Contents

    April 22th, 2024 Selection of Target Genes

    Spodoptera litura is an important crop pest, which has evolved a high degree of resistance to all insecticides targeted at it. After 24 h injection of 500 ng/μL dsRNA, the expression levels of SlCHS1 and SlCHS2 were significantly inhibited in S. litura (Yu et al.,2020). Among them, SlCHS1 has a high expression level in the outer epidermis and is exclusively expressed in the epidermis underlying the cuticular exoskeleton and related ectodermal cells such as tracheal cells, while SlCHS2 is highly expressed in the midgut, which protects the intestinal epithelium from mechanical disruption and invasion by various pathogens.

    These results suggest that SlCHS1 might play an important role during S. litura larval molting, while SlCHS2 has no significant effect on S. litura molting. Therefore, we have chosen SlCHS1 for further study.

    clip_image001.png

    Reference

    Yu HZ, Li NY, Xie YX, et al. (2020) Identification and functional analysis of two chitin synthase genes in the common cutworm, Spodoptera litura. Insects 11: 4.


    April 23th, 2024 Selection of amiRNA Backbones

    Five backbones were selected in the literature (Bally et al., 2020): At-miR159(At, Arabidopsis thaliana), Dm-ba (Dm, Drosophila melanogaster), Dv-miR279 (Dv, Diabrotica virgifera), Dv-miR1 and Tc-ba (Tc, Tribolium castaneum). The literature shows that even if the inhibitory effect of Artificial microRNA (amiRNA) delivered in the Arabidopsis pre-miR backbone is lower than that of amiRNA delivered in the insect pre-miR backbones, the effect of the insect backbones is better than that of the plant backbones. The results of the five backbones compared with the wild type are as follows:

    clip_image002.png

    By comparing the rate of death and pupation failure:greatest inhibition Tc-ba > Dv-miR279 > Dv-miR1 > Dm-ba > At-miR159, so we finally chose the Tc-ba backbone.

    Reference

    Bally J, Mclntyre G J, Doran R L, et al. (2016) In-plant protection against Helicoverpa armigera by production of long hpRNA in chloroplasts. Frontiers in Plant Science, 7, 1453.


    April 24th, 2024 Prediction of Effective Fragments of CHS1 from Spodoptera litura

    The relative location and number of effective amiRNA candidates at CHS1 were predicted by indicated bioinformatics tools (DNAMAN, siDirect and Wizard). We selected hotspots predicted by all three tools as effective fragments of CHS1 from Spodoptera litura. Two amiRNA candidates (CHS1-1, CHS1-2) are in the hotspot.

    Spodoptera litura CHS1

    amiRNA-1: TGGATGACAACGTCATGAAGAAG

    amiRNA-2: AAGGTTTCAACGAGTTCTACAAT


    April 25th, 2024 The Construction of Tc-ba-miR-CHS1

    We found the base sequence of Tc-ba-miR-ACE2 (Yu et al.2020).

    Tc-ba: Tribolium castaneum bantam H. armigera ACE2 target

    GAGGAATTCACCTCGTCACGGCGACGTCAGCGAGACGACCATGGAGTTGGATGACAGGAAGGAGATATATTTGATTCTCTCCTGTCATCCAACTCCATGGTTGTTCATTAATCATCGATCGCAGGCAGCACCCCTTAGAA

    By replacing ACE2 with CHS1 in Tc-ba-miR-ACE2, Tc-ba-miR-CHS1 was constructed.

    Tc-ba scaffold S. litura CHS1 target 1

    GAGGAATTCACCTCGTCACGGCGACGTCAGCGAGACGACCGATGACAACGTCATGAAGAAGGATATATTTGATTCCTTCTTCATGACGTTGTCATCGGTTGTTCATTAATCATCGATCGCAGGCAGCACCCCTTAGAA


    April 26th, 2024 Primers were Designed and Synthesized by Wuhan Gencreate Company in China

    Tc-ba-miR-CHS1-1 synF1

    GAGGAATTCACCTCGTCACGGCGACGTCAGCGAGACGACCGATGACAACGTCATGAAGA

    Tc-ba-miR-CHS1-1 synF2

    TGACAACGTCATGAAGAAGGATATATTTGATTCCTTCTTCATGACGTTGTCATCGGTTG

    Tc-ba-miR-CHS1-1 synF3

    TTCCGTGCTGCCTGCGATCGATGATTAATGAACAACCGATGACAACGTCATGAA

    XhoI-Tc-F1

    AAAACTCGAGTTCTAAGGGGTGCTGCCT

    XbaI-Tc-R1

    AAAATCTAGAACATGAGGATCACCCATGTGAGGAATTCAC


    May 2nd, 2024: Get the Interest Fragment

    PCR Reaction system

    ReagentVolume
    Tc-ba-miR-CHS1-1 synF12 μL
    Tc-ba-miR-CHS1-1 synF32 μL
    Golden Star T6 Super PCR Mix (Beijing Tsingke Biotechnology Co., Ltd., China)          46 μL
    Total volume50 μL

    Place in a PCR amplifier (Adjust the time according to the instructions).

    1.  Agarose gel preparation for electrophoresis

    • Prepare 1 % agarose gel.
    • Weigh 0.5 g of agarose into a conical flask and add 50 ml of Tris-acetate EDTA (TAE).
    • Heat in the microwave until transparent.
    • Select the comb according to the fragment length and insert a comb at the top of the mold to form the sample well.
    • After the gel is polymerized, the comb can be removed.
    • Place gel in the electrophoresis chamber. Gels should be completely submerged in buffer to allow ion flow and prevent gel drying.

    2.  Electrophoresis

    • Remove the three PCR tubes from the PCR amplifier.
    • Load the marker (2k Plus2) into the first well using a micropipette and allow all the samples in the three PCR tubes to “fall” into each of the three the sample.
    • Fill the upper and lower chambers with running buffer and apply an electric potential on the gel at a constant voltage of 120 V.
    • Remove the gel from the gel tray and expose the gel to UV light. DNA bands show up as fluorescent bands.

    图片1.png

    3.  Recycling of DNA from Agarose Gels

    • Excise a gel slice containing the DNA of interest.
    • Place the gel slice containing the DNA sample into an EP tube. Add 30μl of XP2 Binding Buffer (Omega Bio-Tek, USA).
    • Melt the gel slice at 70°C for 15 min. Make sure that the gel slice is melted.
    • Pour in the Spin column to collect Tube and centrifugal (12000 rpm 1 min).
    • Discard the buffer.
    • Add 700μl SPW Buffer (Omega Bio-Tek, USA) to elute 2 times. Centrifuge the solution (12000 rpm 2 min).
    • Replace the lower part with an EP tube.
    • Add 30μl Elution buffer and heat for 2 min at 60 °C. Centrifuge the solution (12000 rpm 1 min).
    • Nucleic acid quantification.
    • Get the fragment Primer 2+3.


    May 3rd, 2024: Get the Interest Fragment

    1.  Reaction system:

    ReagentVolume
    Primer2+31 μl
    Tc-ba-miR-CHS1-1 synF12 μl
    Tc-ba-miR-CHS1-1 synF32 μl
    Golden Star T6 Super PCR Mix (Beijing Tsingke Biotechnology Co., ltd., China)45 μl
    Total volume50 μl

    Place in a PCR amplifier (Adjust the time according to the instructions).

    2.  Prepare with 1 % agarose gelatin.

    3.  Electrophoresis.

    4.  Take a picture of the gel.

    11111.png

    5.  Recycling of DNA from Agarose Gels.

         Get the interest fragment Tc-ba-miR-CHS1.

    May 4th, 2024: Sequence of Digestion Sites Added

    1.  Reaction system:

    ReagentVolume
    Tc-ba-miR-CHS11 μl
    XhoI-Tc-F12 μl
    XbaI-Tc-R12 μl
    Golden Star T6 Super PCR Mix (Beijing Tsingke Biotechnology Co., Ltd., China)45 μl
    Total volume50 μl

    2.  Prepare with 1 % agarose gelatin.

    3.  Electrophoresis.

    4.  Take a picture of the gel.

    44444.png

    5.  Recycling of DNA from Agarose Gels.

    Get the interest fragment containing digestion sites (XhoI XbaI).


    May 5th, 2024: Plasmid Transformation

    1.  Plasmid transformation.

    After receiving the plasmid pET-28a (+) dry powder, follow the instructions on the kit to transform the plasmid into E. coli DH5α.

    2.  Culture monoclonal colonies.

    • Add 900 μl of antibiotic-free LB liquid medium and incubate at 180 rpm
           shaking for 45 min.
    • Centrifuge at 6000 rpm for 5 min.
    • Inoculate onto Luria-Bertani (LB) medium containing Kanamycin. Incubate the culture overnight at 37°C.

    5555.png


    May 6th, 2024: Culture Monoclonal Colonies

    Pick monoclonal colonies to inoculate 2 ml of LB medium containing Kan with a single colony of transformed bacteria. Incubate the culture overnight at 37°C with vigorous shaking.


    May 7th, 2024: Plasmid Extraction

    1.  Lyse bacteria to release plasmid DNA.

    • Pour 1.5 ml of the culture into a microfuge tube. Centrifuge at 12000 rpm for 30 s at 4 °C.
    • Resuspend the bacterial pellet in 100 µl of ice-cold Alkaline lysis solution I by vigorous vortexing.

    2.  Isolate and purify plasmids.

    • Add 200 µl of Alkaline lysis solution II to each bacterial suspension.
    • Add 150 µl of ice-cold Alkaline lysis solution III.
    • Centrifuge the bacterial lysate at 12000rmp for 5 min at 4 °C in a microfuge. Transfer the supernatant to a fresh tube.
    • Add an equal volume of phenol: chloroform.
    • Adding ethanol into the supernatant. Mix the solution by vortexing.
    • Collect the precipitated nucleic acids by centrifugation at maximum speed for 5 min at 4 °C in a microfuge.

    3.  Measure nucleic acid concentration.

    4.  Store at -20°C for later use.


    May 8th ,2024: The Expression Vector pMJ5 Was Designed Based on pET28a (+)

    66666.png


    May 9th ,2024: Plasmid Digestion

    1.  Reaction system:

    ReagentVolume
    XbaI1 μl
    XhoI1 μl
    pET-28a(3÷0.2)15 μl
    10X QuickCut Green Buffer5 μl
    ddH2O28 μl
    Total volume50 μl

    2.  37 ℃, 5h.

    3.  Agarose gel preparation for electrophoresis.

    4.  Electrophoresis.

    5.  Recycling of DNA from agarose gels.

    5.png

    6.  Measure nucleic acid concentration.

    7.  Store at -20 °C for later use.


    May 10th ,2024: PCR product Digestion

    1.  Reaction system:

    ReagentVolume
    XbaI1 μl
    XhoI1 μl
    Tc-ba-miR-CHS1 (containing digestion sites)30 μl
    10X QuickCut Green Buffer3 μl
    ddH2O15 μl
    Total volume50 μl

    2.  37 ℃, 5 h.

    3.  Agarose gel preparation for electrophoresis.

    4.  Electrophoresis.

    5.  Recycling of DNA from agarose gels.

    图片5.png

    6.  Measure nucleic acid concentration.

    7.  Store at -20 °C for later use.


    May 11th ,2024:the Plasmid and Fragment are Ligated by the T4 DNA Ligase

    1.  Reaction system:

    ReagentVolume
    processed vector1 μl
    processed Tc-ba-miR-CHS13 μl
    T4 DNA Ligase0.5 μl
    10 × T4 DNA ligase Buffer1 μl
    ddH2O4.5 μl
    Total volume10 μl

    2.  16 ℃, 3 h.

    3.  The constructed plasmid was transformed into DH5α by heat shock.

    • Add 5 μl of the constructed plasmid mixture and place on ice for 20 min.
    • Heat shock 42 ℃, 45 s.
    • Add 500 μl of LB medium to each of the tubes.
    • Shake at 211 rpm, 37 ℃ for 1 h.

    4.  Add 300 μl of the above transformation mix to a solid LB containing Kana (100 μg /ml) in a clean bench.

    5.  Overnight at 37 °C.


    May 12th ,2024: Check whether the Vector is Successfully Constructed

    1.  Colony PCR:

    ReagentVolume
    10 µM Primer F2 µl
    10 µM Primer R2 µl
    Golden Mix (green)45 µl
    Bacterial liquid1 µl
    Total volume50 µl

    2.  Agarose gel preparation for electrophoresis.

    3.  Electrophoresis.

    图片6.png

    May 14th ,2024: Single Colony Expansion Culture

    1.  Pick the sequenced single colonies in the clean bench and add them to a bacterial bottle (contains 5 ml of liquid medium containing KanR).

    2.  Overnight on a shaker at 37 °C.


    May 15th ,2024: Plasmid Extraction

    1.  The bacterial fluid in the bacterial bottle appears cloudy.

    2.  Plasmid Extraction (Operate according to the instructions).

    3.  Measure nucleic acid concentration.

    4.  Take 10 μl for sequencing.

    5.  The company emailed back that the fragment sequenced yesterday was correct. Then the vector pMJ5 (Tc-ba-miR-CHS1) was constructed successfully.


    May 18th ,2024: The Expression Vector pMJ6 Was Designed Based on pFJ1

    1.  The pFJ1 is made by the senior sister and we replaced the target gene on this basis

    图片8.png 图片9.png


    May 19th ,2024: Two Primers were Designed and Synthesized by Wuhan Gencreate Company in China

    XhoI-Tc-F2          

    AAAACTCGAGTTCTAAGGGGTGCTGCCTGCGATCG

    HindⅢ-Tc-R2      

    AAAAAAGCTTGAGGAATTCACCTCGTCACGGCGAC


    May 20th, 2024: Get the Interest Fragment

     Received two primers (Primer1: XhoI-Tc-F2 Primer2: HindⅢ-Tc-R2)synthesized by the company.

    1.  Reaction system:

    ReagentVolume
    Tc-ba-miR-CHS11 μl
    XhoI-Tc-F22 μl
    HindⅢ-Tc-R22 μl
    Golden Star T6 Super PCR Mix (Beijing Tsingke Biotechnology Co.,Ltd., China)45 μl
    Total volume50 μl

    2.  Prepare with 1 % agarose gelatin.

    3.  Electrophoresis.

    4.  Take a picture of the gel.

    图片10.png

    5.  Recycling of DNA from Agarose Gels.

            Get the interest fragment containing digestion sites (XhoI HindⅢ).


    May 21th ,2024: Plasmid Digestion

    1.  Reaction system:

    ReagentVolume
    HindⅢ1 μl
    XhoI1 μl
    pJF1(3÷0.2)15 μl
    10X QuickCut Green Buffer5 μl
    ddH2O28 μl
    Total volume50 μl

    2.  37 ℃, 5h.

    3.  Agarose gel preparation for electrophoresis.

    4.  Electrophoresis.

    5.  Recycling of DNA from agarose gels.

    图片11.png

    6.  Measure nucleic acid concentration.

    7.  Store at -20 °C for later use.


    May 22th ,2024: the Plasmid and Fragment are Ligated by the T4 DNA Ligase

    1.  Reaction system:

    ReagentVolume
    processed vector1 μl
    processed interest fragment2.5 μl
    T4 DNA Ligase0.5 μl
    10 × T4 DNA ligase Buffer1 μl
    ddH2O5 μl
    Total volume10 μl

    2.  16 ℃, 3 h.

    3.  The constructed plasmid was transformed into DH5α by heat shock.

    • Add 5 μl of the constructed plasmid mixture and place on ice for 20 min.
    • Heat shock 42 ℃, 45 s.
    • Add 500 μl of LB medium to each of the tubes.
    • Shake at 211 rpm, 37 ℃ for 1 h.

    4.  Add 300 μl of the above transformation mix to a solid LB containing Kana (100 μg /ml) in a clean bench.

    5.  Overnight at 37 °C.


    May 23th ,2024: Check whether the Vector is Successfully Constructed

    1.  Colony PCR:

    ReagentVolume
    10 µM Primer F2 µl
    10 µM Primer R2 µl
    Golden Mix (green)45 µl
    Bacterial liquid1 µl
    Total volume50 µl

    2.  Agarose gel preparation for electrophoresis.

    3.  Electrophoresis.

        图片12.png


    May 24th ,2024: the Plasmid and Fragment are Ligated by the T4 DNA Ligase

    1.  Reaction system:

    ReagentVolume
    processed vector1 μl
    processed interest fragment2.5 μl
    T4 DNA Ligase0.5 μl
    10 × T4 DNA ligase Buffer1 μl
    ddH2O5 μl
    Total volume10 μl

    2.  16 ℃, 3 h.

    3.  The constructed plasmid was transformed into DH5α by heat shock.

    • Add 5 μl of the constructed plasmid mixture and place on ice for 20 min.
    • Heat shock 42 ℃, 45 s.
    • Add 500 μl of LB medium to each of the tubes.
    • Shake at 211 rpm, 37 ℃ for 1 h.

    4.  Add 300 μl of the above transformation mix to a solid LB containing Kana (100 μg /ml) in a clean bench.

    5.  Overnight at 37 °C.


    May 25th ,2024: Check whether the Vector is Successfully Constructed

    1.  Colony PCR:

    ReagentVolume
    10 µM Primer F2 µl
    10 µM Primer R2 µl
    Golden Mix (green)45 µl
    Bacterial liquid1 µl
    Total volume50µl

    2.  Agarose gel preparation for electrophoresis.

    3.  Electrophoresis.

    图片13.png

    May 26th ,2024: Single Colony Expansion Culture

    1.  Pick the sequenced single colonies in the clean bench and add them to a bacterial bottle (contains 5 ml of liquid medium containing KanR).

    2.  Overnight on a shaker at 37 °C.


    May 27th ,2024: Plasmid Extraction

    1.  The bacterial fluid in the bacterial bottle appears cloudy.

    2.  Plasmid Extraction (Operate according to the instructions).

    3.  Measure nucleic acid concentration.

    4.  Take 1 μg plasmid for sequencing.

    5.  The company emailed back that the fragment sequenced yesterday was correct. Then the vector pMJ6 (MS2-Tc-ba-miR-CHS1) was constructed successfully.

    图片14.png

    June 7th ,2024: E. coli B2 (BL21ΔRNC) were Prepared as Competent

    1.  Melt the E. coli BL21 strain stored at -80 °C on ice.

    2.  Plate streak on LB medium.

    3.  Overnight at 37 °C.


    June 8th ,2024: E. coli B2 (BL21ΔRNC) were Prepared as Competent

    1.  Pick BL21 single colonies from LB medium and added to 100 mL of LB liquid medium.

    2.  Shake at 200 rpm, 37 °C for 48h.


    June 9th ,2024: E. coli B2 (BL21ΔRNC) were Prepared as Competent

    1.  When the bacterial solution OD600 nm=0.4~0.5, place it on ice for 30min

    2.  Add the bacterial solution to 50ml of liquid medium and put it on ice for 10 min

    3.  4℃、Centrifuge (3 000 rpm 5 min), remove the liquid from the tube

    4.  Resuspend the cells with 20 ml of pre-chilled CaCl2, and put it on ice for 10 min

    5.  Repeat the above two steps

    6.  After aliquoting, it is quickly frozen with liquid nitrogen, store at -80 °C for later use


    June 10th ,2024: Plasmid Transformation

    1.  Three plasmids (pMJ5 pMJ6 pMJ7) were transformed into competent cells of B2 (BL21ΔRNC) at room temperature.

    • Take the competent prepared yesterday and melt it on ice
    • Take 30 μl of competent and add it to the tube containing the plasmid, put on ice for 30min
    • Place in water at 42 °C for 45 s, then immediately place on ice for 2min
    • Add to 500 μl of medium and shake at 200 rpm, 37 °C for 1 h

    2.  Add 300 μl of the above transformation mix to a solid LB containing Kana (100 μg /ml) in a clean bench.

    3.  Overnight at 37 °C.


    June 11th ,2024: Check whether the Vector is Successfully Constructed

    1.  Colony PCR:

    ReagentVolume
    10 µM Primer F2 µl
    10 µM Primer R2 µl
    Golden Mix (green)45 µl
    Bacterial liquid1 µl
    Total volume50 µl

    2.  Agarose gel preparation for electrophoresis.

    3.  Electrophoresis.

    4.  Pick the 3 colonies with the brightest bands and add them to 100 ml of liquid medium. The same procedure is followed for bacteria containing pFJ4 and pET28a. Shake at 200 rpm, 37 °C overnight


    June 11th ,2024: Check whether the Vector is Successfully Constructed

    1.  When the bacterial solution OD600 nm=0.4~0.5, place it on ice for 30min

    2.  Plasmid Extraction (Operate according to the instructions).

    3.  Measure nucleic acid concentration.

    4.  Take 10 μl for sequencing.

    5.  The company emailed back that the fragment sequenced yesterday was correct. Then the five vector were constructed successfully.


    June 12th ,2024: Expanded Culture

    1.  Each of the 5 bacteria was added to 1 L of LB liquid medium (1mmol/L).

    2.  Shake at 200 rpm, 37 °C overnight.


    June 13th ,2024: Induced Expression

    1.  When the bacterial solution OD600 nm=0.6~0.8, place it on ice for 30min

    2.  Inoculate LB medium ( IPTG 1 mM/L) and overnight at 37℃


    June 14th ,2024: The RNA expression levels were evaluated using Northern blot analys

    1.  Extract total RNA from the samples using TRIzol reagent.

    2.  Treat the RNA samples with formaldehyde and heat to denature them for analysis by gel electrophoresis.

    notebook 6.14.png

    Northern blot results showed that amiRNA expression was detected in the B2 strains expressing pMJ5, pMJ6 and pMJ7 (138 nt)


    June 15th,2024: SDS-PAGE was Used to Detect whether the Protein was Expressed

    1.  Protein extraction

    2.  Glue pouring and sample loading

    3.  Gel electrophoresis

    4.  Dyeing and decolorization

    notebook 6.15.png

          The results of SDS-PAGE assay showed that the expression of 2× CP (28 kDa) was detected in the strains expressing pFJ4 and pMJ6, and the expression of GFP (29 kDa) was detected in the strains expressing pMJ7

    5.  The expression strain was constructed


    June 18th,2024

    1.  Preparation of fungus

    The plasmid was transferred into five kinds of B2 bacterial solution, and after thawing, it was inoculated into 10mL liquid LB medium containing 50mg/L Kana at 1% inoculation rate, and then oscillated and activated in a shaking table at 37℃ overnight. When OD600=0.6, the activated bacterial solution was absorbed into 1L liquid LB medium containing 50mg/L Kana (kanamycin) at 1% inoculation rate, and incubated in a shaking table at 37℃ for 6h. When OD600=0.6-0.8 was measured, 1mL 1mol/L IPTG was added to the mixture (stored in the refrigerator at -20℃), and continued to shake and culture, and induced overnight. The bacteria were collected by centrifuge at 6000rpm for 5min in a large-sized floor-mounted high-speed refrigerated centrifuge. After adding Tris-HCl 8.0, the bacteria were shaken and mixed, and stored at −80℃ for future use.

    notebook 6.18.png


    June 19th,2024

    1.  Feed preparation

    Prepare 25 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    A total of 250 larvaes were placed in small feed boxes (10 larvaes of Spodoptera litura in each box).


    June 20th,2024

    1.  Feed preparation

    Prepare 25 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for 250 larvaes of Spodoptera litura (10 larvae of Spodoptera litura in each box).


    June 21th,2024

    1.  Feed preparation

    Prepare 25 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.   Biological Detection

    Replacement of feed box for 250 larvaes of Spodoptera litura (10 larvae of Spodoptera litura in each box).

    3.  Observe, record the number of surviving Spodoptera litura. Remove 5 Spodoptera litura from 50 heads of surviving Spodoptera litura for weight weighing, remove 8 heads for qPCR detection.


    June 22th,2024

    1.  Feed preparation

    Prepare 25 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for 250 larvaes of Spodoptera litura (10 larvae of Spodoptera litura in each box).


    June 23th,2024

    1.  Feed preparation

    Prepare 25 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for 250 larvaes of Spodoptera litura (10 larvae of Spodoptera litura in each box).


    June 24th,2024

    1.  Feed preparation

    Prepare 25 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for 250 larvaes of Spodoptera litura (10 larvae of Spodoptera litura in each box).


    June 25th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replace the feed box of the hatchling larvae from the original 10-head box to 5-head box.


    June 26th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvae of Spodoptera litura in each box).


    June 27th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).

    3.  Observe, record the number of surviving Spodoptera litura, remove 5 Spodoptera litura from surviving Spodoptera litura for weight weighing, remove 8 heads for qPCR detection.

    notebook 6.27.png


    June 28th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).


    June 29th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).

    3.  Observe, record the number of surviving Spodoptera litura, remove 5 Spodoptera litura from surviving Spodoptera litura for weight weighing, remove 8 heads for qPCR detection.

    notebook 6.29(2).pngnotebook 6.29.png

    N=26;N=26;N=26;N=27;N=26                 Sample:8

    notebook 6.29(1).png


    June 30th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).


    July 1th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).


    July 2th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).


    July 3th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).


    July 4th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).


    July 5th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).


    July 6th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura (5 larvaes of Spodoptera litura in each box).

    notebook 7.6.png


    July 7th,2024

    1.  Feed preparation

    Prepare 50 small plastic boxes with a pinhole on the lid of the plastic box for breathability and artificial feed (KEYUN BIOCONTROL) the Spodoptera litura Placed in a 50mL syringe, squeeze into each small plastic box. Each time the feed is squeezed about 1cm long and pressed to pave, Using pipettes to absorb 200μL 5 groups of fungus on feed, and make a mark, open the lid naturally dry 30min ~ 1h. After the artificial feed fully absorbs the bacterial fluid can be tested.

    2.  Biological Detection

    Replacement of feed box for larvaes of Spodoptera litura 5 larvaes of Spodoptera litura in each box.

    3.  Stability test of intestinal juice of Spodoptera litura to amiRNA.

    • RNA from the B2 strains expressing the pMJ5 (amiCHS1)  and pMJ7 (MS2-amiCHS1) plasmids was extracted.Make it into crude pure liquid (amiRNA/amiRNA+MS2).
    • The RNase of 5th instar larvae was extracted and diluted (1μl RNase+19ul water).
    • RNase and crude pure fluid (amiRNA/amiRNA+MS2) were nursed at a ratio of 1: 1.
    • The content of amiRNA was detected by Northern blot.

    notebook 7.7.png

    Figure 2.Northern blot The expression of miRNA in the bacteria was examined.(Sample loading, 5 μ g.)

    Experimental result:

    The results showed that amiCHS1 was obviously degraded after 5 min incubation and completely degraded for a long time after 10 min. AmiCHS1 coated with MS2 coat protein can still be detected after 10min incubation (Figure 2). The results show that the CP of MS2 phage can protect amiRNA well. Subsequently, we will test the control effect of amiRNA on Spodoptera litura.


    July 8th,2024

    Prepare 25 sandy plastic boxes with a small amount of feed (no bacterial solution) and a certain amount of moisture, prick holes in the lid of the plastic box with pinholes to make them breathable, and put 5-6 instar Spodoptera litura, which has been fed with different bacterial solutions, and wait for them to pupate.


    July 9th,2024

    Prepare 25 sandy plastic boxes with a small amount of feed (no bacterial solution) and a certain amount of moisture, prick holes in the lid of the plastic box with pinholes to make them breathable, and put 5-6 instar Spodoptera litura, which has been fed with different bacterial solutions, and wait for them to pupate.


    July 10th,2024

    Prepare 25 sandy plastic boxes with a small amount of feed (no bacterial solution) and a certain amount of moisture, prick holes in the lid of the plastic box with pinholes to make them breathable, and put 5-6 instar Spodoptera litura, which has been fed with different bacterial solutions, and wait for them to pupate.


    July 11th,2024

    Prepare 25 sandy plastic boxes with a small amount of feed (no bacterial solution) and a certain amount of moisture, prick holes in the lid of the plastic box with pinholes to make them breathable, and put 5-6 instar Spodoptera litura, which has been fed with different bacterial solutions, and wait for them to pupate.


    July 12th,2024

    Prepare 25 sandy plastic boxes with a small amount of feed (no bacterial solution) and a certain amount of moisture, prick holes in the lid of the plastic box with pinholes to make them breathable, and put 5-6 instar Spodoptera litura, which has been fed with different bacterial solutions, and wait for them to pupate.


    July 13th,2024

    Take out the Spodoptera litura, which has pupated in the sandy soil, and weigh and photograph it.

    notebook 7.13.png


    July 14th,2024

    Observe and record the pupation status of Spodoptera litura, and wait for it to emerge from the pupa and become an adult.


    July 15th,2024

    Observe and record the pupation status of Spodoptera litura, and wait for it to emerge from the pupa and become an adult.


    July 16th,2024

    Observe and record the pupation status of Spodoptera litura, and wait for it to emerge from the pupa and become an adult.


    July 17th,2024

    Observe and record the pupation status of Spodoptera litura, and wait for it to emerge from the pupa and become an adult.


    July 18th,2024

    The pupation of Spodoptera litura is basically completed. Observe and record the number of deformed adults and take photos for record.


    July 19th,2024

    The pupation of Spodoptera litura is basically completed. Observe and record the number of deformed adults and take photos for record.


    July 20th,2024

    The pupation of Spodoptera litura is basically completed. Observe and record the number of deformed adults and take photos for record.

    All the data were summarized to calculate the pupation rate, deformity rate and mortality rate of Spodoptera litura fed with different bacterial fluids, and plotted into a pie plot as follows.

    notebook 7.20.png


    July 22th ,2024: The Expression Vector pMJ11 Was Designed Based on pYY25

    1.   The pFJ11 is made by the senior sister and we replaced the target gene on this basis


    July 23th ,2024: Two Primers were Designed and Synthesized by Wuhan Gencreate Company in China

    XbaI-amiCHS1-F

    AAAATCTAGANACATGAGGATCACCCATGTGAGGAATTCACCTCGTC

    XhoI-amiCHS1-R

    AAAACTCGAGTTCTAAGGGGTGCTGCCTGCGATCGATG


    July 24th ,2024: Get the Interest Fragment

    Received two primers (Primer1: XbaI-amiCHS1-F Primer2: XhoI-amiCHS1-R) synthesized by the company.

    2.  Reaction system:

    ReagentVolume
    XbaI-amiCHS1-F2 μl
    XhoI-amiCHS1-R2 μl
    Golden Star T6 Super PCR Mix (Beijing Tsingke Biotechnology Co., Ltd., China)46 μl
    Total volume50 μl

    3.  Prepare with 1 % agarose gelatin.

    4.  Electrophoresis.

    5.  Take a picture of the gel.

    6.  Recycling of DNA from Agarose Gels.

    Get the interest fragment amiCHS1 containing digestion sites (XhoI XbaI).


    July 25th ,2024: Plasmid Digestion

    1.  Reaction system:

    ReagentVolume
    XbaI1 μl
    XhoI1 μl
    pYY2515 μl
    10X QuickCut Green Buffer5 μl
    ddH2O28 μl
    Total volume50 μl

    6.  37 ℃, 5h.

    7.  Agarose gel preparation for electrophoresis.

    8.  Electrophoresis.

    9.  Recycling of DNA from agarose gels.

    notebook 7.25.png

    10.  Measure nucleic acid concentration.

    11.  Store at -20 °C for later use.


    July 26th ,2024: the Plasmid and Fragment are Ligated by the T4 DNA Ligase

    1.  Reaction system:

    ReagentVolume
    processed vector pYY251 μl
    processed interest fragment amiCHS12.5 μl
    T4 DNA Ligase0.5 μl
    10 × T4 DNA ligase Buffer1 μl
    ddH2O5 μl
    Total volume10 μl

    2.  16 ℃, 3 h.

    3.  The constructed plasmid was transformed into DH5α by heat shock.

    ·Add 5 μl of the constructed plasmid mixture and place on ice for 20 min.

    ·Heat shock 42 ℃, 45 s.

    ·Add 500 μl of LB medium to each of the tubes.

    ·Shake at 211 rpm, 37 ℃ for 1 h.

    4.  Add 300 μl of the above transformation mix to a solid LB containing Kana (100 μg /ml) in a clean bench.

    5.  Overnight at 37 °C.


    July 27th ,2024: Check whether the Vector is Successfully Constructed

    1.  Colony PCR:

    ReagentVolume
    10 µM Primer F2 µl
    10 µM Primer R2 µl
    Golden Mix (green)45 µl
    Bacterial liquid1 µl
    Total volume50 µl

    2.  Agarose gel preparation for electrophoresis.

    3.  Electrophoresis.


    July 28th ,2024: Single Colony Expansion Culture

    1.  Pick the sequenced single colonies in the clean bench and add them to a bacterial bottle (contains 5 ml of liquid medium containing KanR).

    2.  Overnight on a shaker at 37 °C.


    July 29th ,2024: Plasmid Extraction

    1.  The bacterial fluid in the bacterial bottle appears cloudy.

    2.  Plasmid Extraction (Operate according to the instructions).

    3.  Measure nucleic acid concentration.

    4.  Take 10 μl for sequencing.

    5.  The company emailed back that the fragment sequenced yesterday was correct. Then the vector pMJ11 was constructed successfully.

    notebook 7.30.png


    July 31th ,2024: The Expression Vector pMJ12 Was Designed Based on pYY25

    1.  The pFJ12 is made by the senior sister and we replaced the target gene on this basis


    August 1th ,2024: Four Primers were Designed and Synthesized by Wuhan Gencreate Company in China

    NcoI-Cry1C-F

    AAAACCATGGATGGAGGAGAACAATCAGAACCAGTG

    ApaI-Cry1C-R

    GGGCCCCTACTTTTGTGCTCTTTCAAGGTC

    AfeI-amiCHS1-F

    AAAAAGCGCTTGGATACTCTAGAACATGAGGATCACCCATGTNGAGGAATTCACCTCGTC

    XhoI-amiCHS1-R

    AAAACTCGAGNTTCTAAGGGGTGCTGCCTGCGATCGATGATTAATG

    FrameSeq4-F

    CGGAAGGCCGAGAGCTAACTATC

    ZTYW2-R

    TACGGGACGTCAGTGGCAGTTG


    August 2th ,2024: Get the Interest Fragment

    Received four primers (Primer 1: NcoI-Cry1C-F Primer 2: ApaI-Cry1C-R Primer 3: AfeI-amiCHS1-F Primer 4: XhoI-amiCHS1-R) synthesized by the company.

    1.  Reaction system:

    ReagentVolume
    NcoI-Cry1C-F2 μl
    ApaI-Cry1C-R2 μl
    Golden Star T6 Super PCR Mix (Beijing Tsingke Biotechnology Co., Ltd., China)46 μl
    Total volume50 μl

    ReagentVolume
    AfeI-amiCHS1-F2 μl
    XhoI-amiCHS1-R2 μl
    Golden Star T6 Super PCR Mix (Beijing Tsingke Biotechnology Co., Ltd., China)46 μl
    Total volume50 μl

    2.  Prepare with 1 % agarose gelatin.

    3.  Electrophoresis.

    4.  Take a picture of the gel.

    notebook 8.1.png

    5.  Recycling of DNA from Agarose Gels.

    Get two kinds of interest fragment (Cry1C amiCHS1)


    August 3th ,2024: Plasmid Digestion

    1.  Reaction system:

    ReagentVolume
    NcoI1 μl
    ApaI1 μl
    pYY2515 μl
    10X QuickCut Green Buffer5 μl
    ddH2O28 μl
    Total volume50 μl

    2.  37 ℃, 5h.

    3.  Agarose gel preparation for electrophoresis.

    4.  Electrophoresis.

    5.  Recycling of DNA from agarose gels.

    notebook 8.3.png

    6.  Measure nucleic acid concentration.

    7.  Store at -20 °C for later use.


    August 4th ,2024: the Plasmid and Fragment are Ligated by the T4 DNA Ligase

    1.  Reaction system:

    ReagentVolume
    processed vector pYY251 μl
    processed interest fragment Cry1C2.5 μl
    T4 DNA Ligase0.5 μl
    10 × T4 DNA ligase Buffer1 μl
    ddH2O5 μl
    Total volume11 μl

    ReagentVolume
    processed vector pYY251 μl
    processed interest fragment amiCHS12.5 μl
    T4 DNA Ligase0.5 μl
    10 × T4 DNA ligase Buffer1 μl
    ddH2O5 μl
    Total volume10 μl

    2.  16 ℃, 3 h.

    3.  The constructed plasmid was transformed into DH5α by heat shock.

    ·Add 5 μl of the constructed plasmid mixture and place on ice for 20 min.

    ·Heat shock 42 ℃, 45 s.

    ·Add 500 μl of LB medium to each of the tubes.

    ·Shake at 211 rpm, 37 ℃ for 1 h.

    4.  Add 300 μl of the above transformation mix to a solid LB containing Kana (100 μg /ml) in a clean bench.

    5.  Overnight at 37 °C.


    August 5th ,2024: Check whether the Vector is Successfully Constructed

    1.  Colony PCR:

    ReagentVolume
    10 µM FrameSeq4-F2 µl
    10 µM ZTYW2-R2 µl
    Golden Mix (green)45 µl
    Bacterial liquid1 µl
    Total volume50 µl

    2.  Agarose gel preparation for electrophoresis.

    3.  Electrophoresis.

    notebook 8.5.png


    August 6th ,2024: Single Colony Expansion Culture

    1.  Pick the sequenced single colonies in the clean bench and add them to a bacterial bottle (contains 5 ml of liquid medium containing KanR).

    2.  Overnight on a shaker at 37 °C.


    August 7th ,2024: Plasmid Extraction

    1.  The bacterial fluid in the bacterial bottle appears cloudy.

    2.  Plasmid Extraction (Operate according to the instructions).

    3.  Measure nucleic acid concentration.

    4.  Take 10 μl for sequencing.

    5.  The company emailed back that the fragment sequenced yesterday was correct. Then the vector pMJ12 was constructed successfully.

    notebook 7.7(1).png

    August 9th ,2024: Particle bombardment

    1.  Gold particles are co-precipitated with DNA containing the target gene, usually with the selection marker gene.

    2.  Gene guns (such as PDS1000/He particle delivery systems) are used to accelerate and bombard DNA-coated gold particles into plant tissues. Precise control of bombardment parameters is required to ensure that DNA can effectively enter plant cells without causing excessive damage.

    3.  Cut the bombarded leaves into small pieces and place them on spectinomycin-containing medium to screen for cells containing transgenes.


    August 10th ,2024: Screened resistant shoots

    1.  Place the bombarded leaf segments on the regeneration medium to select for transformed cells containing the resistance gene.

    2.  After a period of cultivation, the resistant tissue will gradually regenerate to form new plantlets. During this process, the tissue undergoes dedifferentiation and redifferentiation, eventually leading to the formation of complete plants.

    3.  Perform PCR analysis on the regenerated plants to detect whether the target gene has been integrated into the plant genome.

    notebook 8.10.png

    August 17th ,2024: southern blot

    notebook 8.11.png

    August 25th ,2024: Screening of homoplasmy

    1.  Further confirm the homozygous state of transgenic plants through seed screening and plant regeneration. This typically involves sowing the seeds of transgenic plants on a medium containing a selection agent to test whether all offspring plants exhibit resistance.

    2.  Perform genetic analysis on the regenerated transgenic plants and their offspring to ensure that the chloroplast genome of all plants is homogenized, meaning that each chloroplast contains the same foreign gene.

    3.  Conduct phenotypic observations on the transgenic plants and their offspring to ensure that their growth and development are similar to those of wild-type plants, without any negative phenotypic effects.






    April 22th, 2024: Selection of Target Genes

    Spodoptera litura is an important crop pest, which has evolved a high degree of resistance to all insecticides targeted at it. After 24 h injection of 500 ng/μL dsRNA, the expression levels of SlCHS1 and SlCHS2 were significantly inhibited in S. litura (Yu et al.,2020). Among them, SlCHS1 has a high expression level in the outer epidermis and is exclusively expressed in the epidermis underlying the cuticular exoskeleton and related ectodermal cells such as tracheal cells, while SlCHS2 is highly expressed in the midgut, which protects the intestinal epithelium from mechanical disruption and invasion by various pathogens.

    These results suggest that SlCHS1 might play an important role during S. litura larval molting, while SlCHS2 has no significant effect on S. litura molting. Therefore, we have chosen SlCHS1 for further study.

    DNAMAN

    DNAMAN is a one-for-all software package for molecular biology applications. This package provides an integrated system with versatile functions for high efficiency sequence analysis. It can also perform multiple sequence alignment, designing PCR primers, protein sequence analysis or drawing plasmids.

    siDirect

    siDirect (http://design.RNAi.jp/) is a web-based online software system for computing highly effective small interfering RNA (siRNA) sequences with maximum target-specificity for mammalian RNA interference (RNAi). Highly effective siRNA sequences are selected using novel guidelines that were established through an extensive study of the relationship between siRNA sequences and RNAi activity. Our efficient software avoids off-target gene silencing to enumerate potential cross-hybridization candidates that the widely used BLAST search may overlook. The website accepts an arbitrary sequence as input and quickly returns siRNA candidates, providing a wide scope of applications in mammalian RNAi, including systematic functional genomics and therapeutic gene silencing.

    Wizard


    Chitin Synthase (CHS1 and CHS2)

    Chitin synthases are enzymes that catalyze the synthesis of chitin, a key component of the exoskeletons of arthropods, including insects. In the context of Spodoptera litura, SlCHS1 and SlCHS2 refer to two specific chitin synthase genes. SlCHS1 is highly expressed in the outer epidermis and related ectodermal cells, while SlCHS2 is primarily expressed in the midgut, playing roles in protection against mechanical disruption and pathogen invasion.

    Double-Stranded RNA (dsRNA)

    Double-stranded RNA (dsRNA) is a form of RNA that consists of two complementary strands. In the context of gene silencing, dsRNA can be used to trigger the RNA interference (RNAi) pathway, leading to the degradation of specific messenger RNAs (mRNAs) and the subsequent inhibition of gene expression.

    Artificial microRNA (amiRNA)

    Artificial microRNAs (amiRNAs) are synthetic small RNA molecules designed to mimic natural microRNAs. They are engineered to target and silence specific genes through the endogenous miRNA pathway. The backbone of an amiRNA refers to the sequence structure that is used to carry the guide sequence for targeting the mRNA of interest.

    Backbone Selection

    Backbone selection in the context of amiRNA design involves choosing the most effective pre-microRNA (pre-miR) structure from different organisms. The choice of backbone can influence the efficiency of gene silencing, with some backbones being more effective than others.

    Bioinformatics Tools

    Bioinformatics tools are computational programs and databases used to analyze biological data, such as DNA, RNA, and protein sequences. These tools can help predict the most effective fragments for designing amiRNAs, ensuring high specificity and minimal off-target effects.

    Polymerase Chain Reaction (PCR)

    Polymerase chain reaction (PCR) is a technique used to amplify specific DNA segments. It involves repeated cycles of heating and cooling to denature, anneal, and extend DNA, resulting in the exponential amplification of the target DNA sequence.

    Agarose Gel Electrophoresis

    Agarose gel electrophoresis is a method used to separate DNA, RNA, or proteins based on their size. The sample is loaded into wells in an agarose gel, and an electric current is applied, causing the molecules to migrate through the gel. Smaller molecules move faster and travel farther than larger ones.

    DNA Extraction and Purification

    DNA extraction and purification involve isolating DNA from a sample, such as a bacterial culture, and removing contaminants. This process typically includes cell lysis, followed by the addition of buffers to precipitate and purify the DNA.

    T4 DNA Ligase
    • T4 DNA ligase is an enzyme that catalyzes the formation of a phosphodiester bond between the 3' hydroxyl and 5' phosphate groups of two DNA fragments, joining them together. This enzyme is commonly used in molecular biology for the construction of recombinant DNA.
    Colony PCR

    Colony PCR is a method used to screen bacterial colonies for the presence of a specific DNA insert. A small portion of each colony is used as a template for PCR, and the resulting products are analyzed to determine if the desired DNA fragment has been successfully cloned.

    Gene Silencing

    Gene silencing is a process by which the expression of a gene is reduced or completely inhibited. This can be achieved through various mechanisms, such as RNA interference (RNAi), where double-stranded RNA (dsRNA) triggers the degradation of specific messenger RNAs (mRNAs).

    Insecticides
    • Insecticides are substances used to kill or control insects. They can be natural or synthetic and are commonly used in agriculture to protect crops from pests. Insects, like Spodoptera litura, may develop resistance to insecticides, necessitating the development of alternative control methods.
    Resistance

    Resistance in the context of pest management refers to the ability of an organism to withstand the effects of a substance that is normally toxic to it. For example, Spodoptera litura has developed a high degree of resistance to many insecticides, making traditional control methods less effective.

    Epidermis

    The epidermis is the outermost layer of cells covering an organism, including the skin of animals and the cuticle of plants. In insects, the epidermis is part of the exoskeleton and plays a crucial role in protection and support.

    Midgut

    The midgut is a part of the digestive tract in many animals, including insects. It is involved in the digestion and absorption of nutrients. In Spodoptera litura, the midgut is protected by chitin synthase 2 (SlCHS2), which helps maintain the integrity of the intestinal epithelium.

    Mechanical Disruption

    Mechanical disruption refers to physical damage to tissues or organs, which can occur due to external forces or internal processes. In the context of the midgut, mechanical disruption could result from the passage of food or the presence of pathogens.

    Pathogens

    Pathogens are organisms that cause disease. In the context of Spodoptera litura, pathogens could include bacteria, viruses, or fungi that invade the midgut and potentially cause harm to the insect.

    Molting
    • Molting is the process by which an insect sheds its old exoskeleton to allow for growth and the formation of a new one. This process is critical for the development of larvae into adults and is influenced by the activity of genes like SlCHS1.
    Electrophoresis

    Electrophoresis is a laboratory technique used to separate molecules based on their size and charge. In the context of molecular biology, agarose gel electrophoresis is commonly used to separate DNA fragments.

    Gelatin Agarose

    Agarose is a polysaccharide extracted from seaweed and is used to make gels for electrophoresis. Gelatin agarose typically refers to the preparation of an agarose gel, which is used to visualize and analyze DNA fragments after electrophoresis.

    DNA Quantification
    • DNA quantification is the process of measuring the concentration of DNA in a sample. This is important for ensuring that there is enough DNA for downstream applications, such as PCR, cloning, or sequencing.
    Transformation Mix

    A transformation mix is a solution containing plasmid DNA and other reagents that is used to introduce the DNA into bacterial cells. The mix is often prepared with a buffer and sometimes includes heat shock to facilitate the uptake of the plasmid by the bacteria.

    Heat Shock

    Heat shock is a method used in bacterial transformation where the cells are briefly exposed to high temperatures (typically 42°C) to increase the permeability of the cell membrane, allowing the uptake of plasmid DNA.

    Luria-Bertani (LB) Medium

    Luria-Bertani (LB) medium is a nutrient-rich broth or agar used for the growth of bacteria. It contains tryptone, yeast extract, and sodium chloride, and is often used in microbiology and molecular biology for culturing E. coli and other bacteria.

    Kanamycin

    Kanamycin is an antibiotic used to select for bacteria that have been successfully transformed with a plasmid carrying a kanamycin resistance gene. Only those bacteria that have taken up the plasmid will survive in the presence of kanamycin.

    Recombinant DNA

    Recombinant DNA is DNA that has been created by combining DNA sequences from different sources, often using restriction enzymes and DNA ligases. Recombinant DNA technology is used to create new genetic combinations that do not exist naturally.

    Expression Vector

    An expression vector is a type of plasmid or virus that is designed to carry a gene of interest into a host cell and promote the expression of that gene. Expression vectors typically contain regulatory elements, such as promoters and enhancers, to control the level and timing of gene expression.

    Syringe

    A syringe is a medical tool used to inject or withdraw fluids from the body. In the context of the experiment, a 50mL syringe is used to dispense artificial feed into small plastic boxes.

    Pipette

    A pipette is a laboratory tool used to measure and transfer precise volumes of liquid. In the experiment, pipettes are used to apply 200μL of fungal solution onto the feed.

    Fungus (Fungi)

    Fungi are a kingdom of organisms that include yeasts, molds, and mushrooms. They play a key role in the decomposition of organic matter and can also be used as biological control agents. In this experiment, five groups of fungi are applied to the feed to test their effects on Spodoptera litura larvae.

    Biological Detection


    • Biological detection involves the use of living organisms or their components to detect or measure the presence or effect of another substance. In the experiment, it refers to the process of observing and measuring the impact of the fungi on the larvae.
    qPCR (Quantitative Polymerase Chain Reaction)

    qPCR is a laboratory technique used to amplify and simultaneously quantify a targeted DNA molecule. It allows for the measurement of gene expression levels and is used here to detect and quantify specific genetic material in the Spodoptera litura larvae, possibly to assess the effects of the fungal treatment.

    Larvae

    Larvae are the juvenile form of many animals, especially insects, that undergo complete metamorphosis. In this experiment, the larvae of Spodoptera litura are the subjects being treated and observed.

    Bacterial Fluid

    Bacterial fluid may refer to a suspension containing bacteria or bacterial products. In the context of the experiment, it seems to be a term used to describe the fungal solution, although typically, bacteria and fungi are distinct types of microorganisms.