mixture to competent cells and transform using either electroporation or heat shock method.
7. Use colony PCR, restriction digestion, or sequencing to verify the presence and correct orientation of the insert.
6.1 For SaSSy-FPPS insert and pSEVA 631 vector
| COMPOUND | 1:3 RATIO | 1:1 RATIO |
|---|---|---|
| NFW | 30.07 ul | 26.94 ul |
| VECTOR | 3 ul | 6.13 ul |
| INSERT | 9.43 ul | 9.43 ul |
| BUFFER | 5 ul | 5 ul |
| T4-LIGASE | 5 ul | 5 ul |
7. SEQUENCING
7.1 Big Dye Reaction (10 ul)
| COMPONENTS | VOLUME |
|---|---|
| Sequencing Buffer | 1.75 ul |
| Sequencing Big Dye Mix | 0.5 ul |
| Primer (10mM) | 1 ul |
| Template | 200 ng |
| MilliQ | Adjust to final volume |
7.2 Cycling Conditions
| STAGE | TEMPERATURE | TIME | NO. OF CYCLES |
|---|---|---|---|
| Initial Denaturation | 96°C | 1 min | 1 |
| Denaturation | 96°C | 10 sec | 25 |
| Annealing | 50°C | 5 sec | 25 |
| Final Extension | 60°C | 4 sec | 25 |
| Hold | 4°C | infinite | 1 |
7.3 Sequencing Reaction Cleanup
1. Add 10 µL of the PCR reaction (sample) to each well of the 96-well plate.
2. Add 10 µL of autoclaved Milli-Q water to each well to bring the total volume to 20 µL.
3. Add 5 µL of 125 mM EDTA (pH 8.0) to each well and pipette-mix the contents of each well gently.
4. Add 60 µL of 100% ethanol to the walls of the wells.
5. Seal the plate with aluminum foil or a plastic adhesive seal and invert the plate 4 times to mix thoroughly.
6. Incubate the sealed plate in the dark for 15 minutes at room temperature.
7. Spin the plate at 3000g for 30 minutes at room temperature (25°C) or at 2200g for 45 minutes at room temperature.
8. Carefully remove the seal from the plate and invert the plate onto a Kimwipe to drain excess liquid.
9. With the plate still inverted, spin at 185g for 1 minute at room temperature (~25°C) to remove residual liquid.
10. Add 60 µL of 70% ethanol to the walls of the wells.
11. Seal the plate again with aluminum foil or a plastic adhesive seal.
12. Spin the plate at 1650g for 15 minutes at 4°C.
13. With the plate inverted, spin at 185g for 1 minute at room temperature to remove any remaining liquid.
14. Resuspend the samples in 10 uL HiDi Formamide.
15. Heat the plate at 95°C for 2 minutes to denature the samples.
16. Immediately transfer the plate to ice after snap-chilling to halt any further reactions.
17. Spin the plate to collect all the PCR product to the bottom.
1. PLASMID ISOLATION; High Copy Plasmid (Machery-Nagel Kit)
1. Inoculate 5 ml LB broth in a falcon using appropriate antibody under sterile conditions and let it grow overnight.
2. Pellet down the culture for 5 minutes at 11000g.
3. Discard the supernatant, remove as much liquid as possible.
4.Add 250ul resuspension buffer (A1). Resuspend the cell pellet by vortexing to ensure that no cell clumps remain.
5. Add 250ul lysis buffer (A2) and invert mix 6 to 8 times. Be gentle to avoid shearing of genomic DNA.
6. Incubate at room temperature for up to 5 min until lysate appears.
7. Add 300ul neutralising buffer (A3), and invert the mix 6 to 8 times until the blue sample turns colourless.
8. Centrifuge at room temperature for 5 min at 11000g to precipitate the genomic DNA. Repeat till the supernatant is clear.
9. Place a Plasmid Column in a Collection Tube and decant the supernatant onto the column. Spin down at 11000g for 1 minute. Discard the flow-through and place the column back into the collection tube.
10. Repeat step 9 for the rest of the volume.
11.Add 500 uL of wash buffer (AW) , preheated to 50 degree celsius, and centrifuge for 1 min at 11000g. Discard the flow through
12. Add 600ul wash buffer (A4), centrifuge for 1 min at 11000g, and discard the flowthrough.
13. Centrifuge the column (dry spin) for 2 mins at 11000g, and discard the collection tube.
14. Incubate the column with lid open at 50°C for 1-2 minutes to ensure the complete evaporation of any residual ethanol.
15. Transfer the column to a fresh 1.5ml microcentrifuge tube.
16. Add 50ul of pre-heated elution buffer and incubate for 1 min at room temperature.
17. Spin down at 11000g for 1 minute.
2. PCR CLEANUP
1. Add 2 volumes of Binding buffer NTI to 1 volume of PCR product.
2. For sample volumes less than 30 uL make it up to 50uL with molecular grade water and
follow Step 1.
3. Mix thoroughly by pipetting up and down.
4. Place a NucleoSpin® column into a collection tube and load the mixture onto the column.
5. Centrifuge at 11,000 x g for 30 seconds.
6. Discard the flow-through and place the column back into the collection tube.
7. Add 700 µL of Wash buffer NT3 to the column and incubate 1-2 minutes at room temperature.
8. Centrifuge at 11,000 x g for 30 seconds, discard the flow-through and place the column back into the collection tube.
9. Repeat the wash step again and dry spin the column at 11,000 x g for 1 minute to remove any residual ethanol from the wash buffer.
10. Incubate the column at 50°C for 1-2 minutes to ensure the complete evaporation of any residual ethanol.
11. Place the NucleoSpin® column into a clean 1.5 mL microcentrifuge tube.
12. Add 15-30 µL of pre-heated elution buffer NE (or nuclease-free water) directly onto the center of the membrane.
13. Incubate at room temperature for 1-2 minutes.
14. Centrifuge at 11,000 x g for 1 minute to elute the DNA.
15. Store the purified DNA at -20°C for long-term storage.
1. AGAROSE GEL ELECTROPHORESIS
1.1 To prepare 1% agarose gel
1. Add 0.7 g of agarose powder to 70 mL of 1X TAE buffer.
2. Heat the mixture in the microwave for 1 minute or until the agarose is fully dissolved.
3. Allow the agarose solution to cool for 5 minutes.
4. Carefully add 5 µL of ethidium bromide to the gel. Avoid any skin contact.
5. Pour the cooled agarose solution into the casting tray. Ensure it covers the base of the tray evenly.
6. Place the comb and allow it to set for 20 minutes.
7. Once the gel is set, gently remove the comb to create wells.
8. Mix DNA samples with loading dye (usually a 1:5 ratio), and load the DNA samples and the DNA ladder into the gel wells.
9. Place the gel in the electrophoresis tank and add enough 1X TAE buffer to cover the gel.
10. Set the voltage to 80V and run the gel until the samples are sufficiently resolved.
1.2 To visualise the gel
1. Place the gel on a UV transilluminator to visualise the DNA bands.
2. Use appropriate protective measures when working with UV light.
2. SDS PAGE
2.1 Prepare the gel
| COMPONENT | 12% RESOLVING GEL | 5% STACKING GEL |
|---|---|---|
| Distilled Water | 3.3 ml | 2.75 ml |
| 30% Acrylamide-Bis | 4 ml | 0.65 ml |
| Tris HCl | 2.5 ml (1.5M, pH8.8) | 0.5 ml(0.5M, pH 6.8) |
| 10% SDS | 0.1 ml | 0.1 ml |
| 10% APS(Freshly made) | 0.1 ml | 40 ul |
| TEMED | 30 ul | 4 ml |
2.2 Casting the gel
1. Set the SDS apparatus and make sure there is no leakage.
2. Mix the components mentioned above in the required amounts to prepare 12% resolving gel.
3. Add APS and TEMED at the end to initiate polymerisation.
4. Pour the resolving gel solution between glass plates, layer with butanol and let it polymerise for 20-30 minutes.
5. Mix the components to make a 5% stacking solution.
6. Pour the stacking gel solution over the resolving gel.
7. Insert the comb to create wells.
8. Allow the stacking gel to polymerise for 20-30 minutes.
9. Remove the comb once it solidifies.
2.3 Running the gel
1. Place the gel in the electrophoresis apparatus.
2. Fill the inner and outer chambers with 1X running buffer.
3. Load the prepared protein samples and protein ladder into the wells.
4. Attach the apparatus to the power supply and run the gel at 100V until the dye front reaches the bottom of the gel.
3. WESTERN BLOT
1. After SDS-PAGE, carefully remove the gel from the electrophoresis apparatus and soak it in the transfer buffer for 10 minutes to equilibrate.
2. Activate the PVDF membrane by soaking it in 100% methanol for 30 seconds, then rinse with milliQ and equilibrate in transfer buffer for 10 minutes.
3. Assemble the transfer sandwich: sponge, filter paper, gel, membrane, filter paper, sponge.
4. Make sure to wet the sponge and filter paper before placing the gel and ensure no air bubbles are trapped between the gel and the membrane.
5. Place the setup inside the transfer apparatus and fill it with a transfer buffer.
6. Transfer the proteins at 100V for 1-2 hours at 4°C.
7. Once the transfer is complete, remove the membrane and briefly rinse it in TBS-T.
8. Place the membrane in a blocking buffer for 1 hour at room temperature with gentle shaking to prevent non-specific binding.
9. Add primary antibodies diluted in the preffered ratio in the blocking buffer and seal the membrane in a plastic cover.
10. Keep it overnight at 4 degree celsius with gentle rotation.
11. After incubation, decant the primary antibody and wash the blot with 1X TBST shaking for two times 5 minutes each. Then wash the membrane with 1X TBS with shaking for 10 minutes once.
12. Add secondary antibody, diluted in the preffered ratio, in blocking buffer and seal the membrane in a plastic cover.
13. Keep it for 1-hour incubation at room temperature with gentle rotation.
14. After incubation, decant the secondary antibody and wash the blot with 1X TBST shaking for two times 5 minutes each. Then wash the membrane with 1X TBS with shaking for 10 minutes once.
1. GCMS (Gas Chromatography-Mass Spectrometry)
Gas Chromatography-Mass Spectrometry (GC-MS) is an analytical technique that combines the features of gas chromatography (GC) and mass spectrometry (MS) to identify and quantify compounds in complex mixtures. GC separates volatile compounds based on their retention times as they travel through a column, while MS provides detailed information on the molecular structure by ionising and fragmenting the compounds and analysing their mass-to-charge ratios. We performed GC-MS to analyse and confirm the production of our desired compounds santalene and santalol, providing both qualitative and quantitative insights essential for our metabolic engineering work.
1.1 Cell Lysis
1. Harvest the bacterial culture by centrifugation and remove the supernatant.
2. Transfer the pellets to a falcon.
3. Add acid-washed glass beads to the falcon. (Acid-washing typically involves treating the beads with a strong acid and thoroughly washing with distilled water. Ensure they are completely dry before use.)
4. Add 2 ml of hexane to it.
5. Vortex the tube at high speed for 1-3 minutes and let it set.
6. Carefully decant the hexane layer containing the soluble cellular components without disturbing the glass beads and debris pellet into a clean GC-MS vial.
7. Set up in the GC-MS apparatus.