Engineering

Overview


POIROT can be divided into four segments: Biomarker, Amplication, Detection, and Visualization (Lateral Flow Assay, LFA). Among these, amplification and detection involved various approaches, and we dedicated significant effort to establishing the optimal amplification and detection method.
Throughout this process, while we were required to optimize many detailed conditions, we had kept in mind the proverb “Can't see the forest for the trees", not to lose sight of the bigger picture. We repeatedly asked ourselves, "How does this experiment contribute to POIROT?"
Wet Lab served as concrete evidence for the project's core, while Dry Lab provided a deeper understanding through model creation and helped define the project's limitations. The DBTL (Design, Build, Test, Learn) cycle is not just a tool to make the project better but is an essential process to establish projects. As Wet and Dry Lab worked in tandem to build POIROT, a variety of cycles - both large and small - emerged, from revisiting the amplification system to tuning specific conditions.
The diagram below shows the overview of our engineering cycle. Each larger cycle contains smaller cycles, which will be described in more detail below.

Biomarker


Cycle_1 - The pursuit of Reliable Biomarker -

  • We selected Three biomarkers for glaucoma.
  • We investigated whether similar sequence of biomarker miRNA are present in tear fluid.
  • You can search similar sequence for miRNAs in tear fluid using software we developed.

We had to select biomarker microRNA for glaucoma to use in POIROT. To guide our decision on which biomarkers to choose, we consulted with Prof. Ochiya, a leading expert in miRNA biomarker research in Japan.
For more detail about Human Practices, click here:

Through conversation with Prof. Ochiya, we learned that conducting a meta-analysis on tear fluid miRNAs would not guarantee reliability. MiRNAs in tear fluid have not been extensively researched. Therefore, we decided not to use meta-analysis. Instead, we selected miRNAs that reported as glaucoma biomarkers based on highly reliable papers introduced to us by Prof. Ochiya 1. After selecting the biomarkers, Dry Lab investigated whether any similar sequences to the chosen biomarkers exist in order to estimate the necessary sequence specificity for the amplification system.

We wrote a program in Python to search for the presence of biomarker-like sequences in tear fluids, using the results of a paper that profiled miRNAs predicted to be present in tear fluids.
For more detail about algorithm, click here:

We investigated whether miRNAs with sequences similar to those of hsa-miR-10b-5p, hsa-miR-375-5p, and hsa-miR-30d-5p, which we selected as biomarkers, were present in tear fluids.

miR-10b-5p

Hsa-miR-10a-5p, hsa-miR-100-5p, hsa-miR-99a-5p, and hsa-miR-99b-5p were found as miRNAs with sequences similar to hsa-miR-10b-5p. MiR-10a-5p consists of 23 mer, same with miR-10b-5p, with only the 12th base being different. MiR-100-5p, miR-99a-5p, and miR-99b-5p each consist of 22 mer, and when the 3' end is aligned with miR-10b-5p, mismatches occur on 4, 5, and 6 bases, respectively.

miR-375

As a result of the search for similar sequences, no miRNAs with sequences similar to hsa-miR-375 were found.

miR-30d-5p

Hsa-miR-30a-5p and hsa-miR-30e-5p were found to be miRNAs with sequences similar to hsa-miR-30d-5p. Both consist of 22 bases, with miR-30a-5p having a mismatch of one base and miR-30e-5p having a mismatch of two bases.

hogehoge

Figure 2. Similar miRNA sequences found in similar sequence search of (a) hsa-miR-10b-5p and (b) hsa-miR-30d-5p.
Light green bases in similar sequences represent mismatches with the target sequence.

Dry Lab's analysis revealed that sequences similar to the biomarker miRNA used in POIROT are present in tear fluids. If the sequence specificity of the amplification system is low, miRNAs other than the miRNAs that should be amplified will be amplified. This can cause false positives and reduce the reliability of the detection system.
Therefore, high specificity is required for the Amplification System.

Amplification


Previous studies such as DETECTR 2 and CONAN 3 amplify target single-stranded nucleic acids into double-stranded DNA (dsDNA). CRISPR-Cas12a (DETECTER) or Cas3 (CONAN) specifically recognize these dsDNA sequences. Similarly, in POIROT, we aim to amplify dsDNA that can be specifically recognized by CRISPR-Cas.

Our goal is to amplify dsDNA at a rate corresponding to the concentration of miRNA in tear fluid. Therefore, amplification is the core of POIROT. POIROT aims to be a "home-use detection device," with the requirement that the amplification process proceeds isothermally, without any temperature change. In addition, it should be capable of amplifying miRNAs at around 1 fM to approximately 10 nM dsDNA within tens of minutes. Additionally, since it is intended for use outside the laboratory, robustness is absolutely essential.

Cycle_1 - For signal amplification and quantification without enzyme -

  • We focused on HCR to produce dsDNA.
  • Amplification efficiency of HCR does not meet our requirement.
  • We concluded HCR cannot be used to connect with other method from experiment result.

We aim to develop an amplification system in which the final dsDNA product contains CRISPR-Cas recognition sequences corresponding to the concentration of the target miRNA. Our first choice was to use a method that can amplify and quantify isothermally, without the use of enzymes.

We utilize the Hybridization Chain Reaction (HCR) 4, a method for producing dsDNA from single-stranded nucleic acid. For detection of the reaction products, gel electrophoresis is used. Since the resolution provided by agarose gel electrophoresis was insufficient, we considered using capillary electrophoresis for more precise identification.
The HCR method we use involves three types of DNA with hairpin structures as templates. This method needs annealing operations just before the reaction to induce the formation of hairpin structures. However, considering home use, the complex temperature changes required for annealing would be avoided.
If there is a long interval before starting the reaction, structural changes could occur. If no structural changes occur and the presence or absence of the annealing operation does not affect the results, the method could be considered for home use. However, if structural changes lead to the initiation of the reaction even in the Negative Control (NC), incorporating HCR into POIROT is impossible.
Therefore, we also conducted an investigation on the result without annealing operation.

hogehoge

Figure 3. Mechanism of HCR

With annealing operation

We conducted HCR using ssDNA as the target and performed agarose gel electrophoresis to confirm the reaction proceed. While we were able to confirm that hybridization occurred at higher target concentrations, we were unable to effectively distinguish and quantify the various reaction product DNAs. Multiple types of DNAs are expected to be found.

Without annealing operation

Reaction products were observed regardless of the presence or absence of the target. For more detail, see Results.

The detection limit of the MultiNA system is around 100 nM 5, making it difficult to observe whether reaction products are being generated at lower concentrations. The peaks obtained from the MultiNA analysis were attributed to nucleic acids that could potentially exist in the system. Taking into account measurement errors and the formation of incomplete dsDNA, we made the following attributions. The reaction products were, at most, oligomers with around n = 20. Even if hybridization occurred at low target concentrations, the amplification efficiency achieved is far below what we require.

hogehoge

Table 1. Analysis of HCR
T: Target, H1: Hairpin1, H2: Hairpin2, H3: Hairpin3

In the experiment above, we used DNA that had been annealed just before the reaction. However, without annealing operation, amplification occurred even in the NC. The fact that the reaction proceeded independently of the target suggests a critical problem, as it could lead to false positives. Therefore, incorporating HCR into POIROT is not a practical option.
The lack of amplification efficiency is another issue. To address this shortcoming, we considered connecting HCR with other amplification systems, using HCR in the final stage to produce dsDNA. However, due to the inevitable structural changes in the hairpin, we concluded that the use of HCR itself is impractical for our purposes.

Furthermore, Cas12a and Cas3 are activated to some extent even by ssDNA containing a spacer sequence 6. In order for HCR to connect to CRISPR-Cas, the hairpin must have a spacer sequence, and the spacer sequence must be present in the solution at the start of the reaction. This suggests the possibility that CRISPR-Cas would be activated independently with the target miRNA.
For these reasons, enzyme-free systems are decided to be not suitable for use with POIROT, and it is needed to use an amplification mechanism that ensures sufficient amplification efficiency dependent on the target miRNA concentration.
→Cycle_2

Cycle_2 - The quest for reliable exponential amplification -

Cycle_2-1

  • We focused on exponential amplification method, EXPAR (Exponential Amplification Reaction).
  • Wet Lab reproduced previous study and Dry Lab reproduced Wet Lab's result by fitting and improved model.
  • We would be able to achieve enough amplification efficiency by EXPAR, however, EXPAR might lacks robustness.

We aimed to produce dsDNA by amplifying ssDNA with the same sequence as miRNA (sequence with U replaced by T) using EXPAR (Exponential Amplification Reaction) 7, which is expected to have sufficient amplification efficiency, and then performing an extension reaction using one of the target dsDNAs as a template.

hogehoge

Figure 4. Mechanism of EXPAR

Carter, J. G. et al. used EXPAR to obtain amplification products of the target concentration in about 10-20 minutes 7. We performed a preliminary experiment using the protocol described in their paper and were able to obtain the expected amplification products.

hogehoge

Figure 5.

To evaluate the robustness, the amplification curve was examined in Wet Lab with different concentration of the template, DNA polymerase, and nickase concentration.
In addition, referring to previous study 8, we investigated whether the nickase activity could be changed during the amplification reaction by incubating the nickase before use.

With annealing operation

Experiments with different sets of target, template, DNA polymerase, and nickase concentration.

hogehoge
hogehoge hogehoge

Figure 6 - Figure 8.

The time it takes for amplification to occur under the same conditions has been reduced by about five times.

The shape of the amplification curve was highly dependent on the template concentration.
Regarding DNA polymerase and nickase concentrations, the higher the concentration, the faster the amplification, but above a certain concentration, it became stable. Further experiments were conducted to find the cause and solution of the large change in reaction rate under the same conditions.

Based on several previous studies that have done ODE modeling of EXPAR 8, 9, 10, the ODE model of EXPAR in this project was constructed as follows.

hogehoge

Figure 9. The model of EXPAR
X: The target. T: Template. XT: The complex of X and T. W: The complete double-strand. Z: The nicked double-strand.

Based on the figure, an ODE was set up and the fluorescence intensity was predicted as shown below.

hogehoge

Figure 10.

Based on several previous studies that have done ODE modeling of EXPAR 9, 10, 11, the ODE model of EXPAR in this project was constructed as follows.

hogehoge

Figure 11. The model of EXPAR. X: The target. T: Template. XT: The complex of X and T. W: The complete double-strand. Z: The nicked double-strand.

Cycle_2-2

  • We evaluated robustness of EXPAR.
  • We conducted experiment with various concentration of polymerase or nickase.
  • We showed that EXPAR is a system that is highly dependent on the enzyme activity. Robust methods are needed.

A sudden change in amplification rate is undesirable from the view of robustness. To experimentally investigate which parameters affect the amplification rate, we investigate the extent to which amplification is affected by the purification grade of ssDNA and enzyme concentration.

To evaluate the influence of the purification grade of the template and target, experiments were performed using ssDNA purified by OPC (Oligonucleotide-Peptide Conjugates) and PAGE (Higher purification grade than OPC). We also investigated the behavior of the amplification rate when the polymerase and nickase concentrations were lowered after changing the lot.

Wet Lab conducted EXPAR using ssDNA from OPC and PAGE as the target and template, with the other conditions kept. No significant difference in the amplification rate due to the purification grade was confirmed.

hogehoge hogehoge

Figure 12.

When the polymerase concentration was reduced to 1/8 and the nickase concentration to 1/16 of the initial concentration, the amplification rate was almost the same as the initial result, and it was possible to distinguish between the result of 100 fM input and NC.

hogehoge

Figure 13.

It was shown that EXPAR is a system that is highly dependent on the enzyme activity. When EXPAR is included in the amplification system, the overall robustness decreases, so we were needed to consider a different amplification system.
In addition, when considering amplification from tears, specificity becomes important. Namely, a system that can clearly distinguish similar sequences is desired. →Cycle_3 - The pursuit of robustness and specificity -

Cycle_3 - The pursuit of robustness and specificity -

Cycle_3-1

  • We focused on TWJ-SDA. TWJ-SDA is reported to have high specificity.
  • Similar sequences of biomarker miRNA would present in tear fluid. We require high specificity for amplification.
  • Wet Lab showed that TWJ-SDA has significantly superior specificity. Dry Lab build model, but more improvement was needed to provided theoretical justification.

As discussed in Biomarker-Cycle_1, we found a similar sequence with a single base mutation for our target miR-10b-5p, and a similar sequence with a single and two base mutations for miR-30d-5p. Given the possibility that these similar sequences are present in tears, the system requires high sensitivity as well as high specificity.
POIROT uses tears, so the possibility that miRNAs with similar sequences may exist in the system cannot be denied. In other words, not only high sensitivity but also specificity is required. Chen, M. et al. have reported that high specificity for the target can be expected by using TWJ 11. In order to utilize this high specificity in POIROT, we considered using it as the starting point of the amplification system.

We used the mechanism below 11 that targets hsa-let-7b. This system uses SDA starting from the primer produced from TWJ to increase the amplification efficiency, and measures fluorescence using Molecular Beacon (MB).
We used DNA corresponding to let-7b, as well as the subspecies hsa-let-7a, 7c,...,7i, and let-7b with single base mutations at the 1st, 3rd, 5th, 7th, 9th, 11th, 13th, and 15th bases from the 5' end as targets, and investigated what kind of amplification curves would result.
We also performed a similar experiment with SDA that does not create TWJ, and compared the specificities of each.

hogehoge hogehoge

Figure 14. Left: TWJ, Figure 15. Right: Non-Junction

The results are shown below.

hogehoge hogehoge hogehoge hogehoge

Figure 16. - Figure 19.

TWJ can completely distinguish between subspecies, and can also distinguish between single-base mismatches. The fluorescence intensity after 40 minutes of incubation is shown in the graph below, confirming the high specificity of TWJ. In the case of single-base mismatches, specificity was slightly lower when mutations were added to the 1, 9, and 11 mers from the 5' end. However, there was a significant difference with let-7b in the case of mutations in the 9 and 11 mers.
The use of TWJ will ensure the sequence specificity of the POIROT target. For a detailed analysis, see TWJ-2cycle.

hogehoge hogehoge hogehoge hogehoge

Figure 20. - Figure 23.

Similar to NJ-SDA, TWJ Amplification was also modeled to form a ternary complex by one-step binding, and the amplification of let-7b and mismatch-5 was compared. The result that NJ-SDA cannot distinguish between let-7b and mismatch-5 was reproduced, but the result that TWJ-SDA can distinguish between let-7b and mismatch-5 was not reproduced. Therefore, the TWJ-SDA ternary complex was modified to form in two steps and have multiple reaction pathways, and the above experimental results were reproduced.

Even if the model was simplified to have one reaction pathway, the experimental fact that TWJ Amplification can still distinguish between let-7b and mismatch-5 was reproduced. By moving the binding constant as a parameter in this model, it was suggested that the specificity of TWJ-SDA is due to the fact that the binding constant is kept small by the Target, Template, and Helper binding in multiple steps via a reaction intermediate. For more information, see Model_Specificity.

The experimental result that NJ-SDA cannot distinguish between let-7b and mismatch-5 was reproduced, but the experimental result that TWJ-SDA can distinguish between let-7b and mismatch-5 was not reproduced.

This suggests that this model is insufficient to show the characteristics of TWJ Amplification. Therefore, we decided to develop a new model.

Cycle_3-2

  • Dry Lab tried to identify the cause of the high sequence specificity of TWJ-SDA by ODE Model.
  • The ODE Model clarified the cause of the high sequence specificity, and Dry Lab was able to create the model that reproduced the results of experiments from Wet Lab.
  • The ODE Model clarified the conditions of TWJ-SDA helper and target for the sequence specificity.

Based on helpful advice from Human Practices, we created a new model. In the new model, a TWJ complex is formed through a two-step binding process, in order to more accurately replicate the physical phenomena.

We converted the above model into ODEs and simulated it in Python.

For more information, click here:

In our new model, TWJ Amplification can distinguish between let-7b and mismatch-5, which matches the experimental results obtained from the Wet Lab. What is crucial here is understanding why the change of the model allows us to replicate the specificity of TWJ-SDA Amplification. In order to identify the underlying reasons for the specificity of TWJ-SDA Amplification, we simplified the model to have one reaction pathway. Even if the model was simplified to have one reaction pathway, the experimental fact that TWJ-SDA Amplification can still distinguish between let-7b and mismatch-5 was reproduced. By moving the binding constant as a parameter in this model, it was suggested that the specificity of TWJ-SDA is due to the fact that the binding constant is kept small by the target, template, and helper binding in multiple steps via a reaction intermediate.
In Wet Lab, the results showed that specificity decreased when a mutation was introduced at the end of the target or near the junction structure. A model of binding in multiple stages reproduced these results. This suggests that the reason why specificity decreased when a mutation was introduced at the end or junction is because the thermodynamic stability of the ternary complex decreased. However, in the model, the difference in the predicted location of the mutation was not as significant as the results observed in Wet Lab. Analysis of the model that reproduced the results of Wet Lab revealed that the binding constant is important.

From the analysis of the model, it is expected that when a mutation is introduced near the 5' end (for example, mismatch-5), the binding constant between the template and target, and the binding constant between the target-helper complex and the template. Therefore, \(tt\) (the length of the binding region between the target and the template), \(ht\) (the length of the binding region between the helper and the template), are particularly effective in specificity. In addition, when a mutation occurs near the 3' end (e.g. mismatch-15), the binding constant between the target and helper, and the binding constant between the target and template complex and the helper are expected to be important factors. In other words, the length of the base pair where the target and helper bind, and \(ht\) are expected to be particularly important factors for specificity.

Cycle_3-3

  • Dry Lab investigated whether TWJ-SDA alone is sufficient for amplification efficiency.
  • The simulation results using the ODE Model showed that TWJ-SDA alone does not meet the required amplification efficiency.

The high specificity of TWJ-SDA (Fig. 6) was demonstrated in Cycle_3-2. However, due to the nature of the reaction in which the target binds to the template and undergoes strand displacement, the amplification efficiency of TWJ-SDA is limited by the target concentration. We used a simulation with the TWJ-SDA ODE model to determine whether the amplification system for this project was sufficient. In Wet Lab experiments, the presence or absence of amplification can be checked by observing the fluorescence, but this modeling is essential because the actual concentration of the amplified product cannot be measured.

We built TWJ ODE model based on the TWJ mechanism 11.

hogehoge

Figure 24. The model of TWJ. C: The complex of target and primer. T: template. CT: the complex of C and T. W: the complete double-strand. Z: the nicked double-strand. X: products.

The simulation result with the initial target concentration being 100 fM is below.

hogehoge

Figure 25. The simulation of TWJ-SDA. The blue represents the concentration of X.

It was shown that 40 min of TWJ-SDA only resulted in amplification of approximately 3.0 pM from a target of 100 fM. This alone is far from the amplification efficiency required by POIROT.
From the above, the ODE model suggests that for POIROT, the amplification efficiency of TWJ-SDA is insufficient. Reactions with higher amplification efficiency needed to be combined with TWJ-SDA. A detailed discussion, see Model.

Cycle_4A - Balancing specificity and amplification efficiency -

Cycle_4A-1

  • We focsed on "multistep-SDA" to achive enough amplification efficiency.
  • The more steps of SDA is connected, the higher amplification rate would be achieved.
  • We considered an unique amplification method that connecting TWJ-SDA and multistep-SDA.

The amplification efficiency of TWJ-Amp is insufficient, and it is necessary to combine TWJ-Amp with a reaction with higher amplification efficiency. Komiya et al. have developed a method to link multiple SDAs to improve amplification efficiency 12. We call this amplification system that links multiple SDAs as "Multistep-SDA".

We conducted experiments by changing the number of steps using the mechanism and sequence of Komiya et al.'s research 12. In the paper, no increase in fluorescence intensity is confirmed when the target is not present though the amplification proceeds slowly.
We confirmed the change in amplification efficiency by linking multiple SDAs.
In addition, in the paper, the 3' end of the template is modified with a quencher, but we planned first to conduct experiments without this modification. For each, we linked SDA at various step(s) and conducted experiments at various target concentrations.

As shown in the figure below, it was confirmed that the amplification efficiency increased with each step, but when two or more steps were linked, an increase in fluorescence intensity was confirmed even in the absence of a target.

hogehoge hogehoge hogehoge

Figure 26. - Figure 28.

When 3' end modification was modified with a quencher amplification in the absence of the target was suppressed, as shown in the graph on the right.

hogehoge hogehoge

Figure 29. and Figure 30.

Both Wet Lab and Dry Lab confirmed that amplification could be achieved by linking multistep-SDA with a template modified with a quencher at the 3' end. Also, it was confirmed that the amplification efficiency improved with an increase in the number of steps.
Furthermore, Dry Lab simulation confirmed that the robustness was improved compared to EXPAR.
Furthermore, the dry simulation confirmed that the robustness was improved compared to EXPAR.
However, within 200 minutes of observation, amplification was confirmed at 100 pM or more input.
This is inappropriate to be used in the model because it ignores the binding of the template to the 5' end. Based on the wet experimental results, we needed to further bring a more appropriate model and optimize the template design and concentration.
To examine as an amplification system in POIROT, we will consider linking from TWJ and redesign the template to improve amplification efficiency.

Cycle_4A-2

  • We successfully connected TWJ-SDA and multistep-SDA by re-designing templates.
  • We could distinguish between the result of 1 fM - 100 fM miRNA in tear fluid using this method.
  • Robustness is also important aspect and more discussion was conducted in Cycle_4A-3.

In the following, the template for TWJ-SDA is abbreviated as template0, and the templates for subsequent SDA steps are abbreviated as template1, template2, and template3, and the ssDNA output from template-n is called primer-n.
When the template sequence used in Cycle_4A-1 was used as is, it did not work well, and no difference was observed between TWJ alone and when it was linked.
There are two regions that can hybridize for each primer. That is, the 5' end of the template from which the primer is output and the 3' end that is the starting point for the next step. For example, primer1 can hybridize to the 5' end of template1 and the 3' end of template2.
As shown here, it is more stable for each primer to bind to the 5' end of the template in the previous step than to hybridize to the 3' end of the template in the next step.

hogehoge

Figure 31. Diagram of primarily template

Considering the above, we started redesign of template1, template2, and template3.

To ensure amplification efficiency, it is necessary to encourage the primer released by strand displacement to hybridize preferentially to the 3' end of the template in the next step.
The sequence was changed as follows.

Before After
template1 GAAACCCAGCAGACAATGTCCT
CAGCTCAACATCAGTCTGATAAG
GAAACCCAGCAGACAATGTCCT
CAGCTCAACATCAGTCTGATAAGCCTCA
template2 TTCCTGCTGAACTGAGCCACCT
CAGCGAAACCCAGCAGACAATGT
TTCCTGCTGAACTGAGCCACCT
CAGCGAAACCCAGCAGACAATGTCCTCA
template3 AGCCCTGTACAATGCTGCTCCT
CAGCTTCCTGCTGAACTGAGCCA
AGCCCTGTACAATGCTGCTCCT
CAGCTTCCTGCTGAACTGAGCCACCTCA

Table 2. Re-design templates

When an experiment was performed using the redesigned sequence starting from Biomarker 1, the shape of the amplification curve changed as follows

hogehoge hogehoge

Figure 32. and Figure 33.

Calculations using NUPACK confirmed that the released primer hybridized more stably with the 3' end of the template in the next step.

hogehoge

Figure 34. Diagram of re-design template

By redesigning the template, it was shown that a series of TWJ > Multistep-SDA ligations can distinguish between the result of 1 fM - 100 fM input.
Since TWJ is used as the starting point, this mechanism is considered to be appropriate in terms of specificity. By using this method as an amplification system for POIROT, it will be possible to detect extremely low concentrations of miRNA.

Cycle_4A-3

  • Dry Lab compared three options for the next amplification method of TWJ-SDA, and tried to propose the better one.
  • Dry Lab built ODE Models for the three amplification methods, and compared their amplification efficiencies, P/N ratios, and robustness to reaction time and enzyme activity.
  • As a result of the comparison, Dry Lab proposed TWJ-SDA > 3step-SDA as the better amplification method.

We investigated the effectiveness of Multistep-SDA and experimentally examined whether the product of TWJ-SDA can be used as a target. Moreover, we constructed ODE models for TWJ-EXPAR, TWJ-SDA > 2step-SDA, and TWJ-SDA > 3step-SDA, and compared these amplification systems in terms of amplification efficiency, Positive to Negative Ratio (P/N Ratio), robustness to reaction time and to enzymes activity.

Dry Lab constructed the ODE model of TWJ-SDA > EXPAR, TWJ-SDA > 2step-SDA, and TWJ-SDA > 3step-SDA. The outline of model of TWJ-SDA > EXPAR is shown in the figure below. For more details on the ODE models of other amplification systems, see Model.

hogehoge

Figure 35. The model of TWJ-SDA > EXPAR

The amplification efficiency of each amplification system was predicted as follows. Simulations were conducted for multiple initial template concentrations for each amplification system. The red line indicates the desired product concentration.

hogehoge hogehoge hogehoge

Figure 36. - Figure 38. Model: comparison of reaction

First, based on the results of the ODE models for TWJ-SDA > 2step-SDA, it was shown that the amplification efficiency is insufficient. TWJ-EXPAR and TWJ-SDA > 3step-SDA showed enough ampification efficiency for POIROT. TWJ-SDA > 3step-SDA was proposed as the most suitable amplification system for POIROT from the perspective of amplification efficiency and robustness to enzymes. Furthermore, the optimal initial template concentration was proposed for TWJ-SDA > 3step-SDA.
For more details, see Model.

Cycle_4B - Proof of the Feasibility of Sequence Design -

  • Wet Lab conducted experiments to measure S/N ratio for various templates and helpers designed by Dry Lab, and found out the best template and helper for biomarkers.
  • Dry Lab anbalyzed Wet Lab's data, and provided theoretical justification by building an unique model.
  • These efforts made it possible to design reasonable template and helper for various biomarker miRNAs.
  • You can design an appropriate template and helper for your favorite miRNA using our Software.

We conducted designing the helper and template of TWJ-SDA. The key factors in sequence design are target specificity and S/N ratio. Dry Lab aimed to predict the conditions for the helpers and templates that achieve target specificity and high S/N ratio using an ODE model. Wet Lab conducted TWJ-SDA using various templates and helpers and measured S/N ratio.

By changing miRNA-complementary sequence, they then recognize other miRNA.

hogehoge

Figure 39. Mechanism of re-design of template and helper for biomarker

For biomarker 1, 2, and 3, the hybridize lengths of template and target were 10, 11, and 12 bp, and the hybridize lengths of helper and template were 5, 6, 7, and 8 bp, respectively. Wet Lab conducted TWJ-SDA using 3 templates and 4 helpers, and measured S/N ratio.

The results for biomarker1 were plotted below:

hogehoge hogehoge hogehoge hogehoge hogehoge hogehoge hogehoge hogehoge hogehoge

Figure 40. - Figure 48.

for more detail, see Wet_Result_Designed-Sequence.

S/N ratio were shown below:

hogehoge hogehoge hogehoge

Figure 49. - Figure 51.

The larger this ratio, the more clearly the target concentration can be distinguished.
For Biomarker 1, when the condition was 12-5, that is, when the hybridize length between template and target was 12 bp, and the hybridize length between template and helper was 5 bp, the ratio was the largest.
Similarly, it was concluded that 10-5 or 12-7 for Biomarker2 and 12-6 for Biomarker3 would be optimal.

ODE Simulation was conducted using Python.
For detailed information, click Model

ODE simulation showed that sequence specificity in TWJ is achieved when the association constant (\(a_3\)) of the complex between target and helper is less than \(10^3\).

hogehoge

Figure 52. The comparison of the specificity when \(a_1, a_3\) are varied in Model 2(mismatch-5).

Furthermore, the ODE Model simulation was able to predict helpers and template that result in a high S/N ratio to some extent.

hogehoge

Figure 53. The heatmap of experimental and simulated S/N Ratio.

The horizontal axis shows the rank order of large and small S/N Ratio in the simulation and the vertical axis shows the rank order of large and small S/N Ratio in the experiment.

By using the ODE model above, Dry Lab developed software to predict the optimal templates and helpers. This software can assist in the design of templates and helpers for various miRNAs.
For more details about the software, click here:

Cycle_5 - Establishment of Detection System

  • We aim to complete the series of Amplification and Detection system.
  • Wet Lab successfully destinguish NC and 1 fM or higher by tuning the concentration of template.
  • Both Wet Lab and Dry Lab must work hard to suppressing NC by conducting more experiments and improving models

We aim to complete the flow from Biomarker > TWJ-SDA > Multistep-SDA > Cas. Cas3 or Cas12a is activated by the PAM sequence in dsDNA and the spacer sequence in DNA. It has been reported that even incomplete PAM and spacer sequences can exhibit some collateral activity 3. By using the complementary strand of the spacer as the final template, we designed Cas would be only activated when amplification occurs.
Additionally, for the reasons mentioned in the Cycle_Detection, Cas3 is the most suitable Detection Module for use in POIROT.

We designed the template of the final-step and confirmed in silico that amplification occurs without problems. From the 3' end, the template includes the region complementary to the primer, the Cas recognition site.

We connect to Cas3 at various amplification stages, including only the final stage, from the middle of multistep-SDA to the final stage, and from miRNA to the final stage.

The result was shown below.

hogehoge hogehoge hogehoge hogehoge

Figure 54. - Figure 57.

When connected ds-amplification > Cas3, the amplification curve showed dependence on target concentration. As the number of amplification steps increased, the amplification of the NC became non-negligible.
By tuning the concentration of template, we were able to distinguish NC and 1 fM or higher.

hogehoge hogehoge hogehoge

Figure 58. - Figure 60.

For more detail about tuning, Please click here:

As the number of amplification steps increases, the collateral activity of CRISPR-Cas independ on the target, becomes more prominent. Suppressing NC is a challenge for the future.
To achieve this, it is necessary to optimize the concentrations of polymerase, nickase, and template. Regarding template concentration, there are many kinds of templates in POIROT. Conducting Wet Lab experiments to independently modify each of them is not practical.
Therefore, it is essential to improve the model by obtaining additional parameters and use it to find the optimal conditions.

Detection - CRISPR-Cas -


Cycle_1 - Module for Visualizing Concentration Information -

  • We compared the collateral activity of Cas3 and Cas12a and chose Cas3 as a detection module.
  • We demonstrated the cleavage rate is proportional to dsDNA concentration within a certain range.
  • The cleavage rate for Cas12a is approximately five times faster than that of Cas3 at the same dsDNA concentration.

We had considered using CRISPR-Cas3 or Cas12a as a detection unit. They exhibit collateral activity and work at 37 °C with dsDNA, suitable for signal amplification and visualization of POIROT. By comparing the collateral activity of Cas3 and Cas12a, we determined which type of Cas to use for POIROT.

We added dsDNA recognized by Cas at various concentrations and tracked the cleavage rate of the FQ probe by measuring fluorescence intensity. These experiments were conducted for both Cas3 and Cas12a to evaluate the cleavage rate of collateral activity.

The result was shown below.

hogehoge hogehoge

Figure 61. and Figure 62.

We calculated the cleavage rate from the slope. The slope of the amplification curve represents the cleavage rate of the collateral activity. We demonstrated the cleavage rate is proportional to dsDNA concentration within a certain range.

hogehoge

Figure 63.

The cleavage rate is directly proportional to dsDNA concentration within a certain range. The proportional range is wider for Cas3. The cleavage rate for Cas12a is approximately five times faster than that of Cas3 at the same dsDNA concentration.
One of the weaknesses of the amplification system of POIROT is that target independent amplification is a challenge. Therefore, using Cas3 is considered more appropriate than Cas12a, as Cas12a triggers collateral activity even at low concentrations of the final product.

Visualization - Lateral Flow Assay -


So far, we have demonstrated the Limit of Detection (LoD) and specificity of POIROT's detection system. We proved that POIROT is equipped with a robust, specific, and sensitive, and versative detection mechanism. However, POIROT still needs one final piece: a system that clearly presents the results to the user without the need for specialized equipment. We focused on Lateral Flow Assay (LFA), a method commonly applied in pregnancy test kits.

Cycle_1 - Tuning of LFA -

  • Wet Lab conducted experiments to evaluation of the effect of solution viscosity on the results by adding PEG.
  • It turned out that turning of flow rate (or solution viscosity) is essential to POIROT.
  • Designing Hardware well, tuning of flow rate might become possible.

We assembled the LFA with reference to CONAN developed by Yoshimi et al. 3.
The strip used was pre-installed with AuNPs with rb anti FITC antibody on the conjugate pad, streptavidin on the control line (C-line), and anti rb antibody on the test line (T-line). FITC-ssDNA-biotin was used as a reporter 13. When CRISPR-Cas3 is activated, the ssDNA within the FITC-ssDNA-biotin is cleaved, producing FITC-labeled reporter fragments and biotin-labeled reporter fragments. Using this, both the T-line and C-line turn red if the test is positive, and only the C-line turns red if the test is negative.
Previous studies have shown that whether the T-line develops color in the same sample can depend on the flow rate and the amount of FITC-ssDNA-biotin added 13. In our designed device, it is possible to adjust the flow rate and reaction time.
Based on this, we aim to demonstrate the quantification potential of miRNA concentration (more precisely, the signal amplified from miRNA) by tuning the flow rate.
For details about the device, please click here:

We compared the conditions with and without the addition of 5% Polyethleneglycol (PEG). For each condition, we developed FITC-ssDNA-biotin solution and TE alone for 5 min. The case where FITC-ssDNA-biotin was added corresponds to the negative control, while the case where it was not added corresponds to the positive control.

Without adding PEG, both the C-line and T-line turned red regardless of whether FITC-ssDNA-biotin was added or not. In the case with 5% PEG, only the C-line turned red when uncleaved FITC-ssDNA-biotin was added (corresponding to a negative result), while both the C-line and T-line turned red when FITC-ssDNA-biotin was not added (corresponding to a positive result).
The upper strip had no PEG added to the buffer, and the lower strip had PEG added to the buffer.

hogehoge

Figure 64. LFA: The upper PEG (-) / The lower PEG (+)

It was confirmed that the viscosity of the solution is an important factor for LFA. Under our experimental conditions, adding 5% PEG to increase the viscosity seems to achieve the appropriate flow rate. When implementing POIROT, in addition to adjusting the viscosity, it will be necessary to fine-tune the width of the device's flow path to ensure accurate visualization at home.

Cycle_2 - POIROT -

  • Through we could distingish positive and negative, we could not distinguish positive and negative connection amplification, Cas3 and LFA.
  • More effort is needed to establish POIROT.

To confirm that the combination of amplification, Cas3, and LFA allows for successful visualization for POIROT, we conducted experiments.

Under the conditions tuned in Cycle_5, we performed a comparison between the presence and absence of the target using the 1-step SDA > Cas3 > LFA system.

hogehoge

Figure 65. Mechanism of 1step-SDA > ds-amp > Cas3 > LFA

Under these conditions, fluorescence measurement using the FQ probe successfully distinguished between the presence and absence of the target.

In both cases, T-lines were not turned red.
The upper strip is NC and the lower strip is when primer2 was added.

hogehoge

Figure 66. LFA: The upper NC / The lower PC

The factors that prevented the distinction between positive and negative resultsare currently unknown. While the concentration of FITC-ssDNA-biotin and flow rate are likely contributing factors, it is also necessary to investigate further to determine whether sufficient cleavage of FITC-ssDNA-biotin occurred in the first place.
In addition to that, it is known that in many cases, miRNAs that serve as biomarkers are expressed in both glaucoma patients and healthy subjects. To distinguish between healthy individuals and those with the condition based on miRNA concentration, it is necessary to identify not just an "all or none" response, but variations in signal strength.
To achieve this, optimizing factors such as the concentration of FITC-ssDNA-biotin and flow rate is essential.

Our journey continues toward the completion of POIROT.

To see our success, click here:

References


  1. Cho, H.-k., Seong, H., Kee, C., Song, D. H., Kim, S. J., Seo, S. W., & Kang, S. S. (2022). MicroRNA profiles in aqueous humor between pseudoexfoliation glaucoma and normal tension glaucoma patients in a Korean population. Scientific Reports, 12(1), 6217. https://doi.org/10.1038/s41598-022-09572-4

  2. Chen, J. S., Ma, E., Harrington, L. B., Da Costa, M., & Doudna, J. A. (2018). CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science, 360(6387), 436-439. https://doi.org/10.1126/science.aar6245

  3. Yoshimi, K., Takeshita, K., Yamayoshi, S., Shibumura, S., Yamauchi, Y., Yamamoto, M., Yotsuyanagi, H., Kawaoka, Y., & Mashimo, T. (2022). CRISPR-Cas3-based diagnostics for SARS-CoV-2 and influenza virus.iScience 25, 103830, 1-13. https://doi.org/10.1016/j.isci.2022.103830

  4. Jia, H.-Y., Zhao, H.-L., Wang, T., Chen, P.-R., Yin, B.-C., & Ye, B.-C. (2022). A programmable and sensitive CRISPR/Cas12a-based MicroRNA detection platform combined with hybridization chain reaction. Biosensors and Bioelectronics, 211, 114382.https://doi.org/https://doi.org/10.1016/j.bios.2022.114382

  5. Shimadzu Corporation. (n.d.). Microchip Electrophoresis System for DNA/RNA Analysis MCE-202 MultiNA Instruction Manual. http://mor.niboch.nsc.ru/public/MBA_Course/References/Electrophoresis/devices/
    Shimadzu%20MultiNA%20manual.292-28464D_SWmanualMCE-202(E).pdf

  6. Yoshimi, K., Takeshita, K., Kodera, N., Shibumura, S., Yamauchi, Y., Omatsu, M., ... & Mashimo, T. (2022). Dynamic mechanisms of CRISPR interference by Escherichia coli CRISPR-Cas3. Nature Communications, 13 (4917), 1-11. https://doi.org/10.1038/s41467-022-32618-0

  7. Carter, J. G., Orueta Iturbe, L., Duprey, J. H. A., Carter, I. R., Southern, C. D., Rana, M., Whalley, C. M., Bosworth, A., Beggs, A. D., Hicks, M. R., & Tucker, J. H. R. (2021). Ultrarapid detection of SARS-CoV-2 RNA using a reverse transcription-free exponential amplification reaction, RTF-EXPAR. Proceedings of the National Academy of Sciences, 118(35), e2100347118. https://doi.org/10.1073/pnas.2100347118

  8. Özay, B., Murphy, S. D., Stopps, E. E., Gedeon, T., & McCalla, S. E. (2022). Positive feedback drives a secondary nonlinear product burst during a biphasic DNA amplification reaction. Analyst, 147(20), 4450-4461.https://doi.org/10.1039/D2AN01067D

  9. Van Ness, J., Van Ness, L. K., & Galas, D. J. (2003). Isothermal reactions for the amplification of oligonucleotides. Proceedings of the National Academy of Sciences, 100(8), 4504-4509.https://doi.org/10.1073/pnas.0730811100

  10. Chen, J., Zhou, X., Ma, Y., Lin, X., Dai, Z., & Zou, X. (2016). Asymmetric exponential amplification reaction on a toehold/biotin featured template: an ultrasensitive and specific strategy for isothermal microRNAs analysis. Nucleic acids research, 44(15), e130-e130.https://doi.org/10.1093/nar/gkw504

  11. Qing, Z., Feng, C.,Feng, X., Yongxi, Z., & Chunhai, F. (2014). Target-Triggered Three-Way Junction Structure and Polymerase/Nicking Enzyme Synergetic Isothermal Quadratic DNA Machine for Highly Specific, One-Step, and Rapid MicroRNA Detection at Attomolar Level. Anal. Chem. 2014, 86, 16, 8098-8105. https://doi.org/10.1021/ac501038r

  12. Komiya, K., Noda, C. & Yamamura, M. (2024). Characterization of Cascaded DNA Generation Reaction for Amplifying DNA Signal.New Gener. Comput. 42, 237-252. https://doi.org/10.1007/s00354-024-00249-2

  13. Milenia Biotec GmbH. (n.d.). CRISPR/Cas-based Detection Methods and HybriDetect: Universal Test Strips - Individual Readout. https://www.milenia-biotec.com/uploads/2019/07/improved-CRISPR-readout_final-1.pdf

Back to Top CDDC39_primer