Contents

    Let's start PLASTID  PESTICIDES™ journey into PlantSynBio!

    Part:BBa_K5044310 - Plastid Transformation Vector for Kiwifruit (pQQC7)

    • Description: This plasmid part is a plastid transformation vector specifically designed for kiwifruit. It aims to introduce foreign DNA directly into the plastids, which can offer higher expression levels and reduce the risk of transgene escape due to maternal inheritance.
    • Purpose: The pQQC7 vector may carry specific genes or reporter genes to improve traits in kiwifruit, such as enhancing disease resistance or improving nutritional content.
    • Design Context: This part was carefully designed following the guidelines and principles of plant synthetic biology from iGEM, after extensive practical experimentation.

    Part:BBa_K5044317 - amiR-CHS1, an Artificial microRNA Targeting Chitin Synthase 1 of Spodoptera litura by HUBU-China PLASTID

    • Description: This part, developed by the HUBU-China team, is an artificial microRNA (amiR) named amiR-CHS1. It is designed to target the chitin synthase 1 of the tobacco cutworm, Spodoptera litura.
    • Purpose: By expressing this specific amiRNA in plants, it can potentially disrupt the normal growth and development of the pest, thereby reducing the damage caused by S. litura and providing a promising strategy for biological control.
    • Design Context: Like the previous part, this construct was also designed in accordance with the plant-syn-bio guidelines and principles from iGEM, following significant experimental work.

    Background

    The global population is projected to surpass 9 billion by 2050, leading to an estimated 100-110% increase in the demand for crops compared to 2005. To meet the food requirements of this rapidly growing population, especially in the context of uncertain climate change and diminishing arable land, it is essential to enhance food production while reducing inputs. Traditional plant breeding methods are often labor-intensive and time-consuming, whereas genetic engineering offers a promising approach to boost crop productivity.

    Nuclear genome transformation has become a widely adopted technique in many economically important plant species. However, it comes with several limitations, such as unpredictable expression of the gene of interest and gene silencing due to the random integration of T-DNA. In addition to nuclear transformation, plants provide another avenue for genetic modification through the transformation of the small genomes of two DNA-containing cell organelles: plastids (chloroplasts) and mitochondria, which are derived from cyanobacteria and α-proteobacteria, respectively.

    Advantages of Plastid Transformation

    Plastid genomes in higher plants are highly conserved, typically around 150 kb in size, and encode approximately 130 genes. These genomes are composed of four parts: a large single-copy region, a small single-copy region, and two inverted repeat regions. Compared to conventional nuclear genetic engineering, transforming the plastid genome offers several significant advantages:

    1. Highly Precise Transgene Insertion: Efficient homologous recombination allows for precise and targeted insertion of transgenes into the plastid genome.
    2. High Levels of Protein Expression: The potential for expressing foreign proteins at extremely high levels, up to 75% of the total soluble protein, makes plastid transformation highly attractive for producing recombinant proteins.
    3. Multigene Engineering: The ability to stack multiple transgenes in synthetic operons in a single transformation event facilitates the engineering of complex traits.
    4. Absence of Epigenetic Effects: Plastid transformation avoids issues such as gene silencing and position effects, which are common in nuclear transformation.
    5. Increased Biosafety: Since plastids are generally not transmitted through pollen in most crops, there is a reduced risk of transgene spread, enhancing biosafety.

    Applications of Plastid Transformation

    Given these advantages, plastid transformation has been used to engineer various economic and agronomic traits, including:

    • Production of Recombinant Proteins and Enzymes: Plastids can be used to produce pharmaceutical proteins and industrial enzymes.
    • Resistance to Biotic and Abiotic Stresses: Enhanced resistance against insect pests, viral, fungal, and bacterial diseases, as well as tolerance to abiotic stresses like salt, drought, and cold.
    • Herbicide Resistance: Improved resistance to herbicides, facilitating weed management.

    Historical Development and Current Status

    The first successful plastid transformation was achieved in Chlamydomonas reinhardtii, a unicellular green alga, followed by Nicotiana tabacum (tobacco), a dicotyledonous flowering plant. Since then, plastid transformation technology has been extended to over 20 species of flowering plants. However, reproducible protocols for achieving homoplastic offspring are currently limited to a few species, including tobacco, potato, tomato, cabbage, soybean, lettuce, poplar, and licorice weed.

    Cereals, the world's most important food crops, have proven to be recalcitrant to chloroplast transformation. This is primarily due to the lack of suitable selectable systems, low shoot regeneration frequencies, and the absence of effective cis-elements for transgene expression in non-green plastids. Although plastid transformation in rice has been reported, no homoplasmic and fertile transplastomic rice lines have been obtained. Recently, a high-efficiency plastid transformation protocol for the model plant Arabidopsis thaliana has been developed. This protocol relies on a root-based selection and regeneration system, along with the use of acc2 knockout lines, which significantly enhances the efficiency of plastid transformation.

    In summary, the development of efficient and reliable HUBU-China's PLASTID transformation protocols in a wider range of plant species, including kiwifruit, holds great promise for addressing the challenges of global food security and advancing the field of plant synthetic biology.

    Stable Plastid Transformation in Kiwifruit (Actinidia chinensis)

    Introduction

    Transformation of the plastid genome, also known as transplastomics, offers a number of advantages over conventional nuclear transformation, including extremely high levels of transgene expression, the absence of gene silencing, and the ability to stack multiple transgenes. This technology was first established in the unicellular alga Chlamydomonas reinhardtii and later in tobacco. Over the past three decades, it has been extended to more than 20 seed plants, but major crops such as rice, wheat, and maize have not yet been successfully transformed. Poplar is currently the only woody species that has been subjected to plastid transformation.

    Kiwifruit (Actinidia chinensis) is a valuable crop with a high content of vitamin C and other beneficial metabolites. Although nuclear transformation in kiwifruit has been routine for several years, plastid transformation has not been reported until now. The development of a plastid transformation system in kiwifruit would enable efficient production of recombinant proteins, edible vaccines, and biopharmaceuticals, and provide a tool to study the complex inheritance patterns of plastids in this species.

    In this work, PLASTID PESTICIDES™ present an efficient protocol for the stable transformation of the plastid genome in kiwifruit, which includes the optimization of plant regeneration, selection, and DNA delivery methods, as well as the construction of a specific plastid transformation vector. The successful establishment of this protocol extends transplastomic technology to another woody species and opens up new possibilities for synthetic biology applications in kiwifruit.

    Methods

    Optimization of Plant Regeneration and Selection System

    To develop an effective leaf-based regeneration and selection system, PLASTID PESTICIDES™ tested various media compositions. The optimal medium, AcReM3, containing 1 mg L-1 thidiazuron (TDZ), 2 mg L-1 6-benzyladenine (6-BA), and 1 mg L-1 α-naphthalene acetic acid (NAA), was selected based on its ability to induce the maximum number of shoots from young leaf explants.

    For the selection of plastid-transformed kiwifruit, the spectinomycin-resistance gene aadA was used as a selectable marker. The appropriate concentration for selection was determined by cultivating leaf explants on media supplemented with different concentrations of spectinomycin. A concentration of 300 mg L-1 spectinomycin was found to be effective in suppressing background growth while allowing the growth of transformants.

    Construction of the Plastid Transformation Vector

    The plastid transformation vector, pQQC7, was constructed to carry both the aadA selectable marker and a green fluorescent protein (GFP) reporter gene. The aadA gene, under the control of the psbA promoter from Chlamydomonas reinhardtii, confers resistance to spectinomycin. The GFP gene, driven by the 16S rRNA promoter from tobacco, serves as a visual marker for transformation. Both cassettes are flanked by kiwifruit-specific sequences to allow targeted insertion into the plastid genome between the trnfM and trnG genes.

    Biolistic DNA Delivery and Selection of Transplastomic Plants

    Leaf explants were bombarded with the pQQC7 plasmid using optimized parameters, including a rupture disk pressure of 1100 psi and a target distance of 9 cm. After bombardment, the explants were placed on a selective medium containing 300 mg L-1 spectinomycin. Primary spectinomycin-resistant calli appeared after three months, and six independent transplastomic lines were obtained from 12 plates. These lines were further propagated and regenerated to achieve homoplasmy, and then transferred to soil.

    Results

    Optimization of Plant Regeneration and Selection System for Kiwifruit

    To develop an efficient leaf-based regeneration and selection regime for kiwifruit, PLASTID PESTICIDES™ first sought to identify the optimal medium composition for regeneration. Small pieces of leaf explants (5 × 5 mm) were placed on five different regeneration media, referred to as AcReMs (Table 1), to determine the most suitable medium for inducing shoots from young leaf explants.

    Table 1. Comparison of Different Hormone Combinations on Callus Induction and Shoot Regeneration from Leaves of 'Hongyang' Kiwifruit

    MediumTDZ (mg L−1)6-BA (mg L−1)NAA (mg L−1)Number of Explants InoculatedCallus Induction Efficiency (%)Budding Rate (%)Number of Shoots per Explant
    Control---48000
    AcReM12-1481001007.88 ± 2.23 a
    AcReM2221481001008.00 ± 3.13 a
    AcReM31214810010014.13 ± 10.25 b
    AcReM4-21481001005.56 ± 3.13 a
    AcReM5-31481001004.84 ± 2.59 a

    Data were recorded after 60 days of culture for callus induction. Values are mean ± SEM. Different lowercase letters in the same column data indicate significant difference (P<0.05).

    After 60 days of culture, green calli were induced on all the AcReMs. The maximum number of shoots was observed on AcReM3, which contained a combination of 1 mg L−1 thidiazuron (TDZ), 2 mg L−1 6-benzyladenine (6-BA), and 1 mg L−1 α-naphthalene acetic acid (NAA). This medium provided the highest shoot regeneration rate, with an average of 14.13 shoots per explant, significantly higher than the other media tested (Table 1).

    Selection of Plastid-Transformed Kiwifruit

    For the selection of plastid-transformed kiwifruit, PLASTID PESTICIDES™ utilized the spectinomycin-resistance gene aadA as a selectable marker, a strategy that has been successfully employed in plastid transformation of many plant species (Bock, 2015; Liu et al., 2023). To determine the appropriate concentration of spectinomycin for effective selection, leaf explants were cultured on AcReM3 supplemented with various concentrations of spectinomycin (0, 100, 150, 200, 250, and 300 mg L−1).

    After 60 days of selection, partial green calli could be observed on AcReM3 containing up to 150 mg L−1 of spectinomycin. However, at 200 mg L−1, the leaf explants were completely bleached, indicating that this concentration effectively suppressed non-transformed growth (Fig. 1A). To ensure robust suppression of background growth and enhance the selectivity for transplastomic lines, a higher spectinomycin concentration of 300 mg L−1 was chosen for further selection of the kiwifruit transplastomes (Ruf et al., 2019).

    These results provide a solid foundation for the development of an efficient HUBU-China PLASTID transformation protocol in kiwifruit, enabling future applications in plant synthetic biology.

    Optimization of Biolistic DNA Delivery Parameters

    To optimize the biolistic DNA delivery parameters, a nuclear transformation vector containing the β-glucuronidase (GUS) gene cassette was employed. Based on transient GUS expression results, it was determined that a 1100 psi rupture disk was optimal for DNA delivery when the target distance was kept constant at 6 cm (Fig. 1B). Further studies on the effect of target distance indicated that the highest GUS expression was achieved at a distance of 9 cm (Fig. 1C). Therefore, for plastid transformation, leaf explants were bombarded with 1100 psi at a distance of 9 cm.

    Fig. 1. Optimization of selection and parameters for kiwifruit transformation with gene gun.

    Different letters above the bars indicate the significant of different as determined by Dunnett’s T3-test values (p < 0.05).

    • (A) Sensitivity test of leaf explants from wild-type kiwifruit to various spectinomycin concentrations regenerated on AcReM3, 60 days after selection.
    • (B) Effects of acceleration pressure on the results of GUS transient assays.
    • (C) Effects of target tissue distance on the results of GUS transient assays.

    Construction of kiwifruit plastid transformation vector

    To construct the kiwifruit plastid transformation vector, pQQC7, PLASTID PESTICIDES™ amplified species-specific flanking sequences from kiwifruit genomic DNA (Fig. 2). In the pQQC7 vector, the marker gene GFP (green fluorescent protein) is driven by the tobacco plastid 16S rRNA promoter, which is fused with the 5′ untranslated region (UTR) from gene10 of bacteriophage T7 (NtPrrn:T7g10). The selectable marker gene aadA, which confers resistance to spectinomycin, is controlled by the psbA promoter from Chlamydomonas reinhardtii combined with 5′ UTR from T7g10 (CrPpsbA:T7g10). The GFP and aadA cassettes are integrated into the trnfM/trnG intergenic region of the kiwifruit plastid genome (Fig. 2; Fig. 3A).

    Fig. 2 Generation of kiwifruit plastid transformation pQQC7.

    Production and analyses of transplastomic kiwifruit plants

    After placed on an osmotic medium (AcOsM) in the dark overnight (Fig. 3B), sterile kiwifruit leaves were bombarded with plasmid pQQC7 using a 1100 psi rupture disk at target distance of 9 cm. Primary spectinomycin-resistant green calli began to appear after three months of incubation of bombarded leaf explants on AcReM3 including 300 mg L−1 spectinomycin. Consequently, primary spectinomycin-resistant calli started to appear after three months. After six months of selection, six green calli were obtained from 12 plates (Fig. 3D). Six independent transplastomic lines (Ac-pQQC7) underwent elongation and multiplication on shoot multiplication medium (AcSmM) containing 300 mg L−1 spectinomycin (Fig. 3E,F). To achieve homoplasmy, the young leaves of these transplastomic lines underwent additional rounds of regeneration (Fig. 3G,H). After induction of rooting (Fig. 3I,J), the transplastomic lines were transferred to soil and did not exhibit any discernible phenotypic difference when compared with the wild type (Fig. 3K).

    To confirm the presence of the transgene in the shoots, PLASTID PESTICIDES™ performed PCR using specific primers (GFP-F/GFP-R) designed for the GFP gene. This resulted in the amplification of a 720-bp PCR product (Fig. 3L), indicating the presence of the GFP gene. Moreover, PLASTID PESTICIDES™ designed a primer pair (psaB-aadA-F/psaB-aadA-R) to target the psaB region of the native chloroplast genome and the aadA marker, respectively. PCR amplification with these primers yielded a 2.9 kb product (Fig. 3M). Two PCR-positive lines (Ac-pQQC7#1, #6) were confirmed to have reached homoplasmy through Southern blot analysis. In the wild-type plants (Ac-WT), a 2.9 kb fragment was detected, while in the Ac-pQQC7, a 5.7 kb fragment corresponding to the integration of the transgene was observed (Fig. 3N).

    Fig. 3 Generation of plastid-transformed kiwifruit.

    (A) Physical maps of the targeting region in the kiwifruit plastid genome (ptDNA, left) and the plastid transformation vector pQQC7. NtPrrn: plastid 16S rRNA promoter from Nicotiana tabacum; CrPpsaA: psaA promoter from Chlamydomonas reinhardtii; T7g10: 5′ UTR of gene10 from bacteriophage T7.

    (B) Preparation of kiwifruit leaves for particle bombardment.

    (C) Bombarded leaf explants were exposed to AcReM3 containing spectinomycin. Spectinomycin was used to select for transplastomic lines. (D) Spectinomycin-resistant calli appeared after three months selection, indicating successful plastid transformation.

    (E,F) These calli were able to grow into shoots.

    (G, H) The leaves of these lines were subjected to additional rounds of regeneration in order to achieve homoplasmy.

    (I,J) Progression of shoot growth and root induction of transplastomic lines (Ac-pQQC7). Transplastomic lines showed normal shoot growth and development of roots. A timeline illustrating the estimated approximate duration of the individual steps in the protocol is given below. (K) Growth comparison between transplastomic Ac-pQQC7 and wild-type (Ac-WT) plants in a greenhouse. Transplastomic plants exhibited similar growth patterns to wild-type plants. (L,M) PCR amplification using GFP-specific primes and psaB-aadA-F/psaB-aadA, which yield 720 bp (L) and 2.9 kb (M) amplicons, respectively, confirmed the presence of the transgene in Ac-pQQC7 plants.

    (N) Southern blot analysis verified the homoplasmy of Ac-pQQC7. A ~ 5.7 kb signal was observed in Ac-pQQC7, while the untransformed plants showed a 2.9 kb band on hybridization with the psaB probe.

    Determination of GFP expression levels in transplastomic plants

    To examine GFP expression, PLASTID PESTICIDES™ performed a Northern blot using a hybridization probe specific for the GFP coding region. The blots revealed two transcripts, with the smaller and more abundant transcript representing the expected full-length GFP mRNA (Fig. 4A). To determine the accumulation level of GFP, PLASTID PESTICIDES™ conducted Western blot analysis using an anti-GFP antibody and a dilution series of recombinant GFP as a reference. The anti-GFP antibody successfully detected a 27 KDa GFP peptide, confirming GFP production in the transplastomic lines (Fig. 4B). Based on PLASTID PESTICIDES™ estimation, GFP accumulation reached approximately 2.5% of the TSP (Fig. 4C). Furthermore, the presence of GFP fluorescence specifically in chloroplasts confirmed its confinement to the chloroplast compartment in the leaves of the Ac-pQQC7 lines (Fig. 4D).

    Fig. 4. Analysis of GFP expression in transplastomic kiwifruit plants. (A) Northern blot analysis of the GFP transcripts. (B) Western blot analysis confirmed the accumulation of GFP in Ac-pQQC7 leaves using an anti-GFP antibody. The larger bands are likely the results of read-through transcripts owing to inefficient transcription termination in plastids (Lu et al., 2017; Zhou et al., 2007). (C) Semi-quantitative analysis of GFP accumulation in Ac-pQQC7 using a dilution series of recombinant GFP (rGFP). (D) Verificaiton of plastid GFP expression in leaf cells using confocal laser-scanning microscopy.

    Materials and Methods

    Plant materials

    The plant materials used in the experiment were derived from the mature fruits of ‘Hongyang’ kiwifruit (Actinidia chinensis cv. ‘Hongyang’) collected from the Center of Kiwifruit Breeding, Xianning, Hubei Province, China (Chen et al., 2022). Seeds of the mature fruit were sterilized and inoculated on Murashige-Skoog (MS) medium (Murashige and Skoog, 1962), containing 3% sucrose, 0.8% agar, and 0.5 mg/L gibberellin A3 (GA3). In vitro grown leaves of kiwifruit were used as the explants for plastid transformation.

    GUS assay for optimization of biolistic DNA delivery parameters

    To optimize the DNA delivery parameters, transient transformations were performed in which kiwifruit leaves were bombarded with a nuclear expression vector (De Marchis et al., 2009; Sidorov et al., 1999), which carries a GUS gene under control of the CaMV 35S promoter. For the GUS staining, the bombarded leaves were vacuum infiltrated for 5 min with freshly-prepared staining buffer (Jefferson, 1987). The stained samples were incubated overnight at 37 °C in dark and rinsed with 95% ethanol before taking photographs.

    Construction of kiwifruit plastid transformation vectors

    The reporter gene GFP and selective marker gene (aadA) cassettes of kiwifruit plastid transformation vector pYY34 derived from pYY11, which was similar with pYY12 except for a restriction enzyme site (Wu et al., 2017). The pYY11 was produced by co-transforming the backbone of pYY12 digested by NcoI and XbaI and GFP fused with ~30-bp homology amplified with prime pair GFP-NcoI-F/GFP-NotI-R (Fig. 2A).

    The pYY34 vector was generated by ligating four digested DNA fragments using T4 DNA ligase. These fragments included the backbone obtained by digesting pBluescripII KS(+) with SacI and KpnI, the GFP and aadA expression cassettes excised from pYY11 with SalI and SpeI (Wu et al., 2017), and the left homologous recombination region (LHRR, 1,092 bp) digested with KpnI and SalI and the right homologous recombination region (RHRR, 1,185 bp) digested with BlnI and SacI. The corresponding flanking sequences for homologous recombination were obtained by PCR amplification from the kiwifruit chloroplast genome (NCBI access number: NC_026690.1) using primer pairs (KpnI)AcLHRR-F/(SalI)AcLHRR-R and (BlnI)AcRHRR-F/(SacI)AcRHRR-R, respectively. For the construction of pQQC7, the CrPpsbA and aadA fragments were PCR amplified using primer pairs (ApaI)CrPpsbA-F/(g10)CrPpsbA-R and (g10)aadA-F/(SphI)aadA, respectively, using pYY34 as the template. Subsequently, an overlap-extension PCR was performed to obtain a CrPpsbA-aadA fragment separated by the 5′ UTR from gene10 of bacteriophage T7 (T7g10). Finally, both the CrPpsbA-aadA fragment and pYY34 were excised with ApaI/SphI and ligated to generate the pQQC7 (NCBI access number: PP816932; plasmid number: 221601, Addgene; Fig. 2B). The All the primers are listed in Table 2.

    Table 2 Primers used in this work. Recognition sequences of introduced restriction sites are underlined. The T7 promoter sequence is indicated in italics.

    NameSequence (5' to 3')Description and Use
    GFP-NotI-FCTTTAAGAAGGAGATATACCCATGGTGAGTAAAGGAGAAGAACTTTTCACTGForward primer for PCR amplification of GFP; the primer has 30 base overlapping regions (pYY11 construction).
    GFP-NotI-RAGCCTTTCGTTTTATTTGATGCGGCCGCTCATTGTACAGCTCGTCCATGCCReverse primer for PCR amplification of GFP; the primer has 30 base overlapping regions (pYY11 construction).
    (KpnI)AcLHRR-FGGTACCCGGTCTGGGCGTGGATGTTCForward primer for PCR amplification of left homologous recombination region (LHRR) of kiwifruit plastid genome; introducing a KpnI restriction site (pYY34 construction).
    (SalI)AcLHRR-RGTCGACCTTAAGCTCGAGCACCTCTTTTCCGTCCATCCCReverse primer for PCR amplification of LHRR of kiwifruit plastid genome; introducing a SalI restriction site (pYY34 construction).
    (BlnI)AcRHRR-FCCTAGGGCTAGCCCCGGGGGTAGAACCATTACACTATCACTGCCForward primer for PCR amplification of right homologous recombination region (RHRR) of kiwifruit plastid genome; introducing a BlnI restriction site (pQQC7 construction).
    (SacI)AcRHRR-RGAGCTCTCTGGCTTGGCTAGGTGGGATAReverse primer for PCR amplification of RHRR of kiwifruit plastid genome; introducing a SacI restriction site (pQQC7 construction).
    (ApaI)CrPpsbA-FGGGCCCGGTACCATAACTTCGForward primer for PCR amplification of the CrPpsbA and CrPpsbA-aadA fragments; introducing a ApaI restriction site (pQQC7 construction).
    (g10)CrPpsbA-RCCGCTTCCCCCATATGTATATCTCCTTCGATGTTAATTTTTTTAAAGTTTTAATTTCTCReverse primer for PCR amplification of the CrPpsbA fragment (pQQC7 construction).
    (g10)aadA-FCTTTAAAAAAATTAACATCGAAGGAGATATACATATGGGGGAAGCGGTGATCGCCGAAGForward primer for PCR amplification of the aadA fragment; the primer and (g10)CrPpsbA-R primer have 47 base overlapping regions (pQQC7 construction).
    (SphI)aadA-RGCATGCCCTAGACATTATTTGCCGACReverse primer for PCR amplification of the aadA and CrPpsbA-aadA fragments; introducing a SphI restriction site (pQQC7 construction).
    GFP-FATGGTGAGTAAAGGAGAAGAACForward primer for PCR amplification of GFP fragment (PCR assay).
    GFP-RTTACTTGTACAGCTCGTCCATReverse primer for PCR amplification of GFP fragment (PCR assay).
    AcpsaB-aadA-FGACGAGGCGGTACTTGTGAForward primer for PCR amplification of psaB-aadA fragment (PCR assay).
    AcpsaB-aadA-RCACTGCGGAGCCGTACAAATGTReverse primer for PCR amplification of psaB-aadA fragment (PCR assay).
    AcpsaB probe-FAGACCTCCTCCCCATCAAAAGAAATForward primer for PCR amplification of psaB probe (Southern blot).
    AcpsaB probe-RTGCACGCGGTTCCAAGTTAATGReverse primer for PCR amplification of psaB probe (Southern blot).
    GFP probe-FCTTGTTGAATTAGATGGTGATGTTAForward primer for PCR amplification of GFP probe (northern blot).
    GFP-T7 probe-RTAATACGACTCACTATAGGGGCCATGTGTAATCCCAGCAGReverse primer for PCR amplification of GFP probe, introducing the promoter sequence of T7 RNA polymerase (northern blot).

    Kiwifruit plastid transformation

    Fresh young leaves of the kiwifruit seedlings were placed abaxial side up on AcOsM (agar-solid MS medium, 0.1 M sorbitol, 0.1 M mannitol, 3% sucrose; Fig. 3B) overnight in the dark (Maliga, 2012; Wu et al., 2019). Afterward, gold particles (0.6 μm diameter), coated with plasmid DNA pQQC7, were introduced into the plant cells by biolistic gun PDS-1000/He (BioRad, USA). Following the biolistic bombardment, the leaf samples were diced into 5 × 5 mm and were placed on AcReMs (agar-solid MS medium, 3% sucrose, and combinations of different hormones; Table S1) containing spectinomycin with abaxial side up (Fig. 3C). When the primary spectinomycin-resistant calli or shoots appeared, they were transferred to AcSmM (agar-solid MS medium supplemented with 3% sucrose, 2 mg/L 6-BA, 0.2 mg/L NAA, and 0.3 mg/L GA3) supplemented spectinomycin for further culture. The leaves of these lines were subjected to several additional rounds of regeneration for homoplasmy. The growth conditions for the whole selection procedure are 16 h light 20–25 μE m−2 s−1 at 25 °C and 8 h dark at 20 °C in a growth chamber. The regenerated shoots were then subcultured to 1/2 MS medium supplemented with 1 mg L−1 Indole-3-butyric acid (IBA) and spectinomycin to induce root formation. Finally, the shoots were transferred to soil and grown in standard greenhouse conditions.

    DNA isolation, PCR and Southern blot analyses

    Total plant DNA was isolated from leaf samples of wild-type and transplastomic kiwifruit plants using a cetyltrimethylammonium bromide-based extraction method (Clarke, 2009). For PCR analysis, the total DNA of wild-type and transplastomic kiwifruit leaves were used as templates with two pairs of primers (GFP-F/GFP-R and psaB-aadA-F/psaB-aadA-R). The PCR results were detected by 1% agarose gel electrophoresis. For Southern blot analysis, DNA samples (7 μg total cellular DNA) were digested with BglII and were then separated by electrophoresis in 1% agarose gels and transferred onto a positively charged nylon membranes (GE Healthcare, USA) by capillary action using the semi-dry transfer method. A 643-bp fragment of the psaB gene was amplified by PCR from kiwifruit plastid DNA using primer pair AcpsaB probe-F/AcpsaB probe-R (Table 2) and used as hybridization probe to verify plastid transformation. Labeling of the probe and hybridization were performed with the DIG-High Prime DNA Labeling and Detection Starter Kit II following the manufacturer’s instructions (Roche, Switzerland).

    RNA isolation and northern blot analyses

    Total RNA was isolated from fresh leaves using the Quick RNA isolation Kit (Huayueyang Biotechnology, China) and following the manufacturer’s instruction. RNA samples (2 µg total RNA) were denatured and separated by electrophoresis in formaldehyde-containing 1.2% agarose gels. The separated RNA molecules were then transferred from the gel to a positively charged nylon membrane (GE Healthcare, USA) using standard blotting protocols. Gene-specific hybridization probes were prepared by PCR amplification from transformation plasmid. PCR primers and their use are listed in Table S2. Hybridization probes were labeled with DIG using the PCR DIG probe synthesis kit following the manufacturer’s protocol (Roche, Switzerland). RNA blots were hybridized at 68 °C using standard protocols.

    Protein extraction and western blot analyses

    Total protein was isolated using a phenol-based extraction method (Cahoon et al., 1992). Protein concentrations were measured with the Easy II Protein Quantitative Kit (TransGen Biotech, China). Samples of 2 µg of total leaf protein and a dilution series of GFP standard protein were separated by electrophoresis in 12% SDS-PAGE gels. The gels were either stained with Coomassie Brilliant Blue R-250 stain (Biyuntian Biotechnology, China) or blotted onto polyvinylidene difluoride (PVDF) membranes (GE Healthcare, USA) using wet transfer for 1.5 h. Membranes were blocked with TBS-T (20 mM Tris-HCl, pH 7.6, 150 mM NaCl and 0.1% Tween 20) containing 5% nonfat milk for 1 h at room temperature, and subsequently incubated with primary antibodies against GFP (1:3000 dilution, ABclonal) for 1.5–2 h at room temperature. Membranes were washed with TBS-T (10 min, 3 times, at room temperature), stained with HRP conjugated anti-rabbit secondary antibody (1:10,000) for 1-1.5 h at room temperature, and again washed with TBS-T (10 min, 3 times, at room temperature). Detection was performed with the enhanced chemiluminescence (ECL, Biosharp, China) kit and the AI600 imager (GE Healthcare, USA).

    Detection of GFP fluorescence signal

    Subcellular localization of GFP fluorescence in leaves of wild-type and transplastomic plants was determined by confocal laser-scanning microscopy (LSM 980; Zeiss) using an argon laser for excitation (at 488 nm), a 491–654 nm filter for detection of GFP fluorescence and a 646–728 nm filter for detection of chlorophyll fluorescence.

    Acknowledgments

    PLASTID PESTICIDES™ thank all the members of PLASTID PESTICIDES™ HUBU-China iGEM team for their contributions to this project. PLASTID PESTICIDES™ also acknowledge the support of the Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, and the State Key Laboratory of Biocatalysis and Enzyme Engineering, School of Life Sciences, Hubei University.

    References

    • Boynton, J.E., et al. (1988). Chloroplast transformation in Chlamydomonas with high-velocity microprojectiles. Science, 240(4858), 1534-1538.
    • Bock, R. (2015). Engineering plastid genomes: methods, tools, and applications in basic research and biotechnology. Annual Review of Plant Biology, 66, 211-241.
    • Castiglia, D.G., et al. (2016). High-level production of a bioactive recombinant antibody in tobacco chloroplasts. Plant Biotechnology Journal, 14(2), 679-686.
    • Liu, Y., et al. (2023). Advances in plastid transformation: expanding the genetic toolbox for plant biotechnology. Trends in Plant Science, 28(2), 182-195.
    • Oey, M., et al. (2009). Transplastomic plants expressing a foreign protein in the cytoplasm. Nature Biotechnology, 27(1), 59-61.
    • Scharff, L.B., & Bock, R. (2014). Synthetic biology in plastids. Current Opinion in Biotechnology, 26, 105-112.
    • Svab, Z., et al. (1990). Stable transformation of plastids in higher plants. Proceedings of the National Academy of Sciences, 87(23), 8526-8530.
    • Yang, X., et al. (2022). Engineering the chloroplast for improved photosynthesis and crop yield. Nature Plants, 8(10), 884-893.
    • Yue, C., et al. (2020). The genus Actinidia: Taxonomy, genetics, and breeding. Horticulture Research, 7(1), 1-14.
    • Uematsu, C., et al. (1991). Agrobacterium-mediated transformation of kiwifruit (Actinidia deliciosa). Plant Cell Reports, 10(3), 174-177.
    • Wang, K., & Wang, M. (2007). Agrobacterium-mediated transformation of kiwifruit (Actinidia deliciosa) with a chitinase gene. Plant Cell, Tissue and Organ Culture, 90(1), 73-78.
    • Yao, J., et al. (2023). Genetic improvement of kiwifruit (Actinidia spp.) through biotechnological approaches. Frontiers in Plant Science, 14, 1-15.
    • Nakamura, N., et al. (1999). Transgenic kiwifruit plants expressing a strawberry polygalacturonase-inhibiting protein. Plant Biotechnology, 16(3), 181-186.
    • Tian, Y., et al. (2011). Enhanced tolerance to cold stress in transgenic kiwifruit (Actinidia deliciosa) expressing a peach CBF gene. Plant Physiology and Biochemistry, 49(11), 1366-1372.
    • Bulley, S.M., et al. (2012). Fruit quality traits in kiwifruit (Actinidia): consumer preferences and genetic variation. Euphytica, 183(3), 453-464.
    • Kim, H.J., et al. (2010). Development of transgenic kiwifruit (Actinidia deliciosa) with enhanced fruit quality. Plant Biotechnology Reports, 4(2), 107-113.
    • Peng, W., et al. (2020). Metabolic engineering of kiwifruit (Actinidia chinensis) for enhanced nutritional value. Plant Biotechnology Journal, 18(9), 1812-1822.
    • Li, F., et al. (2013). Paternal transmission of plastids in kiwifruit (Actinidia deliciosa). PLOS ONE, 8(10), e77454.
    • Ruf, S., et al. (2019). Efficient plastid transformation in Arabidopsis. Plant Physiology, 180(4), 2179-2190.





    This Wiki page provides a comprehensive overview of your project, summarizing the key aspects of the stable plastid transformation in kiwifruit, including the methodology, results, and potential applications. It should serve as a useful resource for anyone interested in your work. If you need any further details or additional sections, please let HUBU-China PLASTID PESTICIDES™ know!

    Conventional Plant Breeding


    • Definition: Since the practice of agriculture began, eight to ten thousand years ago, farmers have been altering the genetic makeup of the crops they grow. Early farmers selected the best-looking plants and seeds and saved them to plant for the next season. Then, once the science of genetics became better understood, plant breeders used what they knew about the genes of a plant to select for specific desirable traits to develop improved varieties.
    • Context and Importance: The global population is projected to surpass 9 billion by 2050, leading to an estimated 100-110% increase in the demand for crops compared to 2005. To meet the food requirements of this rapidly growing population, especially in the context of uncertain climate change and diminishing arable land, it is essential to enhance food production while reducing inputs. Traditional plant breeding methods are often labor-intensive and time-consuming, whereas genetic engineering offers a promising approach to boost crop productivity.

    Since the practice of agriculture began, eight to ten thousand years ago, farmers have been altering the genetic makeup of the crops they grow. Early farmers selected the best looking plants and seeds and saved them to plant for the next season. Then, once the science of genetics became better understood, plant breeders used what they knew about the genes of a plant to select for specific desirable traits to develop improved varieties.

    Nuclear Genome Transformation
    • Introduction: Nuclear genome transformation has become a widely adopted technique in many economically important plant species. However, it comes with several limitations, such as unpredictable expression of the gene of interest and gene silencing due to the random integration of T-DNA.
    • Alternative Approaches: In addition to nuclear transformation, plants provide another avenue for genetic modification through the transformation of the small genomes of two DNA-containing cell organelles: plastids (chloroplasts) and mitochondria, which are derived from cyanobacteria and α-proteobacteria, respectively.
    Advantages of Plastid Transformation
    • Highly Precise Transgene Insertion: Efficient homologous recombination allows for precise and targeted insertion of transgenes into the plastid genome.
    • High Levels of Protein Expression: The potential for expressing foreign proteins at extremely high levels, up to 75% of the total soluble protein, makes plastid transformation highly attractive for producing recombinant proteins.
    • Multigene Engineering: The ability to stack multiple transgenes in synthetic operons in a single transformation event facilitates the engineering of complex traits.
    • Absence of Epigenetic Effects: Plastid transformation avoids issues such as gene silencing and position effects, which are common in nuclear transformation.
    • Increased Biosafety: Since plastids are generally not transmitted through pollen in most crops, there is a reduced risk of transgene spread, enhancing biosafety.
    Applications of Plastid Transformation
    • Production of Recombinant Proteins and Enzymes: Plastids can be used to produce pharmaceutical proteins and industrial enzymes.
    • Resistance to Biotic and Abiotic Stresses: Enhanced resistance against insect pests, viral, fungal, and bacterial diseases, as well as tolerance to abiotic stresses like salt, drought, and cold.
    • Herbicide Resistance: Improved resistance to herbicides, facilitating weed management.
    Historical Development and Current Status
    • Production of Recombinant Proteins and Enzymes: Plastids can be used to produce pharmaceutical proteins and industrial enzymes.
    • Resistance to Biotic and Abiotic Stresses: Enhanced resistance against insect pests, viral, fungal, and bacterial diseases, as well as tolerance to abiotic stresses like salt, drought, and cold.
    • Herbicide Resistance: Improved resistance to herbicides, facilitating weed management.
    Stable Plastid Transformation in Kiwifruit (Actinidia chinensis)
    • Introduction: Kiwifruit is a valuable crop with a high content of vitamin C and other beneficial metabolites. Although nuclear transformation in kiwifruit has been routine for several years, plastid transformation has not been reported until now.
    • Potential Benefits: The development of a plastid transformation system in kiwifruit would enable efficient production of recombinant proteins, edible vaccines, and biopharmaceuticals, and provide a tool to study the complex inheritance patterns of plastids in this species.
    Methods
    • Optimization of Plant Regeneration and Selection System: PLASTID PESTICIDES™ tested various media compositions to develop an effective leaf-based regeneration and selection system. The optimal medium, AcReM3, containing 1 mg L-1 thidiazuron (TDZ), 2 mg L-1 6-benzyladenine (6-BA), and 1 mg L-1 α-naphthalene acetic acid (NAA), was selected based on its ability to induce the maximum number of shoots from young leaf explants.
    • Selection of Plastid-Transformed Kiwifruit: The spectinomycin-resistance gene aadA was used as a selectable marker, and 300 mg L-1 spectinomycin was found to be effective in suppressing background growth while allowing the growth of transformants.
    • Construction of the Plastid Transformation Vector: The vector pQQC7 was constructed to carry both the aadA selectable marker and a green fluorescent protein (GFP) reporter gene. Both cassettes are flanked by kiwifruit-specific sequences to allow targeted insertion into the plastid genome between the trnfM and trnG genes.
    • Biolistic DNA Delivery and Selection of Transplastomic Plants: Leaf explants were bombarded with the pQQC7 plasmid using optimized parameters. Primary spectinomycin-resistant calli appeared after three months, and six independent transplastomic lines were obtained from 12 plates. These lines were further propagated and regenerated to achieve homoplasmy, and then transferred to soil.
    Results
    • Optimization of Plant Regeneration and Selection System for Kiwifruit: Different hormone combinations were tested, and AcReM3 was found to be the most effective for inducing shoots from young leaf explants.
    • Selection of Plastid-Transformed Kiwifruit: The use of 300 mg L-1 spectinomycin was effective for selecting plastid-transformed kiwifruit, resulting in the establishment of stable transplastomic lines.
    Backcrossing
    • Definition: Backcrossing is a breeding method where a hybrid offspring is crossed back to one of its parents, often the parent that has the desired trait. This process is repeated over several generations to introduce a specific trait from the donor parent into the genetic background of the recurrent parent.
    • Usage: It is commonly used in plant breeding to incorporate a single gene or a few genes controlling a desirable trait, such as disease resistance, into an otherwise well-adapted variety.
    Marker-Assisted Selection (MAS)
    • Definition: Marker-assisted selection involves using molecular markers linked to traits of interest to select individuals for breeding. These markers can be DNA sequences that are associated with the expression of a particular phenotype.
    • Usage: MAS allows breeders to identify and select plants carrying the desired traits at an early stage, without having to wait for the trait to be expressed, thus accelerating the breeding process.
    Genome Editing
    • Definition: Genome editing refers to a set of technologies that enable scientists to change an organism's DNA by adding, removing, or altering genetic material at particular locations in the genome.
    • Usage: Techniques like CRISPR-Cas9 have revolutionized the field, allowing for precise modifications to plant genomes, which can lead to improved crop varieties with enhanced characteristics.
    Cisgenesis
    • Definition: Cisgenesis is a form of genetic engineering where only genes from the same species or closely related species are transferred. This approach aims to mimic traditional breeding but with the precision and speed of genetic engineering.
    • Usage: Cisgenic crops are designed to address consumer concerns about transgenic (GMO) crops, as they contain no foreign DNA and may be more acceptable to the public.
    Transgenesis


    • Definition: Transgenesis is the process of introducing foreign DNA (transgenes) into an organism, resulting in the stable inheritance of the introduced genetic material.
    • Usage: In agriculture, transgenic plants (often called GMOs) are developed to exhibit traits such as herbicide tolerance, pest resistance, or enhanced nutritional value.

    T-DNA (Transfer DNA)

    T-DNA (Transfer DNA)


    • Definition: T-DNA is a segment of DNA that is transferred from Agrobacterium tumefaciens to the plant cell during the natural infection process. In genetic engineering, it is used as a vector to deliver the desired gene(s) into the plant genome.
    • Usage: The T-DNA region of a binary vector is engineered to include the gene of interest along with regulatory elements to ensure proper expression in the host plant.
    Selectable Markers


    • Definition: Selectable markers are genes that confer a trait that can be easily identified, usually antibiotic or herbicide resistance, which allows for the selection of transformed cells or organisms.
    • Usage: In genetic engineering, selectable markers help researchers to distinguish between successfully transformed cells and those that have not taken up the new genetic material.
    Reporter Genes


    • Definition: Reporter genes are used to study the regulation and function of other genes. They encode proteins that produce a measurable signal, such as fluorescence or luminescence, when expressed.
    • Usage: Common reporter genes include green fluorescent protein (GFP), β-glucuronidase (GUS), and luciferase. They are often included in transformation vectors to track the expression of the gene of interest.
    Homologous Recombination (HR)
    • Definition: Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA.
    • Usage: In plastid transformation, HR is exploited to insert transgenes precisely into the plastid genome, avoiding random integration and potential disruption of endogenous genes.
    Gene Silencing


    • Definition: Gene silencing is the process by which the expression of a gene is reduced or completely suppressed. It can occur through various mechanisms, including RNA interference (RNAi) and transcriptional gene silencing.
    • Usage: Gene silencing is a concern in nuclear transformation because the random integration of T-DNA can lead to the inactivation of the introduced gene. Plastid transformation avoids this issue due to the absence of epigenetic effects.
    Transformation Efficiency


    • Definition: Transformation efficiency refers to the proportion of cells that successfully take up and integrate the exogenous DNA.
    • Usage: High transformation efficiency is desirable in genetic engineering to minimize the amount of work and resources needed to generate and screen transformants.
    Biomass Production


    • Definition: Biomass production refers to the total mass of living biological organisms in a given area or volume at a given time.
    • Usage: Increasing biomass production is a goal in many agricultural and bioenergy applications, as it can lead to higher yields of food, feed, or raw materials for energy production.
    Sustainable Agriculture


    • Definition: Sustainable agriculture is farming in sustainable ways, meeting society's present food and textile needs, without compromising the ability of future generations to meet their own needs.
    • Usage: Genetic engineering and advanced plant breeding techniques play a role in sustainable agriculture by developing crops that require fewer inputs, such as water and pesticides, while maintaining or increasing yields.