1. Mix 5 μL of DNA with 50 μL of DH5 alpha in a microcentrifuge tube. Gently mix by flicking the bottom of the tube with your finger a few times.
2. Incubate the DH5 alpha on ice for 30 minutes.
3. Place the tube into a 42 °C water bath for 45 seconds then place it back on ice for 2 minutes.
4. Add 950 μL SOC medium(without antibiotic) to the bacteria and grow in a 37 °C incubator for 45 minutes.
5. Centrifuge the cells in 8,000 xg for 4 minutes. Discard the supernatant and resuspend the pellet.
6. Plate all the bacteria onto a LB agar plate and incubate it at 37 °C overnight.

Materials

• DH5 alpha
• Plasmid
• Kanamycin, 50 μg/mL
• LB agar plate (with Kanamycin)
• SOC medium

1. Place a suitable amount of LB broth with correct concentration of antibiotic (40 μL kanamycin/mL) into a conical flask. The liquid to air ratio should be at least 1:3.
2. Use a sterile pipette tip to touch a bacterial colony that is away from other growth and put the tip into the conical flask.
3. Culture the medium overnight in an incubated orbital shaker, which should be set in 37 °C, 200 rpm.

Materials

• LB agar plate with DH5 alpha
• LB medium
• Kanamycin, 50 μg/mL

1. Pellet 1.5 mL of bacteria by centrifugation for 30 seconds.
2. Discard supernatant and resuspend the pellet in 200 μL Plasmid Resuspension buffer (B1). Pipette up and down to ensure the cells are completely resuspended.
3. Lyse cells by adding 200 μL Plasmid Lysis Buffer (B2) and invert the tube gently for 5-6 times until the solution changes to dark pink and is clear and viscous. Incubate for 1 minute.
4. Neutralize the lysate by adding 400 μL Plasmid Neutralization Buffer (B3). Gently invert the tube until the color is uniformly yellow and a precipitate forms. Incubate for 2 minutes, then centrifuge for 3 minutes
5. Carefully transfer the supernatant to the spin column and centrifuge for 1 minute. Discard the flow-through in the collection tube.
6. Re-insert the column into the collection tube and add 200 μL Plasmid Wash Buffer 1. After that, incubate for 5 minutes.
7. Centrifuge for 1 minute then discard the flow-through in the collection tube.
8. Re-insert the column into the collection tube and add 400 μL Plasmid Wash Buffer 2, then centrifuge for 1 minute.
9. Transfer the column into a clean 1.5 mL microcentrifuge tube and add 30 uL DNA Elution Buffer. Wait for one minute then centrifuge for one minute.

Notes:

1. All incubation should be done at 35 °C
2. All centrifugation steps should be carried out at 16,000 x g
3. Store Plasmid Neutralization Buffer (B3) at 4 °C after opening

Materials

• Monarch@ Plasmid Miniprep Kit

pipette

pipette tip

microfuge tube

incubator

centrifuge

1. Mix the following components in a 1.5 mL microcentrifuge tube. Mix the components gently by pipetting and spin down.

Component	Amount
Extracted DNA	3 μg
BamHI	3 μL
HINDIII	3 μL
10x Fastdigest Buffer	6 μL
Nuclease-free Water	To 60 μL

2. Incubate the microcentrifuge tube at 37 °C for 45 minutes in a heat block. Then heat the tube at 80 °C for 5 minutes.

Materials

• Extracted DNA
• Restriction enzyme BamHI
• Restriction enzyme HINDIII
• 10x Fastdigest Buffer

Instruments required:

• pipette
• pipette tip
• ice bucket
• microfuge tube

Apparatus required:

• incubator

Setting up an agarose gel

1. Setting up an agarose gel

1. Mix 0.26 g agarose with 26 mL 1x TAE buffer
2. Microwave the bottle of solution for 1-2 minutes and swirl around to ensure no white precipitates are present in the solution
3. Cool down the solution by placing the bottle under running water for 1 minute
4. Add 1 μL DNA Stain to the solution and swirl it to completely dissolve the stain
5. Pour the solution into the casting tray and insert the comb onto the top of the gel. Avoid bubbles.

b. Preparing DNA samples and DNA ladder

1. Remove the comb from the gel and add 1x TAE buffer until the gel is fully covered
2. Mix 4 μL DNA ladder with 6 μL 10X BlueJuice Gel Loading Buffer and add it to the well.
3. Dilute the DNA samples with 10X BlueJuice Gel Loading Buffer and add the samples to the well. (Volume of loading dye:Volume of DNA = 1:9)
4. Perform gel electrophoresis at 120 V for 20-30 minutes
5. Visualize the results with a blue light

Materials

• Agarose
• 1x TAE Buffer
• DNA Stain
• 1 Kb Plus DNA Ladder
• 10X BlueJuice Gel Loading Buffer

Instruments required:

• pipette
• pipette tip
• ice bucket
• microfuge tube

Apparatus required:

• incubator

1. Cut the gel slice containing the DNA fragment and place it in a 1.5 mL microcentrifuge tube. Minimize the gel volume
2. Add 1:1 volume of binding buffer to the gel slice and incubate the gel mixture at 55 °C heat block for 10 minutes, until the gel slice is completely dissolved.
3. Transfer up to 800 μL gel solution to the GeneJET purification column and centrifuge for 2 minutes.
4. Discard the flow-through in the collection tube then re-insert the column into the tube. Add 700 μL Wash Buffer to the GeneJET purification column and centrifuge for 2 minutes.
5. Discard the flow-through in the collection tube then re-insert the column into the tube. Continue to centrifuge until the wash buffer is completely removed.
6. Transfer the GeneJET purification column into a clean 1.5 mL microcentrifuge tube and add 50 μL elution buffer to the tube. Centrifuge for 2 minutes
7. Discard the GeneJET purification column and store the purified DNA -20 °C

Notes:

All centrifugation steps should be carried out at 16,000 x g

Materials

• GeneJET Gel Extraction Kit

1. Place the following components in a 1.5 mL microcentrifuge tube on ice. The volume of the components can be adjusted if the volume of DNA is too small. (Reduce all of the volumes by half)

The T4 DNA Ligase should be added last.

Component	Volume for a 40 μL reaction
Plasmid pENTR1A	20 fmol
GOI	60 fmol
5x T4 DNA Ligase Reaction Buffer	4 μL
T4 DNA Ligase	2 μL
Nuclease-free Water	to 40 μL

1. Gently mix the solution by pipetting up and down. Then centrifuge briefly to bring the contents to the bottom of the tube.
2. Incubate the solution at room temperature for 5 minutes.
3. Use 2 μL solution to transform 100 μL DH5 alpha.(Refer to 1.1 Bacterial Transformation)

Materials

• 5x T4 DNA Ligase Reaction Buffer
• T4 DNA Ligase
• Plasmid pENTR1A and GOI

1. Prepare PCR Master Mix and dispense it into each PCR tube

Component	Volume per reaction
PCR Master Mix (2x)	10 μL
Primer pENTR-F (ctacaaactcttcctgttagttag)	0.5 μL
Primer pENTR-R (caaggggtgttatgagccat)	0.5 μL
Water	9 μL

2. Use a sterile micropipette tip to transfer cells from each colony to a PCR tube and briefly resuspend them in the PCR Master Mix.
3. Amplify the target DNA with the following thermocycling conditions:

Step	Temperature	Time	Cycle
Cell Lysis	95 °C	3 Minutes	1
Denaturation	95 °C	30 Seconds	35
Annealing	45.7 °C	30 Seconds
Extenson	72 °C	4.5 Minutes
Final Extension	72 °C	10 Minutes	1
Hold	4 °C	Indefinitely

4. Perform gel electrophoresis to visualize the result (Refer to 1.5 Gel Electrophoresis)

Materials

• PCR Master Mix (2x)
• Primers

• pENTR-F (ctacaaactcttcctgttagttag)

• pENTR-R (caaggggtgttatgagccat)

1. Add 20 μL/well of medium from the transfected cells within 72 hours after transfection to a black opaque 96-well plate. (For Transfection Protocol, please refer 3.4 Transfection)
2. Add 50 μL of coelenterazine working solution to each well and detect the light output immediately

Materials

• Pierce™ Gaussia Luciferase Flash Assay Kit
• Black Opaque 96-well Plate

1. Remove original culture medium and add 100 µL of fresh medium
2. Add 10 µL of the 12-mM MTT solution to each well. Include a negative control by adding 10 µL of the MTT solution to 100 µL of medium alone.
3. Incubate at 37°C for 2–5 hours.
4. Remove 85 µL of medium from the wells.
5. Add 50 µL of DMSO to each well, then pipet up and down thoroughly to mix.
6. Incubate at 37°C for 10 minutes.
7. Pipet up and down to mix each sample again, then read the absorbance at 540 nm.

Materials

• MTT Cell Viability Assay Kit
• PBS
• DMSO
• Complete culture medium

Procedure

1. Supplement RPMI 1640 medium with FBS to final concentration of 10%, store the complete medium in the fridge
2. Place the culture vessel containing complete growth medium into a 37 °C 5% CO2 incubator for at least 15 minutes.
3. Warm the cell vial by gentle agitation in a 37 °C water bath until the contents are thawed.
4. Transfer thevial contents to the centrifuge tube containing 9.0 mL complete growth medium drop by drop.
5. Centrifuge at 125 x g for 7 minutes and discard supernatant.
6. Add 1 mL complete growth medium to the centrifuge tube and resuspend the cell by pipetting up and down.
7. Dispense it into a 75 cm2 culture flask and rock the flask gently back and forth.
8. Incubate the flask in a 37 °C 5% CO2 incubator.

Materials

• RPMI 1640 Medium
• Fetal bovine Serum (FBS)

Procedure

1. Add heat inactivated FBS to final concentration of 10% and BPE to final concentration of 0.3% to 500 mL of basal medium.
2. Mix the medium by pipetting up and down gently and store the complete medium in the fridge.
3. Place the culture vessel containing complete growth medium into a 37 °C 5% CO2 incubator for at least 15 minutes.
4. Warm the cell vial by gentle agitation in a 37 °C water bath until the contents are thawed.
5. Transfer the vial contents to the centrifuge tube containing 9.0 mL complete growth medium.
6. Centrifuge at 125 x g for 8 minutes and discard supernatant.
7. Add 1 mL complete growth medium to the centrifuge tube and resuspend the cell by pipetting up and down.

Materials

• NPMM neural Progenitor Maintenance Medium Bullet Kit
• Fetal Bovine Serum (FBS)
• Bovine Pituitary Extract (BPE)

Procedure

1. Remove the medium from the culture flask in the incubator
2. Add 0.25% Trypsin in 0.03% EDTA Solution into the flask and rock the flask gently to rinse
3. Remove the solution with a pipette gun and add an additional 1 mL trypsin-EDTA solution
4. Place the flask at room temperature and observe under microscope until cells start to round up.
5. Add fresh culture medium to the flask. Aspirate and dispense into new culture flasks.
6. Gently rock the flask back and forth to disperse cells evenly.
7. Incubate the flask in a 37 °C 5% CO2 incubator.

Materials

• Complete growth medium
• 0.25% Trypsin in 0.03% EDTA Solution

Procedure

1. Remove the medium from the flask and briefly rinse the cell layer with 0.25% trypsin, 0.53 mM EDTA solution by rocking.
2. Remove the solution from the flask with a pipette gun.
3. Add 2 mL trypsin-EDTA solution to the flask.
4. Observe the cells under the microscope until the cell layer is dispersed and the cells round up
5. Add 8 mL complete medium and aspirate cells by gently pipetting.
6. Transfer the cell suspension to a centrifuge tube and centrifuge at 250 x g for 10 minutes. Discard supernatant.
7. Add fresh complete medium to the tube and gently pipette the cells up and down to resuspend the cell pellet.
8. Add the cell suspension to new poly-L-lysine and laminin coated culture vessels.
9. Incubate the flask in a 37 °C 5% CO2 incubator.

Materials

• Complete growth medium
• 0.25% Trypsin, 0.53 mM EDTA Solution

Procedure

1. Dilute the poly-D-lysine solution with sterile DPBS to prepare a 50 μg/mL working solution
2. Coat the surface of 75 cm2 culture vessel with 11.7 mL working solution of poly-D-lysine
3. Incubate the vessel at room temperature for an hour then remove the poly-D-lysine solution with a pipette gun.
4. Rinse culture surface for 3 times with 24 mL distilled water and remove it from the flask.
5. Leave the coated culture vessel uncovered in the biosafety cabinet to dry for 2 hours. Afterwards, the flask can be used immediately or store at 4°C
6. Dilute the thawed laminin solution to 3 μg/mL with sterile distilled water.
7. Add laminin solution into poly-D-lysine coated culture vessel to cover the whole surface.
8. Incubate and store in a 37°C 5% CO2 incubator.
9. Aspirate laminin solution from coated culture vessel and let it dry right before seeding cells.

Materials

• Complete growth medium
• 0.25% Trypsin, 0.53 mM EDTA Solution

Procedure

1. Plate around 10,000 cells/well in a 96-well palte and incubate the plates overnight at 37 °C 5% CO2
2. Aspirate medium off cells and add 2-3 mL PBS to wash
3. Aspirate off PBS and add 8 mL of 10% FBS in OptiMEM media to each of the plates.
4. Incubate for 30 minutes at 37 °C
5. Mix the following components and incubate it in the biosafety cabinets for 5 minutes

• A Tubes: Add selected DNA and add OptiMEM to 100 μL
• B Tubes: Add lipofectamine 2000 and add OptiMEM to 100 μL

1. Add Component B to Component A by gently bubbling and mixing. Incubate at room temperature for 30 minutes
2. Drip 200 μL solution mixture onto cells and gently mix the media on cells
3. Incubate at 37 °C for 6 hours. Then remove Opti-MEM media containing mixtures of A and B
4. Add 8 mL fresh culture medium per plate of 10% FBS/DMEM with antibiotics
5. Incubate and store in a 37 °C 5% CO2 incubator.

Materials

• 10% FBS in OptiMEM
• OptiMEM
• 1 x PBS
• Lipofectamine 2000

Procedure

1. Remove the cells from the incubator and view each flask under microscope to determine percent cellular confluence
2. Carefully remove the media without disturbing the monlayer
3. Add 15 mL fresh, pre-warmed complete growth medium to the flask and return the flask to the incubator.
4. Keep changing medium until subculturing is needed.

Materials

• Complete growth medium