Validation of plasmid construction by enzymatic digestion experiments

experimental step：

Reaction system: total volume 20 μL NcoⅠ:1μL HindⅢ:1μL 10×H Buffer:2μL Plasmid DNA: 10μL ddH2O :6μL

Reaction conditions:

Temperature 37°C, enzyme digestion for 3 hours. 1. Agarose gel electrophoresis to detect the results of enzyme digestion Prepare 1% agarose gel (containing 0.5μg/mL nucleic acid dye), electrophoresis at 90V for 30 min. 2. UV transilluminator to observe the results (lane 1: original plasmid; lane 2: plasmid digested by restriction endonuclease.

Preparation of Escherichia coli receptor cells

Experimental Steps:

Preparation:

Configuration and sterilization of 0.05mol/L CaCl2 solution, 0.05mol/L CaCl2 solution containing 15% glycerol; E. coli BL21, E. coli S17-1 plate delineation to ensure single colonies 1、Pick single colony from the plate and incubate it in 5ml LB medium overnight. 2, Take 100ul of bacterial solution and add it into 10mL LB medium. Shake at 220 rpm for about 3-5 hours to make OD600 between 0.4~0.5. 3、Sub-transfer the bacterial solution into 1.5ml centrifuge tubes (one tube of 10ml bacterial solution can be divided into about 6 tubes of 1.5ml centrifuge tubes), place on ice for 10 minutes, and centrifuge at 3000g for 10 minutes at 4℃. 4. Discard the supernatant, gently suspend the cells with 200 μL of pre-cooled 0.05 mol/L CaCl2 solution, and place on ice for 10 min. The cells were suspended in 200 μL of pre-cooled 0.05 mol/L CaCl2 solution, placed on ice for 30 min, and then centrifuged at 3000g for 10 min at 4℃. 5. Discard the supernatant, add 200 μL of pre-cooled 0.05 mol/L CaCl2 solution containing 15% glycerol, gently suspend the cells, and place on ice for a few minutes to form a sensory cell suspension. The cells were kept on ice for a few minutes to form a sensory cell suspension. Plasmid transformation

Transformation of plasmids

Experimental steps:

1, 10μL of recombinant plasmid was mixed with 50μL of susceptible E. coli BL21 2、Mix the recombinant plasmid with the receptor cells in an ice bath for 30min. 3、Hot excitation at 42℃ for 90s, and then ice bath for 2-3min. 4、Add 500μl of LB medium, 37℃, 220rpm, incubate for 1-2h. 5、Take 200μL and spread it evenly on LB solid medium containing 100μg/ml Kana, incubate at 37℃ inverted overnight.

Screening of positive clones

Experimental steps:

1 Pick the overnight cultured colonies (2 parallels per plate) into the LB liquid medium containing 100μg/ml Kana, 37℃, 150rpm, overnight culture, prepare the seed solution, and then carry out bacterial liquid PCR for verification. 2 Bacterial liquid PCR: take 2μL of bacterial liquid on the ultra-clean bench, add 100μL of ddH2O, mix well, and boil in a 100℃ water bath for 15min.

3 20μL system Bacterial liquid: 4μL Upstream primer: 1μL Downstream primer: 1μL Master mix:6μL ddH2O:8μL (Upstream primer: ATGGCAAGCGAAGAAATGGAAC) Downstream primer: TTAACCCACTGCGCCTTCAAG) PCR Parameters. 95°C pre-denaturation:5min➔main cycle 94°C:30s➔55°C:30s➔72°C:2min cycle 30 times➔72°C:10min➔4°C:50min

Expression of target genes

The activated engineering bacteria were pre-cultured 37°C overnight. Growth at 1% inoculum reached 0.6 ≤ OD600 ≤ 0.8 at 37°C. 0.1 mM IPTG was added (no IPTG was added to the control group) and growth was carried out at 30°C for 2 hrs. The experimental group with OD600 ±1.0, diluted the above bacterial solution with LB at 0.01% inoculum. The growth was observed every 12h by inoculating into 8% NaCl, pH=8 LB plates at an inoculum of 50μl.

Protein detection

Take 30ml of the induced bacterial solution,at 4℃,,centrifuge for 5min (5000g). Discard the supernatant and add 1% lysozyme containing 1mg/ml. Then freeze and thaw three times: at 37℃ for 5min, and then at -80℃ for 5min. ultrasonic cell crusher was used to sonicate for 3s, stop for 3s, and work for 20min (power: 40%, 360W), and the obtained solution was centrifuged at room temperature for 10min, and the supernatant was taken as the upper sample solution, and electrophoresis was performed.

Salt concentration shake flask test

Procedure: inoculate the induced bacterial solution at 1% inoculum into 250 ml conical flasks. (100 ml sample volume)

Control group: A wild-type Dh5α (WT) medium without kana, B empty (EV) medium with kana.

Experimental group: E coli. Dh5α-pET-28a(+)-LS21sufB(LSD) medium with kana.

Note: The addition of the antibiotic kana to the medium of the empty and experimental groups serves to prevent contamination by stray bacteria.

Determination of salinity tolerance of engineering bacteria

Engineering bacteria: E coli.BL21(DE3)-pET-28a(+)-LS21sufB .

Saline plate medium pH 8.5, diluted to 10-2 after induction, 30μL per compartment.