Experiments


Methods


Assembly


1. Amplification of parts by Q5 PCR

Each gene fragment of interest was amplified using a PCR standard protocol. The components were added according to the following table (Tab. 1) as suggested from New England Biolabs (NEB, United States) user manual for Q5® High-Fidelity DNA Polymerase.

Table 1: PCR preparation using Q5® High-Fidelity DNA Polymerase from NEB.
Component Stock concentration 50 µL reaction mix Final concentration
5x Q5® Buffer (New England Biolabs) 5x 10 µL 1x
mqH2O (MilliQ water) - 32.5 µL -
Forward primer 10 µM
(10 pmol/µL)
2.5 µL 0.5 µM
Reverse primer 10 µM
(10 pmol/µL)
2.5 µL 0.5 µM
dNTPs (New England BioLabs) 10 µM (each) 1 µL 200 µM
Template DNA - 1 µL -
Q5® High-Fidelity DNA Polymerase (New England BioLabs) 2 U/µL 0.5 µL 0.02 U/µL

The general thermocycling conditions for the PCR are shown in the table (Tab. 2) below.

Table 2: Standard PCR cycling conditions for Q5 PCR (35 cycles from step 2-4).
Step Temperature Duration
Initial denaturation 98 °C 30 s
Denaturation 98 °C 10 s
Annealing adjusted 20 s
Elongation 72 °C 30 s/kb
Final extension 72 °C 2 min
Hold 15 °C ∞

The used oligonucleotides as well as the construct specific PCR parameters are listed in the following table (Tab. 3). To determine the annealing temperatures, the NEB Tm Calculator was employed.

Table 3: Primer pairs with annealing temperatures and expected fragment sizes.
DNA fragment Template Primer pair Primer 5’ - 3’ Anneal Size [bp]
Cellulases and PETase pSB1C3-gene oJS_BBprefix_fwd GATCGAATTCGCGGCCGCTTCTAGAG 72 °C 1410 (BhBglA), 1413 (PpBglB, AtBglA)
oJS_BBsuffix_rev GATCCTGCAGCGGCCGCTACTAGTA 1566 (BsEglS), 1767 (AtCelG), 2046 (BpEglA), 1500 (AtCelA)
2284 (AtCelS), 2041 (AtCelO)
925 (BhrPET),
B0014 - Terminator pBS1C-PcotYZ-sfGFP-cotY oJS_BBpre-B0014_fwd gatcgaattcgcggccgcttctagagTCACACTGGCTCACCTTC 65 °C 146
oJS_BBsuf-B0014_rev gatcctgcagcggccgctactagtaAAATAATAAAAAAGCCGGATTAATAATCTGGC
spec cassette pDG1726 spec-fwd CAGCGAACCATTTGAGGTGATAGGGACTGGCTCGCTAATAACGTAACGTGACTGGCAAGAG 72 °C 1152
spec-rev CGATACAAATTCCTCGTAGGCGCTCGGCGTAGCGAGGGCAAGGGTTTATTGTTTTCTAAAATCTG
tet casette pDG1513 Tc tet fwd1 CAGCGAACCATTTGAGGTGATAGGTCTTGCAATGGTGCAGGTTGTTCTC 68 °C 2044
Tc rev CGATACAAATTCCTCGTAGGCGCTCGGGAACTCTCTCCCAAAGTTGATCCC
eglS up genomic DNA B. subtilis W168 oJS_eglS_up-fwd GTTATCGCTACAATTGTTAAAAATGC 60 °C 1078
oJS_eglS_up-rev CCTATCACCTCAAATGGTTCGCTGGTCAATAACGTAATCAATAAACACG
eglS down oJS_eglS_down-fwd CGAGCGCCTACGAGGAATTTGTATCGGGAAAACTGATTTGGGGAACAG 62 °C 1084
oJS_eglS_down-rev GGATGTTTCACAGCATATTCAC
bglH up oJS_bglH_up-fwd CTTGTGGCAATGATTTTGCTG 1073
oJS_bglH_up-rev CCTATCACCTCAAATGGTTCGCTGCCCATAAAAATCCTTCTGGAAATCG 64 °C
bglH down oJS_bglH_down-fwd CGAGCGCCTACGAGGAATTTGTATCGCAACTGGTATCAGCAGGTTATC 1077
oJS_bglH_down-rev GTAACGGACGTTTCTTCAAAAGAC
PcotYZ genomic DNA B. subtilis W168 oJS_(BBpre)-PcotYZ_fwd CTAGAAGCTTATCGAATTCGCGGCCGCTTCTAGAGACAGCAACAAATACACTCGTAGC 61 °C 238
oJS_PcotYZ-(RBS-Spac)_rev CATTTTTTTTCCTCCTTATTATAGGGTATTTGACTTTAGTCCTTA
L1/L3-cotY oEO-CC-cotY-N-fwd ATGAGCTGCGGAAAAAC 514
oJS_cotY-(Spac-Term)_rev GGTGAGCCAGTGTGACAGCTTATGATTATCCATTGTGATGATGCTTTTTATC
L2-cotY oJS_(GGGGS4)-cotY_fwd ggaggcggtggaagtggtggcggaggtagcATGAGCTGCGGAAAAACC 62 °C 544
oJS_cotY-(Spac-Term)_rev GGTGAGCCAGTGTGACAGCTTATGATTATCCATTGTGATGATGCTTTTTATC
B0014 - Terminator pBS1C-PcotYZ-sfGFP-cotY oJS_(Spac)-Term_fwd TCATAAGCTGTCACACTGGCTCACCTTCG 63 °C 140
oJS_Term-(BBsuf)_rev CCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTAAAATAATAAAAAAGCCGGATTAATAATCTGG
BhBglA-GA pSB1C3-BhBglA oJS_(PcotYZ-RBS-Spac)-BhBglA_fwd CCTATAATAAGGAGGAAAAAAAaTGTCGATCA 1394
oJS_BhBglA-GA_rev GGCCATGGGTTTTTCCGCAGCTCATtgcgccAAGTTCAAAGAACTGATTGGCAATC
BhBglA-GGGGS4 oJS_(PcotYZ-RBS-Spac)-BhBglA_fwd CCTATAATAAGGAGGAAAAAAAaTGTCGATCA 1418
oJS_BhBglA-GGGGS4_rev ctccgccaccacttccaccgcctccagaacctcctccaccagaacctcctccaccAAGTTCAAAGAACTGATTGGCAATC
BhBglA-EAAAK oJS_(PcotYZ-RBS-Spac)-BhBglA_fwd CCTATAATAAGGAGGAAAAAAAaTGTCGATCA 1421
oJS_BhBglA-EAAAK_rev GGCCATGGGTTTTTCCGCAGCTCATtcctcctcctttcgccgccgcttctcctcctccAAGTTCAAAGAACTGATTGGCAATC
PpBglB-GA pSB1C3-PpBglB oJS_(PcotYZ-RBS-Spac)-PpBglB_fwd CCTATAATAAGGAGGAAAAAAAATGAGCGAG 64 °C 1397
oJS_PpBglB-GA_rev GGCCATGGGTTTTTCCGCAGCTCATtgcgccAAACCCGTTCTTCGCCATCA
PpBglB-GGGGS4 oJS_(PcotYZ-RBS-Spac)-PpBglB_fwd CCTATAATAAGGAGGAAAAAAAATGAGCGAG 1421
oJS_PpBglB-GGGGS4_rev ctccgccaccacttccaccgcctccagaacctcctccaccagaacctcctccaccAAACCCGTTCTTCGCCATCA
PpBglB-EAAAK oJS_(PcotYZ-RBS-Spac)-PpBglB_fwd CCTATAATAAGGAGGAAAAAAAATGAGCGAG 1424
oJS_PpBglB-EAAAK_rev GGCCATGGGTTTTTCCGCAGCTCATtcctcctcctttcgccgccgcttctcctcctccAAACCCGTTCTTCGCCATCA
BhrPET-GA pSB1C3-BhrPETase oJS_(PcotYZ-RBS-Spac)-BhrPETase_fwd CCTATAATAAGGAGGAAAAAAAATGCAATCAAATCCGTATCAAAGAGGAC 833
oJS_BhrPETase-GA_rev GGCCATGGGTTTTTCCGCAGCTCATtgcgccTTGGCAATGTCTATTATTTGAGCGA
BhrPET-GGGGS4 oJS_(PcotYZ-RBS-Spac)-BhrPETase_fwd CCTATAATAAGGAGGAAAAAAAATGCAATCAAATCCGTATCAAAGAGGAC 857
oJS_BhrPETase-GGGGS4_rev ctccgccaccacttccaccgcctccagaacctcctccaccagaacctcctccaccTTGGCAATGTCTATTATTTGAGCGA
BhrPET-EAAAK oJS_(PcotYZ-RBS-Spac)-BhrPETase_fwd CCTATAATAAGGAGGAAAAAAAATGCAATCAAATCCGTATCAAAGAGGAC 860
oJS_BhrPETase-EAAAK_rev GGCCATGGGTTTTTCCGCAGCTCATtcctcctcctttcgccgccgcttctcctcctccTTGGCAATGTCTATTATTTGAGCGA
BsEglS-GA pSB1C3-BsEglS oJS_(PcotYZ-RBS-Spac)-BsEglS_fwd CCTATAATAAGGAGGAAAAAAAATGGCAGGGACAAAAACGCCAGTAG 66 °C 1466
oJS_BsEglS-GA_rev GGCCATGGGTTTTTCCGCAGCTCATtgcgccATTTGGTTCTGTTCCCCAAATCAG
BsEglS-GGGGS4 oJS_(PcotYZ-RBS-Spac)-BsEglS_fwd CCTATAATAAGGAGGAAAAAAAATGGCAGGGACAAAAACGCCAGTAG 1490
oJS_BsEglS-GGGGS4_rev ctccgccaccacttccaccgcctccagaacctcctccaccagaacctcctccaccATTTGGTTCTGTTCCCCAAATCAG
BsEglS-EAAAK oJS_(PcotYZ-RBS-Spac)-BsEglS_fwd CCTATAATAAGGAGGAAAAAAAATGGCAGGGACAAAAACGCCAGTAG 1493
oJS_BsEglS-EAAAK_rev GGCCATGGGTTTTTCCGCAGCTCATtcctcctcctttcgccgccgcttctcctcctccATTTGGTTCTGTTCCCCAAATCAG
AtCelO-GA pSB1C3-AtCelO oJS_(PcotYZ-RBS-Spac)-AtCelO_fwd CCTATAATAAGGAGGAAAAAAAATGGATGACACTTCTGAAGAACC 61 °C 1940
oJS_AtCelO-GA_rev GGCCATGGGTTTTTCCGCAGCTCATtgcgccTTCATTTTGGTTTTCTTCCACC
AtCelO-GGGGS4 oJS_(PcotYZ-RBS-Spac)-AtCelO_fwd CCTATAATAAGGAGGAAAAAAAATGGATGACACTTCTGAAGAACC 1964
oJS_AtCelO-GGGGS4_rev ctccgccaccacttccaccgcctccagaacctcctccaccagaacctcctccaccTTCATTTTGGTTTTCTTCCACC
AtCelO-EAAAK oJS_(PcotYZ-RBS-Spac)-AtCelO_fwd CCTATAATAAGGAGGAAAAAAAATGGATGACACTTCTGAAGAACC 1967
oJS_AtCelO-EAAAK_rev GGCCATGGGTTTTTCCGCAGCTCATtcctcctcctttcgccgccgcttctcctcctccTTCATTTTGGTTTTCTTCCACC
AtCelS-GA pSB1C3-AtCelS oJS_(PcotYZ-RBS-Spac)-AtCelS_fwd CCTATAATAAGGAGGAAAAAAAATGGGTCCTACAAAGGCACCTAC 62 °C 2198
oJS_AtCelS-GA_rev GGCCATGGGTTTTTCCGCAGCTCATtgcgccGTTCTTGTACGGCAATGTATC
AtCelS-GGGGS4 oJS_(PcotYZ-RBS-Spac)-AtCelS_fwd CCTATAATAAGGAGGAAAAAAAATGGGTCCTACAAAGGCACCTAC 2222
oJS_AtCelS-GGGGS4_rev ctccgccaccacttccaccgcctccagaacctcctccaccagaacctcctccaccGTTCTTGTACGGCAATGTATC
AtCelS-EAAAK oJS_(PcotYZ-RBS-Spac)-AtCelS_fwd CCTATAATAAGGAGGAAAAAAAATGGGTCCTACAAAGGCACCTAC 2225
oJS_AtCelS-EAAAK_rev GGCCATGGGTTTTTCCGCAGCTCATtcctcctcctttcgccgccgcttctcctcctccGTTCTTGTACGGCAATGTATC

After completion of the PCR reaction, either 5 µl of PCR product were analyzed in a 1 % agarose gel and the rest (45 µl) was purified using the HiYield® PCR Clean-up/Gel Extraction Kit (SLG, Germany) or the whole PCR product was given onto the gel and extracted afterwards according to the manufacturer's protocol. The DNA concentration was measured using the NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., United States) at a wavelength of 260 nm.


2. Backbone Phusion PCR

To amplify a target backbone, PCR was performed using Phusion DNA Polymerase (NEB, United States). The required reaction mixture was prepared and each 50 μl were added to a single PCR tube. The components were added according to the following table (Tab. 4) as suggested from NEBs user manual for Phusion® High-Fidelity DNA Polymerase.

Table 4: PCR preparation using Phusion DNA Polymerase from NEB.
Components Stock concentration 50 µl reaction Final concentration
5X Phusion GC Buffer (NEB) 5x 10 µl 1x
mqH2O - 31 µl -
Forward Primer 10 µM (10 pmol/µl) 2.5 µl 0.5 µM
Reverse Primer 10 µM (10 pmol/µl) 2.5 µl 0.5 µM
dNTPs (NEB) 10 mM of each 1 µl 200 µM each
DMSO - 1.5 µl 3 %
Template DNA 100 ng 1 µl 100 ng
Phusion DNA Polymerase (NEB) 2 U/µl 0.5 µl 0.02 U/µl

The PCR reactions were carried out in the thermocycler according to the program shown in Table 5:

Table 5: Standard PCR cycling conditions for Phusion PCR (35 cycles from step 2-4).
Step Temperature Duration
Initial denaturation 95 °C 3 min
Denaturation 95 °C 20 s
Annealing adjusted 30 s
Elongation 72 °C 30 s/kb
Finale extension 72 °C 10 min
Hold 10 °C ∞

The used oligonucleotides as well as the construct specific PCR parameters are listed in the following table (Tab. 6). To determine the annealing temperatures, the NEB Tm Calculator was employed.

Table 6: Primer pairs with annealing temperatures and expected fragment sizes.
Plasmid Primer pair Primer 5’ - 3’ Anneal Size [bp]
pSB1C3, pSB1C30 SB-prep-3P-1 GCCGCTGCAGTCCGGCAAAAAA 62 °C 2043, 2043
SB-prep-2Ea ATGAATTCCAGAAATCATCCTTAGCG
pBS0E-xylR-PxylA, pBS2E-xylR-PxylA RFP-cassette back fwd TTCGGGTGGGCCTTTCTG 61 °C 8398, 8042
XylRPxyl check rev CTCCTCTTTCTCTAGTATGTGTG

After the PCR 5 µL of PCR product were analysed in an 1 % agarose gel. To get rid of the template plasmid the remaining 45 µL PCR product were digested using 1 µl of DpnI enzyme (digests methylated DNA). The digest was incubated for 1 hour at 37 °C and after this heat inactivated at 80 °C for 10 minutes. The product was again analysed in an 1 % agarose gel and then extracted from the gel using the HiYield® PCR Clean-up/Gel Extraction Kit (SLG). The DNA concentration was measured using the NanoDrop® ND-1000 spectrophotometer (ThermoFisher, United States) at a wavelength of 260 nm.


3. Overlap (Joining) PCR

(protocol generously provided by the lab of Prof. Thorsten Mascher, Faculty of Biology, General Microbiology, TU Dresden)

For gene knockout using a resistance cassette
Figure 1: Scheme for the design of an overlap PCR for gene knockout using a resistance cassette.

The first step in performing the overlap PCR is the selection of the wanted resistance cassette and the design of the required primers (Fig. 1). The up-forward primer (20 - 25 nt) was designed by selecting a sequence about 1 kb upstream of the gene or region to be knocked out. The up-reverse primer was designed by selecting a sequence within 10 - 50 bp downstream of the start of the gene to be knocked out. At the 5' end of this oligo the corresponding sequence to one end of the cassette was added (Tab. 7). The 5' and 3' overhangs are the same for each cassette. Hence, more than one cassette can be used with one set of up reverse and down forward primers. The down-forward primer was designed by selecting a sequence within 10 - 50 bp upstream of the end of the gene to be knocked out. The sequence corresponding to the other end of the cassette was added to the 5' end of this oligo. The down-reverse primer (20 - 25 nt) was designed by selecting a sequence about 1 kb downstream of the gene to be knocked out.

Table 7: 5’ end of joining primers
5’ end of joining primer
Up-rev CCTATCACCTCAAATGGTTCGCTG
Do-fwd CGAGCGCCTACGAGGAATTTGTATCG

The selected cassette as well as the upstream and downstream fragments of the gene to be knocked out were performed using the Q5 PCR protocol ( see Experiments Q5 PCR ). The cassette was amplified using the appropriate vector and the upstream and downstream fragments were amplified using B. subtilis W168 genomic DNA as template. The PCR products were purified using the HiYield® PCR Clean-Up & Gel Extraction Kit (SLG, Germany) and the DNA concentration was measured using the NanoDrop® ND-1000 spectrophotometer (ThermoFisher Scientific Inc., United States) at a wavelength of 260 nm. The last step was the joining of the amplified fragments with the cassette by PCR (Tab. 8).

Table 8: Primer pairs with annealing temperatures and expected fragment sizes.
DNA-fragment Primer pair Primer sequence 5’ - 3’ Anneal Size [bp]
eglS up + cassette + eglS down oJS_eglS_up-fwd GTTATCGCTACAATTGTTAAAAATGC 62 °C 3264 (spec)
oJS_eglS_down-rev GGATGTTTCACAGCATATTCAC 4156 (tet)
bglH up + cassette + bglH down oJS_bglH_up-fwd CTTGTGGCAATGATTTTGCTG 64 °C 3252 (spec)
oJS_bglH_down-rev GTAACGGACGTTTCTTCAAAAGAC 4144 (tet)

The PCR components were added according to the following table (Tab. 9, modified NEB user manual for Q5® High-Fidelity DNA Polymerase). Different ratios (1:2, 1:3) and concentrations (150 ng:300 ng, 10 ng:30 ng, 100 ng: 300 ng) of up/down fragment to cassette were tested.

Table 9: PCR preparation using Q5® High-Fidelity DNA Polymerase from NEB.
Components Stock concentration 50 µl reaction Final concentration
5X Q5® Reaction Buffer (NEB) 5x 10 µl 1x
mqH2O - 30.5 µl -
Forward Primer 10 µM (10 pmol/µl) 2.5 µl 0.5 µM
Reverse Primer 10 µM (10 pmol/µl) 2.5 µl 0.5 µM
dNTPs (NEB) 10 mM of each 1 µl 200 µM each
DNA fragment up variable 1 µl variable
DNA fragment down variable 1 µl variable
Cassette variable 1 µl variable
Q5® High-Fidelity DNA Polymerase
(NEB)
2 U/µl 0.5 µl 0.02 U/µl

The same thermocycler program was used as for the Q5 PCR protocol ( see Experiments Q5 PCR ).

After completion of the PCR reaction, 5 μl of PCR product were analyzed in a 1 % agarose gel. The PCR product was used unpurified or the rest (45 μl) was purified using the HiYield® PCR Clean-up/Gel Extraction Kit (SLG, Germany) according to the manufacturer's protocol. The DNA concentration was measured using the NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., USA) at a wavelength of 260 nm.

b) For spore display

The design of the overlap PCR for spore display follows the same principle as the knockout using a resistance cassette. It serves to join the four different parts needed for the spore display using B. subtilis. These are the promoter for cotYZ, our target gene, the cotY gene, which encodes a spore coat protein, and the terminator. In this order, the parts were added in a 1:3:3:1 ratio for overlap PCR using Q5 DNA polymerase ( Tab. 11). The ratio was adjusted when the amplification was not efficient.

The used oligonucleotides as well as the construct specific PCR parameters are listed in the following table (Tab. 10). To determine the annealing temperatures, the NEB Tm Calculator was used.

Table 10: Primer pairs with annealing temperatures and expected fragment sizes.
DNA-fragment Primer pair Primer sequence 5’ - 3’ Anneal Size [bp]
PcotYZ-gene-L3-cotY-Term oJS_(BBpre)-PcotYZ_fwd CTAGAAGCTTATCGAATTCGCGGCCGCTTCTAGAGACAGCAACAAATACACTCGTAGC 63 °C 2283 (BsEglS), 2757 (AtCelO), 3015 (AtCelS), 2211 (BhBglA), 2214 (PpBglB), 1650 (BhrPET)
oJS_Term-(BBsuf)_rev CCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTAAAATAATAAAAAAGCCGGATTAATAATCTGG
PcotYZ-gene-L3-cotY-Term oJS_(BBpre)-PcotYZ_fwd CTAGAAGCTTATCGAATTCGCGGCCGCTTCTAGAGACAGCAACAAATACACTCGTAGC 2337 (BsEglS), 2811 (AtCelO), 3069 (AtCelS), 2265 (BhBglA), 2268 (PpBglB), 1704 (BhrPET)
oJS_Term-(BBsuf)_rev CCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTAAAATAATAAAAAAGCCGGATTAATAATCTGG
PcotYZ-gene-L3-cotY-Term oJS_(BBpre)-PcotYZ_fwd CTAGAAGCTTATCGAATTCGCGGCCGCTTCTAGAGACAGCAACAAATACACTCGTAGC 2310 (BsEglS), 2784 (AtCelO), 3042 (AtCelS), 2238 (BhBglA), 2241 (PpBglB), 1677 (BhrPET)
oJS_Term-(BBsuf)_rev CCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTAAAATAATAAAAAAGCCGGATTAATAATCTGG

The PCR components were added according to the following table (Tab. 11), modified NEB user manual for Q5® High-Fidelity DNA Polymerase.

Table 11: PCR preparation using Q5® High-Fidelity DNA Polymerase from NEB.
Components Stock concentration 50 µl
reaction
Final concentration 50 µl reaction with GC Enhancer
5X Q5® Reaction
Buffer (NEB)
5x 10 µl 1x 10 µl
5X Q5® GC
Enhancer
- - - 5 µl
mqH2O - 30.5 µl - 24.5 µl
Forward Primer 10 µM (10 pmol/µl) 2.5 µl 0.5 µM 2.5 µl
Reverse Primer 10 µM (10 pmol/µl) 2.5 µl 0.5 µM 2.5 µl
dNTPs (NEB) 10 mM of each 1 µl 200 µM each 1 µl
Template PcotYZ 10 ng/µl 1 µl 0.2 ng/µl 1 µl
Template target gene 30 ng/µl 1 µl 0.6 ng/µl 1 µl
Template cotY 30 ng/µl 1 µl 0.6 ng/µl 1 µl
Template terminator 10 ng/µl 1 µl 0.2 ng/µl 1 µl
Q5® High-Fidelity
DNA Polymerase
(NEB)
2 U/µl 0.5 µl 0.02 U/µl 0.5 µl

The same thermocycler program was used as for the Q5 PCR protocol ( see Experiments Q5 PCR ).

After PCR, the product was loaded onto a 1 % agarose gel and then extracted from the gel using the HiYield® PCR Clean-up/Gel Extraction Kit (SLG, Germany). The DNA concentration was measured using the NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., United States) at a wavelength of 260 nm.


4. Agarose gel-electrophoresis

Each sample was loaded on to an 1 % agarose gel, containing 2 drops/50 ml agarose ethidium bromide solution (0.025 %) from Carl Roth. 1 kb Plus DNA Ladder from NEB was used as a ladder. The electrophoresis ran at 120 V. The gel was then viewed in the UV transilluminator (Fusion FX7 Edge, Vilber, Germany) under excitation with a wavelength of 260 nm (absorption maximum ethidium bromide). For gel extraction the desired fragments were cut out of the gel under UV light. The purification of PCR products and gel extraction were carried out using the HiYield® PCR Clean-Up & Gel Extraction Kit (SLG, Germany) and were performed according to the manufacturer's protocol. The DNA concentrations of the samples were measured using the NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., United States) at a wavelength of 260 nm.


5. Restriction

For the cloning of the insert with the respective vector, a restriction digestion of both the vector and the insert was carried out. For this purpose, 1 μg of vector and 0.5-1 μg of insert were digested with the respective restriction enzymes (Tab. 13). For the integration of a plasmid into the genome of B. subtilis, 1 - 2 μg plasmid were linearized by using only one restriction enzyme (Tab. 12 and 13). The restriction with two enzymes was pipetted together as follows:

Table 12: Standard restriction protocol from NEB.
Components 20 µl
reaction
50 µl
reaction
Final concentration
DNA variable variable 1 µg
10x rCutSmart
buffer (NEB)
2 µl 5 µl 1 x
Restriction enzyme I 1 µl 1 µl variable
Restriction enzyme II 1 µl 1 µl variable
mqH2O Add to 20 µl Add to 50 µl -

After mixing, the reaction mixtures were incubated at 37 °C for 1 hour. The insert and vector were then purified using the HiYield® PCR Clean-up/Gel Extraction Kit (SLG, Germany). To purify the vector from its insert, three 50 µl reaction tubes were used for gel extraction. The DNA concentrations were then measured using the NanoDrop® ND-1000 spectrophotometer (ThermoFisher, USA).

The enzymes used for restriction were all supplied by NEB.
* For the integration of the plasmid into the genome of B. subtilis it was linearized by using only one restriction enzyme.
Table 13: Restriction enzymes used in this work.
Vector/ Insert Enzyme I Enzyme II
pBS1C, pSB1C3, pBS0E-xylR-PxylA, pBS2E-xylR-PxylA EcoRI-HF PstI-HF
BhBglA, PpBglB, AtBglA, BsBglS, BpBglA, AtCelA, AtCelG, AtCelO, AtCelS, BhrPET EcoRI-HF PstI-HF
PcotYZ-enzyme-linker-cotY-Term EcoRI-HF PstI-HF
pBS0E-xylR-PxylA-enzyme SpeI-HF PstI-HF
B0014 Terminator XbaI PstI-HF
pBS2E-xylR-PxylA-enzyme* BsaI-HF -
pBS2E-xylR-PxylA-enzyme* SapI -
pBS1C-PcotYZ-enzyme-linker-cotY-Term* BsaI-HF -

6. Ligation

Ligation took place after restriction of the vector and the insert. The components were added according to the following table (Tab. 14) as suggested from NEBs user manual for T4 DNA Ligase. For this purpose, 50 ng of vector were used with 3, 5 or 7 times the molar excess of the insert. The molar ratio was determined using the NEBioCalculator® for Ligation (NEB). The preparations were incubated either 20 minutes at 4 °C followed by 2 hours at 16 °C or for 2 hours at room temperature.

Table 14: Standard ligation protocol from NEB.
Component 20 µl reaction
T4 DNA Ligase Buffer (10X) (NEB) 2 µl
Vector DNA 50 ng (0.020 pmol)
Insert DNA variable
mqH2O add to 20 µl
T4 DNA Ligase (NEB) 1 µl

7. Preparation of chemical competent E. coli DH10β

(Mülhardt, C. (2009). Der Experimentator: Molekularbiologie/ Genomics (6. Aufl). Spektrum Akademischer Verlag.)

The preparation of chemical competent E. coli DH10β was carried out by the technical assistants.

For the preparation of chemical competent E. coli DH10β, 500 µl of an overnight culture in 5 mL LB broth (37 °C, 180 rpm) was used to inoculate 50 mL LB medium for a day culture. The day culture was incubated at 37 °C, 180 rpm to an OD600 of 0.4 - 0.7. All following steps were performed on ice. After incubation the cells were put on ice for 10 minutes with careful inversion in between. They were then centrifuged at 6000 x g, 4 °C for 5 minutes. The supernatant was removed, and the cell pellet was resuspended in 20 mL TFB1. The cells were then incubated for 15 minutes on ice with careful inversion in between and again centrifuged at 6000 x g, 4 °C for 5 minutes. The supernatant was removed, and the cell pellet was resuspended in 2 mL TFB2 and incubated on ice for 10 minutes. Each 50 µl competent cells were aliquoted into 1.5 mL tubes and frozen by using liquid nitrogen. Aliquots were stored at - 80 °C in the freezer. The composition of the transformation buffers can be found in Table 15.

Table 15: Composition of TFB1 and TFB2.
Media Components Concentration
TFB1 CaCl2 10 mM
Glycerol 15 % (v/v)
Potassium acetate 30 mM (pH 5.8)
RbCl2 100 mM
MnCl2 50 mM
TFB 2 MOPS 10 mM (pH 7.0)
RbCl2 10 mM
CaCl2 75 mM
Glycerol 15 %

8. Transformation of E. coli DH10β

(Protocol generously provided by the lab of Prof. Thorsten Mascher, Faculty of Biology, General Microbiology, TU Dresden)

Initially, the chemical competent cells stored at - 80 °C were thawed on ice for 5 - 10 minutes and 4 - 20 μl of ligation mixture or 1 µg of plasmid were added to 50 μl of competent cells. Cells were further incubated on ice for 20 - 30 minutes, followed by heat shock at 42 °C for 90 seconds. Immediately after the heat shock, the cells were incubated on ice for 2 minutes. For cell recovery, 400 μl of LB medium was added and the samples were incubated at 37 °C for 1 - 2 hours with agitation (550 - 850 rpm) in a thermomixer. After incubation, the cells were centrifuged (1 minutes, 16,000 x g), around 200 μl of the supernatant was discard and the cells were resuspended in the remaining medium. 100 μl of the cells were plated on LB agar (100 μg/ml ampicillin) and incubated overnight at 37 °C.


9. Transformation of B. subtilis

(Protocol generously provided by the lab of Prof. Thorsten Mascher, Faculty of Biology, General Microbiology, TU Dresden)

For the transformation, 10.43 ml of MNGE medium in a flask were first inoculated with 300 µl fresh overnight culture of B. subtilis and then incubated at 37 °C, 180 rpm to an OD600 of 1.1 - 1.3. Then 400 μl of the cell suspension was mixed in a glass tube with (linearized) 1 - 2 μg plasmid or 45 μl PCR product and incubated for one hour at 37 °C, 180 rpm. 400 μl of the cell suspension, to which no DNA was added, served as a negative control. Subsequently, 100 μl of expression mix was added to the cells and incubated for a further hour at 37 °C, 180 rpm. After incubation the cells were plated on LB selection plates. 100 μl of the negative control were also plated onto an LB selection plate. The plates were incubated overnight at 37 °C or for 2 - 3 days at room temperature. The strains and the introduced constructs can be found on the results page (see Results).

The composition of the media used for Bacillus transformation can be found in Tab. 16.

Table 16: Composition of media for Bacillus transformation.
Medium Components Volume Stock concentration
10 X MN-Medium K2HPO4 (x 3 H2O) 136 g/L -
K2HPO4 60 g/L -
Na-citrat (x 2 H2O) 10 g/L -
MNGE-Medium 1 X MN-Medium 9.2 ml 10 X
Glucose 1 ml 20 %
K-Glutamate 50 µl 40 %
Fe[III]- ammonium-citrate 50 µl 2.2 mg/mL
Tryptophan 100 µl 5 mg/mL
MgSO4 30 µl 1 M
Expression Mix Yeast extract 500 µl 5 %
Casamino-acids 250 µl 10 %
H2O 250µl -
Tryptophan 50 µl 5 mg/mL

10. Colony PCR

Colony PCRs were carried out to test potential transformants of B. subtilis or E. coli on selection plates. Amplification was carried out using OneTaq® polymerase. The required reaction mixture was prepared and each 12 μl were added to a single PCR tube. A few cells were used as templates, which were taken directly from a colony using a sterile toothpick and mixed into the reaction mixture of the respective PCR tube. The master mix contained according to Table 17:

Table 17: PCR preparation using OneTaq® DNA Polymerase from NEB.
Components Stock concentration 50 µl
reaction
Final concentration
5X OneTaq®
Standard Reaction
Buffer (NEB)
5x 10 µl 1x
mqH2O - 36.75 µl -
Forward Primer 10 µM
(10 pmol/µl)
1 µl 0.2 µM
Reverse Primer 10 µM
(10 pmol/µl)
1 µl 0.2 µM
dNTPs 10 mM of each 1 µl 200 µM each
Template DNA - variable -
OneTaq® DNA
Polymerase (NEB)
5 U/µl 0.25 µl 0.025 U/µl

The PCR reactions were carried out in the thermocycler according to the program shown in Tab. 18:

Table 18: Standard PCR cycling conditions for Colony PCR (30 cycles from step 2-4).
Step Temperature Duration
Initial denaturation 94 °C 3 min
Denaturation 94 °C 20 s
Annealing adjusted 30 s
Elongation 68 °C 1 min/kb
Finale extension 68 °C 5 min
Hold 15 °C ∞

The used oligonucleotides as well as the construct specific PCR parameters are listed in the following table (Tab. 19). To determine the annealing temperatures, the NEB Tm Calculator was employed .

Table 19: Primer pairs with annealing temperatures and expected fragment sizes.
Construct Primer pair Primer 5’ - 3’ Anneal Size [bp]
E. coli DH10β
pSB1C3-enzyme seqcheck fwd TGCCACCTGACGTCTAAG 47 °C 1676 (AtBglA, PpBglB), 1673 (BhBglA)
seqcheck rev ATTACCGCCTTTGAGTGA 1829 (BsEglS), 2030 (AtCelG), 2309 (BpEglA), 1763 (AtCelA)
2555 (AtCelS), 2312 (AtCelO)
1196 (BhrPET)
pBS0E-xylR-PxylA-enzyme oXL_54 TGAAAATACTGACGAGGTT 44 °C 1564 (AtBglA, PpBglB), 1561 (BhBglA)
1717 (BsEglS), 1918 (AtCelG), 2197 (BpEglA), 1651 (AtCelA)
pProEX-1-check-fwd GGATAACAATTTCACACAGG 2443 (AtCelS), 2200 (AtCelO)
1084 (BhrPET)
pBS2E-xylR-PxylA-enzyme oXL_54 TGAAAATACTGACGAGGTT 44 °C 1765 (AtBglA, PpBglB), 1762 (BhBglA)
1918 (BsEglS), 2119 (AtCelG), 2398 (BpEglA), 1852 (AtCelA)
pAX01-sacI.selfligated-fw ctgaaattgatcctccaaac 2644 (AtCelS), 2401 (AtCelO)
1285 (BhrPET)
pBS0E-xylR-PxylA-enzyme-Term oXL_54 TGAAAATACTGACGAGGTT 44 °C 1667 (AtBglA, PpBglB), 1664 (BhBglA)
1820 (BsEglS), 2021 (AtCelG), 2300 (BpEglA), 1754 (AtCelA)
pProEX-1-check-fwd GGATAACAATTTCACACAGG 2546 (AtCelS), 2303 (AtCelO)
1187 (BhrPET)
pBS1C-PcotYZ-enzyme-L1-cotY-Term oEO-OV(3frag)-fwd CACAAATTAAAAACTGGTCTGATCG 48 °C 2275 (PpBglB), 2272 (BhBglA)
2344 (BsEglS)
1711 (BhrPET)
pBS1C-PcotYZ-enzyme-L2-cotY-Term 2329 (PpBglB), 2326 (BhBglA)
2398 (BsEglS)
1C_rev_P TAAGCTGTCAAACATGAGAATTGAC 2872 (AtCelO)
1765 (BhrPET)
pBS1C-PcotYZ-enzyme-L3-cotY-Term 2302 (PpBglB), 2299 (BhBglA)
2371 (BsEglS)
1738 (BhrPET)
B. subtilis WB800N
bglH::spec oJS_bglH_up-fwd CTTGTGGCAATGATTTTGCTG 48 °C 1341
spec-check rev CGTATGTATTCAAATATATCCTCCTCAC
spec-checkfwd GTTATCTTGGAGAGAATATTGAATGGAC 49 °C 1289
oJS_bglH_down-rev GTAACGGACGTTTCTTCAAAAGAC
eglS::tet oJS_eglS_up-fwd GTTATCGCTACAATTGTTAAAAATGC 47 °C 1517
(tet) tc-check rev CATCGGTCATAAAATCCGTAATGC
bglH::tet oJS_bglH_up-fwd CTTGTGGCAATGATTTTGCTG 49 °C 1519
(tet) tc-check rev CATCGGTCATAAAATCCGTAATGC
pBS0E-xylR-PxylA-enzyme oJS_BBprefix_fwd GATCGAATTCGCGGCCGCTTCTAGAG 57 °C 1413 (AtBglA, PpBglB), 1410(BhBglA)
1566 (BsEglS), 1767 (AtCelG), 2046 (BpEglA), 1500 (AtCelA)
oJS_BBsuffix_rev GATCCTGCAGCGGCCGCTACTAGTA 2292 (AtCelS), 2049 (AtCelO)
933 (BhrPET)
pBS0E-xylR-PxylA-enzyme pSET152 checking Fw CTGCAAGGCGATTAAGTTGGGTAAC 51 °C 3044 (AtBglA, PpBglB), 3041 (BhBglA)
3197 (BsEglS), 3398 (AtCelG), 3677 (BpEglA), 3131 (AtCelA)
oXL_2 TATGACCATGATTACGCCAAGC 3923 (AtCelS), 3680 (AtCelO)
2564 (BhrPET)
pBS2E-xylR-PxylA-enzyme oJS_BBprefix_fwd GATCGAATTCGCGGCCGCTTCTAGAG 51 °C 1951 (AtBglA, PpBglB), 1948 (BhBglA)
2104 (BsEglS), 2305 (AtCelG), 2584 (BpEglA), 2038 (AtCelA)
lacA-back-rev AAGAATCCGCCCATATCGAG 2830 (AtCelS), 2587 (AtCelO)
1471 (BhrPET)
pBS2E-xylR-PxylA-enzyme lacA-front-fwd GAACGAAGGGCTAAGAGAAC 44 °C 1370 (all enzymes)
oXL_109 CTGAATACTCGTGTCACT
pBS2E-xylR-PxylA-BhrPET pBS2E int. up fwd TGCTGCAAAAGAATTTTGTGTCCG 49 °C 5301
pBS2E int. up rev CTTTGCTTTTCATGATTTCATCCC

11. Plasmid isolation

Overnight-cultures of 5 mL LB medium and respective antibiotics were inoculated each with single E. coli colonies grown on selective plates. The HiYield® Plasmid Mini DNA Kit (SLG, Germany) was used for the isolation of plasmid DNA. The procedure was carried out according to the manufacturer's protocol. DNA was eluted with 50 µl MilliQ water and a second elution step was performed to increase yield. The DNA concentrations of the samples were measured using the NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., United States) at a wavelength of 260 nm.

After concentration determination, samples were prepared for Sanger sequencing, provided by Microsynth Seqlab GmbH (Germany).


12. Expression of secreted and intracellular proteins

To test the desired enzymes, an overnight culture was prepared by inoculating 5 ml of LB medium with 5 µl of Erythromycin (1 mg/ml) and Lincomycin (25 mg/ml). The culture was incubated overnight at 37 °C with shaking at 180 rpm. The following day, the optical density at 600 nm (OD600) was adjusted to 0.1 in 20 ml of fresh LB medium with 20 µl of Erythromycin (1 mg/ml) and Lincomycin (25 mg/ml). Additionally, for experiments with exoglucanases, the cultures were incubated at 28 °C or 42 °C with shaking at 180 rpm. The OD was monitored until it reached 0.5 – 0.6, at which point the cultures were induced with 0.5 % xylose (Carl Roth GmbH + Co. KG, Germany). After induction, the cultures were left for 24 hours in the incubator under the defined conditions.

To test secreted enzymes, like endoglucanases, exoglucanases and PETases, the cells were centrifuged at 4 °C and 14,000 rpm for 15 minutes. The supernatant (SN) was transferred into a new reaction tube. The SN was stored short term at 4 °C until further use. Aliquots of the SN were frozen with liquid nitrogen and stored overnight at - 80 °C. Samples of SN were taken for the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to determine the molecular weight of the desired proteins. To test intracellular enzymes, like β-glucosidases, the cells were centrifuged at 4 °C and 14,000 rpm for 15 minutes. The SN was discarded, and the pellet was frozen with liquid nitrogen. The next day, cell disruption buffer with pH 7.5 (50 mM Tris-HCl (Carl Roth GmbH + Co. KG, Germany), 100 mM NaCl (Carl Roth GmbH + Co. KG, Germany)) was used for the cell lysis. All subsequent steps were performed on ice. 700 µl of disruption buffer along with 7 µl of Protease Inhibitor Cocktail (100X) (New England Biolabs GmbH, United States) was added to each. The cells were disrupted by ultrasonication using the Ultrasonic processor Bandelin Sonopuls UW70/ GM70HD with sonotrode SH70 homogeniser (BANDELIN electronic GmbH & Co. KG, Germany). In sum, 8 - 10 ultrasonic treatments (100 % amplitude, 0.6 cycle, 10 seconds). Between each ultrasonic treatment cycle, the samples were placed on ice for 15 – 30 seconds. The success of the disruption was checked by observing less density and coloration in the samples. The sonication device was wiped with bacillol (Paul Hartmann AG, Germany) and water before switching between samples. The suspension was centrifuged at 4 °C and 14,000 rpm for 15 minutes. The crude extract was transferred to a new reaction tube. The crude extract was stored at 4 °C for short term use and at - 80 °C for long term storage. Before centrifugation, SDS-PAGE sample of the cell debris were taken.


13. SDS-PAGE

SDS-PAGE was conducted to determine the molecular weight of the proteins. The separation gel percentage varied based on the protein tested (e.g., 8 % for exoglucanases, 10 % for endoglucanases and β-glucosidases, 12 % for PETases). The gels were prepared following the SDS-PAGE Gel Preparation Kit manual (Abbexa Ltd, United Kingdom), with tetraacetylethylenediamine (TEMED) and 10 % ammonium persulfate (APS) added just before proceeding. This was done under the hood, being cautious as the mixture is toxic before polymerization. Approximately 3 ml of the gel mixture was poured to fill two-thirds of the gel plate, and isopropanol was added on top of the separation gel to ensure a smooth, bump-free surface. The stacking gel was prepared following the manual of the previous named kit, adding TEMED and 10 % APS only when ready to proceed. The gel was poured to fill one-third of the gel plate, and the comb was inserted. The gel was left to set. The glass plates containing the gel were wrapped with a wet towel, placed in a plastic bag, and stored in the fridge until needed. Before use, the gel was removed from storage and allowed to warm up to room temperature.

For sample preparation, 45 µl of sample was mixed with 15 µl of 4X SDS loading buffer (8 % SDS (w/v) (AppliChem GmbH, Germany), 355 mM β-Mercaptoethanol (Bio-Rad Laboratories, United States)). The mixture was heated for 10 minutes at 95 °C to ensure protein denaturation. The SDS-PAGE apparatus (Bio-Rad Laboratories, United States) was assembled, which could hold up to 4 gels, and its leakiness was checked. 20 µl of samples were loaded into the wells along with 4 µl of the molecular weight marker PageRuler™ Plus Prestained Protein Ladder, 10 bis 250 kDa (Thermo Fisher Scientific Inc., United States). The 1X SDS running buffer (diluted from 10X running buffer: Tris base/Glycine/SDS (Bio-Rad Laboratories, United States)) was added, and the gel was run at a constant 100 V for approximately 1.5 hours. The gel was placed in a plastic box and stained using Coomassie Blue solution (1.25 g Coomassie Blue G-250 (Carl Roth GmbH + Co. KG, Germany), 250 ml methanol (Carl Roth GmbH + Co. KG, Germany), 50 ml acetic acid (Carl Roth GmbH + Co. KG, Germany), 200 ml dH2O) under the hood. The staining process took only 10 - 15 minutes with constant shaking. After staining, the Coomassie Blue solution was returned to the bottle for reuse.

For rapid destaining of the gel, isopropanol (Carl Roth GmbH + Co. KG, Germany) was used with three destaining cycles of 20 minutes with constant shaking. For destaining of the gel overnight, water was poured in the box and kept on constant shaking. Once complete, a picture of the gel was taken.


14. Spore preparation

To isolate spores, an overnight culture was prepared by inoculating 5 ml of LB medium with 5 µl of chloramphenicol (5 mg/ml). The culture was incubated overnight at 37 °C with shaking at 180 rpm. The following day, the optical density at 600 nm (OD600) was adjusted to 0.05 in 5 ml of fresh LB medium with 5 µl of chloramphenicol (5 mg/ml). This culture was then incubated at 37 °C with shaking at 180 rpm until it reached the exponential growth phase, which corresponds to an OD600 between 0.4 and 0.6.

Once the culture reached the desired OD, it was centrifuged at 13,000 g for 30 seconds. The supernatant was discarded, and the cell pellet was washed with 1 ml of Difco Sporulation Medium (DSM, recipe see below). This washing step was repeated, and the cells were resuspended in 4 ml of DSM medium in a sterile glass tube. The culture was then incubated at 37 °C with shaking at 180 rpm for 24 hours. In addition to the test strains, the wildtype W168 strain was included as a negative control.

After the 24-hour incubation, the cells were harvested by centrifugation at 13,000 g for 10 minutes. The supernatant was discarded, and the cell pellet was resuspended in 1 ml of dH2O. To lyse the cells, 1.5 µl of lysozyme (75 µg/ml, Carl Roth GmbH + Co. KG, Germany) was added, and the tubes were gently inverted before being incubated at 37 °C for 1 hour.

Following cell lysis, the culture was centrifuged again using the same settings. After centrifugation, a series of washing steps were performed. First, the cells were washed with 2 ml of dH2O, followed by centrifugation. After discarding the supernatant, the cells were resuspended in 2 ml of 0.05 % SDS to remove organic residues. After another centrifugation step, the cells were washed three more times with 2 ml of dH2O. Finally, the pellet was resuspended in 1 ml of dH2O and stored in the dark at room temperature.

The OD of the spore suspension was measured using a 1:10 dilution (900 µl of dH2O and 100 µl of spore solution). The OD was then adjusted by fixing the OD to 2 for the glucose assay, DNS assay, and assays that use pNPG or pNPAc as substrate with a final OD concentration of 0.2 in the reaction. For the qualitative plate assays, the OD was fixed to 0.2 for to test endoglucanases and exoglucanases. Different OD were used to observe the enzymatic reaction of exoglucanase displaying spores on plates with PASC-Agar and PASA-Agar.


Qualitative assays for estimation of cellulase activities


1. Establishing Qualitative Tests for Cellulase Function

To evaluate the activity of β-glucosidase, LB-Agar plates containing Esculin (Carl Roth GmbH + Co. KG, Germany, recipe see in Table 24) were prepared. Wells approximately 0.5 cm in diameter were created in the agar. Into these wells, 10 μl of Accellerase 1500 enzyme mix (Genencor International, United States) was added, both in undiluted form and in dilutions of 1:10 and 1:100. The plates were incubated at 50 °C for 6 hours.

For testing endoglucanase and exoglucanase activities, LB-Agar plates with Carboxymethyl cellulose (CMC, Carl Roth GmbH + Co. KG, Germany) and Avicel (Carl Roth GmbH + Co. KG, Germany) were used, respectively. The media components are described in Table 24. Like the β-glucosidase assay, 10 μl of the undiluted Accellerase 1500 enzyme mix and its dilutions (1:10 and 1:100) were pipetted into the wells. The plates were incubated at 50 °C for varying time periods, ranging from 0 to 24 hours. After incubation, the plates were stained with a 0.1 % (w/v) congo red solution (Sigma-Aldrich®, United States) at room temperature for 15 minutes. After discarding the congo red, a 1 M NaCl solution was used for destaining for 15 minutes, which was also subsequently discarded.

Additionally, for determining exoglucanase activity, LB-Agar-Avicel plates with 0.5 % (w/v) avicel were prepared. 20 μl of Accellerase 1500 solution was added to the wells in the LB-Agar-Avicel media with avicel end concentration of 0.5 % or 1 % respectively. Then, the plates were incubated for 48 h at 37 °C and stained with congo red method as described above.

Furthermore, the exoglucanase activity was examined using cellulose overlay assay. For that 10 μl of Accellerase 1500 mix was pipetted onto LB agar plates. After the suspension dried out, cellulose overlay (Table 24) was poured onto the medium. The plates were incubated at 37 °C for 24 h. Then they were stained with congo red method as described above.

Finally, PASC-Agar and PASA-Agar plates (Table 24) were also used for exoglucanase activity determination. In these assays, 20 μl of commercially acquired cellobiohydrolase I from Hypocrea jecorina (Sigma-Aldrich®, United States) was pipetted into the wells. The plates were then incubated at 50 °C for 24 hours.

The protocol for preparing phosphoric acid swollen cellulose (PASC) and phosphoric acid swollen Avicel (PASA) is based on the method described by Zhang et al., (2006). To begin, 0.2 g of cellulose (microcrystalline, powder, 20 μm, Sigma-Aldrich®, United States) or Avicel was weighed into a 50-mL centrifuge tube. Then, 600 μL of distilled water (dH2O) was added to suspend the substrate. Following this, 10 mL of ice-cold 85 % phosphoric acid (H3PO4, Carl Roth GmbH + Co. KG, Germany) was slowly added to the suspension. The mixture was briefly vortexed before and after the addition of the H3PO4 to ensure proper mixing.

After this step, the suspension was incubated on ice for 1 hour with occasional vortexing. Once the incubation period was complete, 30 mL of ice-cold dH2O was added to the tube, and the mixture was vortexed again. The suspension was then centrifuged at 5000 g and 4°C for 20 minutes, and the supernatant was carefully removed.

The pellet was washed four times by resuspending 40 mL of dH2O, centrifuging, and discarding the supernatant after each wash. After the final wash, 500 μL of 2 M Na2CO3 as added, followed by 2 – 3 additional washing steps with 50 mM phosphate buffer (pH 7) until the pH of the PASC/PASA reached 7 upon resuspension in buffer.

Images of all plates were taken with P.CAM360 (software PlayMemories Mobile).


2. Background activity screening

For the background activity screening, overnight cultures were prepared using the following B. subtilis strains: BKE18130, BKE03410, BKE40110, BKE39070, BKE38560, BKE39260, W168, and WB800N, along with E. coli as a negative control. For BKE strains, antibiotics were added (Erythromycin (1 mg/ml) and Lincomycin (25 mg/ml)). Each overnight culture was adjusted to an OD600 of 0.5, and 10 μL of each solution was pipetted onto the respective LB agar medium containing CMC, Avicel, or esculin as substrates. These media were prepared as described previously for testing cellulase activities, with or without the addition of 0.5 % xylose to induce enzyme production. The plates were incubated at 37 °C for various time periods, ranging from 0 to 24 hours, to observe potential cellulase activity.


3. Functioning of the produced recombinant cellulases (intracellular and secreted)

Initially, to test the functioning of the intracellularly produced β-glucosidases LB-Agar-Esculin with and without 0.5 % xylose was used. 10 μl of each solution containing overnight cultures with OD600 of 0.5 were pipetted onto the medium. The plates were incubated 24 hours at 37 °C.

For evaluating the functionality of secreted endoglucanases, CMC-Agar plates were used. In these tests, 15 μL of supernatant containing the respective endoglucanases was applied as the sample. The supernatant from B. subtilis WB800N was used as a negative control, while a 10 μL aliquot of Accellerase 1500 enzyme mix diluted 1:100, was used as a positive control. The plates were incubated at 50 °C for 24 hours and subsequently stained with congo red solution as previously described.

To test exoglucanase activity, PASC-Agar and PASA-Agar plates were used. For these assays, 70 μL of supernatants, with and without the respective exoglucanases, were applied to the plates. The plates were incubated for 24 hours at 50 °C to evaluate the enzyme activity.


4. Functioning of the cellulases immobilized on spore surface

The OD of the spore suspension was measured using a 1:10 dilution (900 µl of dH2O and 100 µl of spore solution). For the qualitative plate assays, the OD was fixed to 0.2 for to test endoglucanases and exoglucanases. Different OD were used to observe the enzymatic reaction of exoglucanase displaying spores on plates with PASC-Agar and PASA-Agar.


Quantitative assays for estimation of cellulase activities


1. Dinitrosalicylic acid (DNS) assay

DNS assay protocol was adapted, with modifications, from the Environmental Biotechnology lab of the International Institute Zittau, provided by Prof. Dr. Christiane Liers. At first, DNS stop solution was prepared. 1 g of DNS (Sigma-Aldrich®, United States) was dissolved in 50 ml dH2O under stirring at 50 °C. Then 10 ml of 4 M NaOH/KOH solution were added drop by drop. Finally, 30 g of Rochelle salt (potassium sodium tartrate tetrahydrate, Sigma-Aldrich®, United States) were given into the solution under stirring and the volume was adjusted with dH2O to 100 ml. The stop solution was stored at room temperature in the dark.

Calibration standards with concentrations summarized in Table 20 were prepared for glucose and cellobiose (Carl Roth GmbH + Co. KG, Germany) calibration curves. 700 μl of the calibration standards were mixed with 700 μl DNS stop solution, incubated at 99 °C in a heat block for 5 minutes and then cooled down on ice. 100 μl of the resulted solution were added to 900 μl of 50 mM phosphate buffer with pH 7 in a cuvette and the absorption was measured at 540 nm with UV-VIS spectrophotometer UV-1280 (Shimadzu, Japan).

Table 20: Concentrations of glucose and cellobiose in calibration standards applied for construction of the calibration curve.
calibration standard c(standard), mM c(glucose), µg/ml c(cellobiose), µg/ml
1 11.1 2000 3800
2 8.88 1600 3040
3 6.66 1200 2280
4 4.44 800 1520
5 2.22 400 760
6 1.11 200 380
a) Tests with supernatants containing endoglucanases (BsEglS, BpEglA, AtCelA, AtCelG)

A reaction mixture consisted of

  • 650 µl of 1 % CMC solution prepared in 50 mM phosphate buffer,
  • 50 μl of endoglucanase containing supernatants or controls.

The reaction mixtures were incubated at 50 °C for varying times: 1 hour, 5 hours, or 13 hours. As a negative control, 50 mM phosphate buffer (pH 7) was used.

After the incubation period, 700 µL of DNS stop solution was added to each reaction, followed by heating the mixture for 5 minutes at 99 °C. The reaction mixtures were then cooled on ice. From each cooled solution, 100 µL was taken, mixed with 900 µL of phosphate buffer in a cuvette, and the absorbance at 540 nm (A540) was measured to estimate the enzyme activity.

b) Initial activity tests with BsEglS immobilized on spore surface

The OD of the spore suspension was measured using a 1:10 dilution (900 µl of dH2O and 100 µl of spore solution). The OD was then adjusted by fixing the OD to 2.8 for DNS assay with a final OD concentration of 0.2 in the reaction.

A reaction mixture was prepared with

  • 650 µl of 1 % CMC solution prepared in 50 mM phosphate buffer,
  • 50 μl of endoglucanase containing supernatants or controls.

The reaction mixture was incubated at 50 °C for either 24 hours or 30 minutes, depending on the experimental conditions. After the incubation period, 700 µL of DNS solution was added to each sample, and the mixture was heated at 99 °C for 5 minutes. Following heating, the mixture was cooled on ice and then centrifuged at 13,000 g for 1 minute. The solution was diluted 1:10, and absorbance was measured at 540 nm.

c) Optimal temperature of BsEglS-L1,BsEglS-L2, BsEglS-L3

The optimal temperature for BsEglS-L1,BsEglS-L2, BsEglS-L3 was determined by conducting the assay as previously described (see point (b)) for 30 minutes, but at varying temperatures ranging from 40 °C to 90 °C. This allowed for the assessment of enzyme activity at different temperatures to determine the temperature at which the enzyme exhibits maximal activity.

d) Thermostability determination of BsEglS-L1,BsEglS-L2, BsEglS-L3

To determine the thermostability of BsEglS-L1,BsEglS-L2, BsEglS-L3, the assay was conducted as described in point (b) for 30 minutes. However, before performing the assay, spore solutions were incubated at various temperatures ranging from 40 °C to 90 °C for 2 hours. After the heat treatment, the samples were allowed to cool down to room temperature. Following this pre-incubation, the assay was carried out to assess the residual enzyme activity.


2. 4-Nitrophenyl acetate (pNPAc) activity assay

The PETase activity assay was adapted from the method described by Xi et al. ( Xi et al., 2020 ). A fresh stock solution of 20 mM 4-nitrophenyl acetate (pNPAc) (Thermo Fisher Scientific, United States) in dimethyl sulphoxide (DMSO) (Carl Roth GmbH + Co. KG, Germany) was prepared immediately before the experiments. The stock solution was not stored for more than one day to ensure reagent stability and assay accuracy.

a) Activity tests with supernatants containing BhrPET

A 100 µl reaction mixture was prepared as follows:

  • 20 µL of 250 mM sodium phosphate buffer (pH 7.0) to achieve a final concentration of 50 mM in the reaction,
  • 5 µL of 20 mM 4-nitrophenyl acetate (pNPAc) solution in DMSO, resulting in a final substrate concentration of 1 mM and 5 % DMSO in the reaction,
  • x µL of supernatant containing BhrPET, and
  • x µL of dH2O to bring the final volume to 100 µL.
The reaction was initiated by adding the supernatant and incubated at 40 °C. A continuous absorption measurement at 405 nm was carried out for 10 minutes using a TECAN Microplate Reader Infinite® 200 PRO.

b) Activity tests with BhrPET immobilized on spore surface

A 400 µl reaction mixture was prepared in a 1.5 ml Eppendorf tube consisting of:

  • 80 µl of 250 mM phosphate buffer (pH 7),
  • 40 µl of spore solution (OD = 2),
  • 20 µl of 20 mM pNPAc,
  • 260 µl of dH2O.
The mixture was incubated at 40 °C for 10 minutes, followed by centrifugation at 13,000 g for 1 minute. After centrifugation, 100 µl of the supernatant was transferred into a 96-well plate, and absorbance was measured at 405 nm.

Additionally, the described assay was carried out with BhBglA immobilized on spore surface to test the interaction of spores with pNPAc.

c) Optimal temperature of BhrPET-L1

The optimal temperature for BhrPET-L1 was determined by conducting the assay as previously described (see point (b)) for 10 minutes, but at varying temperatures ranging from 40 °C to 90 °C. This allowed for the assessment of enzyme activity at different temperatures to determine the temperature at which the enzyme exhibits maximal activity.

d) Thermostability determination of BhrPET-L1

To determine the thermostability of BhrPET-L1 the assay was conducted as described in point (b) for 10 minutes. However, before performing the assay, spore solutions were incubated at various temperatures ranging from 40 °C to 90 °C for 2 hours. After the heat treatment, the samples were allowed to cool down to room temperature. Following this pre-incubation, the assay was carried out to assess the residual enzyme activity.


3. Glucose assay

To determine the glucose concentration in a reaction, Amplex™ Red Glucose/Glucoseoxidase-Assay-Kit (Thermo Fisher Scientific Inc., United States) was used.

First, all solutions were prepared according to the kit manual. To prepare the 1X Reaction Buffer (RB), 4 mL of 5X RB (Component C, white cap) were added to 16 ml of dH2O. A 10 U/ml stock solution of horseradish peroxidase (HRP) was prepared by dissolving the contents of the vial of HRP (Component D, yellow cap) in 1 ml of 1X RB. The solution was divided into single-use aliquots and stored frozen at –20 °C. To prepare a 100 U/ml glucose oxidase stock solution, the contents of the glucose oxidase (Component E, orange cap) were dissolved in 1 mL of 1X RB. This stock was also divided into single-use aliquots and stored frozen at –20 °C. For the 10 mM stock solution of Amplex® Red reagent, the vial (Component A, blue cap) and DMSO (Component B, green cap) were allowed to warm to room temperature. Just before use, the contents of the Amplex® Red reagent vial were dissolved in 60 µL of DMSO.

Next, a working solution containing 100 µM Amplex® Red reagent, 0.2 U/mL HRP, and 2 U/ml glucose oxidase was prepared by mixing the following: 50 µl of the 10 mM Amplex® Red reagent stock solution, 100 µl of the 10 U/ml HRP stock solution, 100 µl of the 100 U/mL glucose oxidase stock solution and 4.75 ml of 1X Reaction Buffer.

To generate a glucose standard curve, an appropriate amount of glucose was dissolved in 1X RB to produce concentrations of 0 to 150 µM, each in a volume of 50 µL. The final glucose concentrations in the reaction were twofold lower (i.e., 0 to 100 µM). 50 µL of each standard curve sample was loaded into a 96-well plate.

After loading the samples (50 µL) into the 96-well plate, 50 µL of the Amplex® Red reagent/HRP/glucose oxidase working solution was added to each well. The reactions were incubated at room temperature for 30 minutes, protected from light. Afterward, absorbance was measured at 560 nm using a TECAN Microplate Reader Infinite® 200 PRO.

For sample preparation (lysate or spore solution), we followed the respective protocols for induced expression or spore preparation. To quantify the glucose produced by cellobiose degradation dissolved in 1X RB, the following reactions were set up prior to the glucose assay and incubated for varying time periods (up to 24 hours).

a) Activity tests with lysates containing β-glucosidases (BhBglA, PpBglB, AtBglA)

A 400 µl reaction mixture was prepared with the following components:

  • 160 µl of 125 mM cellobiose, yielding a final concentration of 50 mM in the reaction,
  • x µl of lysate containing glucosidases,
  • x µl of 1X RB to complete reaction volume.
The mixture was incubated at 50 °C for varying time periods (up to 24 hours). After incubation, the reaction was terminated by heating the samples at 75 °C for 15 minutes, followed by centrifugation at 5,000 g for 1 minute. Subsequently, 50 µl of the working solution from the glucose assay kit was added, and the mixture was incubated in the dark for 30 minutes. Absorbance was measured at 560 nm.

b) Optimization of glucose assay with lysates

To optimize the glucose assay performance with lysates, varying percentages of lysate from WB800N were tested out. The samples were mixed with 50 mM cellobiose, 200 µM glucose, and 1X reaction buffer from the Amplex® Red Glucose/Glucose Oxidase Assay Kit. Glucose concentration was measured using the kit, and absorbance was recorded at 560 nm. 

Additionally, cellobiose purification protocol was tested out (McCarthy et al, 2004 ). Cellobiose was treated with glucose oxidase for 3 hours at 37 °C. The reaction was terminated by the subsequent incubation at 85 °C. The remaining impurities were removed by filtration performed prior to β-glucosidase reaction.

c) Activity tests with β-glucosidases displaying spores (BhBglA, PpBglB)

A 400 µl reaction mixture was prepared as follows:

  • 160 µl of 125 mM cellobiose, yielding a final concentration of 50 mM in the reaction,
  • 40 µl of spore solution (OD = 2),
  • 200 µl of 1X RB.
The mixture was incubated at 50 °C for varying time periods (up to 24 hours). After incubation, the reaction was centrifuged at 13,000 rpm for 1 minute. As with the lysate samples, 50 µl of the working solution from the glucose assay kit was added, and the mixture was incubated in the dark for 30 minutes. Absorbance was measured at 560 nm.


4. 4-Nitrophenyl glucopyranoside activity assay

The activity of β-glucosidase was measured by assessing the hydrolysis of p-nitrophenyl-β-D-glucopyranoside (pNPG) (Merck Millipore, United States), using the initial rate of colored reaction product accumulation, as described by Korotkova et al. (2009). The enzyme samples (either lysate or spore solution) were mixed with 5 mM pNPG substrate in 50 mM sodium phosphate buffer (pH 7.0). After incubation at 50 °C for 10 minutes, the reaction was terminated by adding 0.5 M Na2CO3. (Carl Roth GmbH + Co. KG, Germany). The release of p-nitrophenol (pNP), indicated by a yellow color, was measured using a TECAN Microplate Reader Infinite® 200 PRO at 405 nm.

a) Activity tests with lysates containing β-glucosidases (BhBglA, PpBglB, AtBglA)

A reaction mixture was prepared by mixing 20 µL of β-glucosidase lysate (BhBglA, PpBglB, AtBglA) with 180 µL of 5 mM pNPG substrate, dissolved in 50 mM sodium phosphate buffer (pH 7.0). The mixture was incubated at 50 °C for 10 minutes to allow the reaction to occur. To stop the reaction, 100 µl of ice-cold 0.5 Na2CO3 was added.

b) Activity tests with β-glucosidases displaying spores (BhBglA-L1, BhBglA-L2 and BhBglA-L3, PpBglB-L1, PpBglB-L3 )

A reaction mixture was prepared by mixing 40 µL of β-glucosidase-displaying spore solution (BhBglA-L1, BhBglA-L2 and BhBglA-L3, PpBglB-L1, PpBglB-L3) with an OD of 2, with 360 µL of 5 mM pNPG substrate, dissolved in 50 mM sodium citrate buffer (pH 7.0). The mixture was incubated at 50 °C for 10 minutes to allow the reaction to proceed. The reaction was then terminated by adding 200 µl of ice-cold 0.5 M Na2CO3.

c) Optimal temperature of BhBglA-L1, BhBglA-L2 and BhBglA-L3

The optimal temperature for BhBglA-L1, BhBglA-L2 and BhBglA-L3 was determined by conducting the assay as previously described (see point (b)) for 10 minutes, but at varying temperatures ranging from 40 °C to 90 °C. This allowed for the assessment of enzyme activity at different temperatures to determine the temperature at which the enzyme exhibits maximal activity.

d) Thermostability determination of BhBglA-L1, BhBglA-L2 and BhBglA-L3

To determine the thermostability of BhBglA-L1, BhBglA-L2 and BhBglA-L3, the assay was conducted as described in point (b) for 10 minutes. However, before performing the assay, spore solutions were incubated at various temperatures ranging from 40 °C to 90 °C for 2 hours. After the heat treatment, the samples were allowed to cool down to room temperature. Following this pre-incubation, the assay was carried out to assess the residual enzyme activity.

e) Reusability of the spore-displayed β-glucosidases

To examine the reusability of the spore-displayed enzymes for BhBglA with three different linkers the spores were used in five reaction cycles, with a washing step between each cycle. The number of spores in the first cycle was adjusted to achieve an OD600 of 0.2 in the reaction mixture. The washing step involved removing the reaction products by ensuring the spores settled at the bottom of the reaction tube through centrifugation for 5 minutes at 13,000 rpm. The supernatant was discarded, followed by the addition of 1 ml of dH2O, another centrifugation step, and subsequent removal of the water. 100 µl of fresh dH2O were added, and the spores were stored until the next usage (20 minutes later). The reaction was conducted with pNPG as the substrate for 15 minutes instead of the usual 10 minutes. After completing the final fifth cycle, the reaction mixture was measured, then incubated for an additional 1 hour, followed by another measurement.


Materials


Reagents, enzymes and kits

Molecular biological agents and enzymes as well as molecular biological kits used during our project are listed in Tab. 21, Tab. 22 and Tab. 23.

Table 21: Molecular biological reagents.
Reagent Manufacturer
1 kb Plus DNA Ladder New England BioLabs Inc., United States
Deoxynucleoside Mix (dNTPs) New England BioLabs Inc., United States
DMSO (100 %) New England BioLabs Inc., United States
Gel Loading Dye Purple (6X) New England BioLabs Inc., United States
OneTaq® Standard Reaction Buffer (5X) New England BioLabs Inc., United States
Phusion® GC Reaction Buffer (5X) New England BioLabs Inc., United States
Q5® GC Enhancer (5X) New England BioLabs Inc., United States
Q5® Reaction Buffer (5X) New England BioLabs Inc., United States
rCutsmart® Buffer (10X) New England BioLabs Inc., United States
T4 DNA Ligase Buffer (10X) New England BioLabs Inc., United States
Table 22: Enzymes.
Enzyme Units Manufacturer
Lysozyme 20.000 U/mg Carl Roth GmbH + Co. KG, Germany
OneTaq® DNA Polymerase 5.000 U/ml New England BioLabs Inc., United States
Q5® High-Fidelity DNA Polymerase 2.000 U/ml New England BioLabs Inc., United States
Restriction enzymes
BsaI-HF® 20.000 U/ml New England BioLabs Inc., United States
EcoRI-HF® 20.000 U/ml
SapI 10.000 U/ml
SpeI-HF® 20.000 U/ml
PstI-HF® 20.000 U/ml
XbaI 20.000 U/ml
T4 DNA Ligase 400.000 U/ml New England BioLabs Inc., United States
Endoglucanase from
Acidothermus cellulolyticus
2.0 U/mg Sigma-Aldrich®, United States
Cellobiohydrolase I from Hypocrea jecorina 0.13 U/mg Sigma-Aldrich®, United States
Accellerase 1500 enzyme mix Endoglucanase activity: 2200 – 2800 CMC U/g Genencor International, United States
β-Glucosidase activity: 525 – 775 pNPG U/g
Table 23: Molecular biological kits.
Purpose Kit Manufacturer
DNA purification HiYield® PCR Clean-up/Gel Extraction Kit Süd-Laborbedarf GmbH
Plasmid isolation HiYield® Plasmid Mini DNA Kit Süd-Laborbedarf GmbH

Media und supplements

Table 24: Media.
Medium Composition Manufacturer
DSM medium 8 g Nutrient broth Carl Roth GmbH + Co. KG, Germany
1 g KCl Carl Roth GmbH + Co. KG, Germany
1 ml MgSO4 (1 M) Grüssing GmbH, Germany
1 ml MnCl2 (10 mM) Sigma-Aldrich® Chemie GmbH, Germany
1000 ml dH2O
After autoclaving:
1 ml FeSO4 (1 mM) Caesar & Loretz GmbH, Germany
0.5 ml CaCl2 (1 M) Honeywell Specialty Chemicals Seelze GmbH, Germany
Expression mix 500 µl Yeast extract (5 %) Carl Roth GmbH + Co. KG, Germany
250 µl Cas amino acids (10 %) Thermo Fisher Scientific, United States
250 µl dH2O
50 µl Tryptophan (5 mg/ml) Carl Roth GmbH + Co. KG, Germany
LB agar 40 g LB-Agar (Luria/Miller) *Dehydrated commercial culture media Carl Roth GmbH + Co. KG, Germany
1000 ml dH2O
LB medium 25 g LB-Broth (Luria/Miller) *Dehydrated commercial culture media Carl Roth GmbH + Co. KG, Germany
MNGE medium 8.28 ml dH2O
920 µl MN medium (10X)
1 ml Glucose (20 %) Carl Roth GmbH + Co. KG, Germany
50 µl Potassium Glutamate (40 %) Sigma-Aldrich®, United States
50 µl Iron(III) ammonium citrate (2,2 mg/ml)
100 µl Tryptophan (5 mg/ml) Carl Roth GmbH + Co. KG, Germany
30 µl MgSO4 (1 M) Grüssing GmbH, Germany
Starch agar 7.5 g Nutrient broth Carl Roth GmbH + Co. KG, Germany
5 g Starch Thermo Fisher Scientific, United States
15 g Agar Carl Roth GmbH + Co. KG, Germany
1000 ml dH2O
LB-Agar-Esculin 40 g LB-Agar (Luria/Miller) *Dehydrated commercial culture media Carl Roth GmbH + Co. KG, Germany
1 g Esculin sesquihydrate Carl Roth GmbH + Co. KG, Germany
1 g Ammonium ferric citrate Sigma-Aldrich®, United States
1000 ml dH2O
LB-Agar-CMC 40 g LB-Agar (Luria/Miller) *Dehydrated commercial culture media Carl Roth GmbH + Co. KG, Germany
10 g CMC Carl Roth GmbH + Co. KG, Germany
1000 ml dH2O
LB-Agar-Avicel 40 g LB-Agar (Luria/Miller) *Dehydrated commercial culture media Carl Roth GmbH + Co. KG, Germany
10 g Avicel PH-101 Sigma-Aldrich®, United States
1000 ml dH2O
CMC-Agar 15 g Agar Carl Roth GmbH + Co. KG, Germany
10 g CMC Carl Roth GmbH + Co. KG, Germany
1000 ml dH2O
PASC-Agar ≤ 0.2 g PASC Carl Roth GmbH + Co. KG, Germany
0.7 g Agar
100 ml dH2O
PASA-Agar ≤ 0.2 g PASA Carl Roth GmbH + Co. KG, Germany
1.4 g Agar
100 ml dH2O
Cellulose overlay 0.2 g cellulose Carl Roth GmbH + Co. KG, Germany
0.7 g Agar
100 ml ml dH20
Table 25: Antibiotic supplements.
Antibiotic Stock solution Final concentration Manufacturer
Ampicillin 100 mg/ml in dH2O 100 µg/ml Carl Roth® GmbH + Co. KG, Germany
Chloramphenicol 35 mg/ml in ethanol (70 %) 35 µg/ml Merck Milipore, United States
Chloramphenicol 5 mg/ml in ethanol (70 %) 5 µg/ml Merck Milipore, United States
Erythromycin 1 mg/ml in ethanol (70 %) 1 µg/ml Sigma-Aldrich®, United States
Lincomycin 25 mg/ml in dH2O 25 µg/ml Sigma-Aldrich®, United States

Strains

All strains used in this project are listed in Tab. 26

cmr: chloramphenicol resistance, mlsr: erythromycin/ lincomycin resistance, ampr: ampicillin resistance, neor: neomycin Table 26: Strains.
Strain Description Reference
E. coli
TME4423 DH10β pBS1C-PcotYZ-sfGFP-cotY, ampr Laboratory collection
E. coli Laboratory collection
E. coli DH10β ФlacZ ΔM15 recA1 endA1 gyrA96 thi-1 hsdR17 (rK-,mK+) supE44 relA1 deoR Δ(lacZYA-arg F) U169 Laboratory collection
B. subtilis
W168 laboratory wildtype strain, B. subtilis trpC2 Laboratory collection
WB800N B. subtilis nprE aprE epr bpr mpr::ble nprB::bsr vpr wprA::hyg cm::neo; neor (cross-resistance to kanamycin) MoBiTec GmbH
3A38 B. subtilis NCIB 3610 comIQ12L (= strain DK1042) BGSC
WB600 B. subtilis trpC2 ΔnprE ΔaprA Δepr Δbpf Δmpr ΔmprB Wu et al. 1991
BKE18130 B. subtilis W168 trpC2 ΔeglS::erm, mlsr Koo et al. 2017
BKE03410 B. subtilis W168 ∆bglC::erm, mlsr Koo et al. 2017
BKE40110 B. subtilis W168 trpC2 ∆bglA::erm, mlsr Koo et al. 2017
BKE39070 B. subtilis W168 trpC2 ∆bglS::erm, mlsr Koo et al. 2017
BKE38560 B. subtilis W168 trpC2 ∆licH::erm, mlsr Koo et al. 2017
BKE39260 B. subtilis W168 trpC2 ∆bglH::erm, mlsr Koo et al. 2017

Vectors

All vectors used in this project are listed in Tab. 27.

Table 27: Vectors.
Vector Description Reference
pSB1C pDG1662 derivative; empty, amyE'…'amyE integration in B. subtilis, catr, blar , ColE1 Radeck et al. 2013
pBS1C3 ori pMB1, cmr, rfp-cassette in BioBrick MCS iGEM
pBS2E-xylR-PxylA-xylR pBS2E derivative, xylose inducible Pxyl (with regulator XylR) in front of mcs; BioBrick compatible, rfp in mcs; blar, mlsr, integrates in lacA Popp et al. 2017
pBS0E-xylR-PxylA pBS0E derivative; xylose inducible Pxyl (with regulator XylR) in front of mcs; BioBrick compatible, rfp in mcs; blar, mlsr, ori1030, ColE1 Popp et al. 2017
pDG1726 pSB119, aad9 Guerout-Fleury et al. 1995
pDG1513 pMTL22, tetr Guerout-Fleury et al. 1995

References


  • MoBiTec GmbH: https://www.mobitec.com/products/vector-systems/bacillus-expression-systems/pbs022/bacillus-subtilis-strain-wb800n-for-secretion-vectors, Accessed 26.09.2024, 17:10.
  • BGSC: https://bgsc.org/getdetail.php?bgscid=3A38, Accessed 26.09.2024, 17:12.
  • Wu, Xu-Chu, et al. "Engineering a Bacillus subtilis expression-secretion system with a strain deficient in six extracellular proteases." Journal of bacteriology 173.16 (1991): 4952-4958.
  • Koo, Byoung-Mo et al. “Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis.” Cell systems vol. 4,3 (2017): 291-305.e7. doi:10.1016/j.cels.2016.12.013
  • Korotkova, O. G., Semenova, M. V., Morozova, V. V., Zorov, I. N., Sokolova, L. M., Bubnova, T. M., Okunev, O. N., & Sinitsyn, A. P. (2009). Isolation and properties of fungal beta-glucosidases. Biochemistry. Biokhimiia, 74(5), 569–577. https://doi.org/10.1134/S0006297909050137
  • McCarthy, J. K., Uzelac, A., Davis, D. F., & Eveleigh, D. E. (2004). Improved Catalytic Efficiency and Active Site Modification of 1,4-β-d-Glucan Glucohydrolase A from Thermotoga neapolitana by Directed Evolution. Journal of Biological Chemistry, 279(12), 11495–11502. https://doi.org/10.1074/JBC.M305642200
  • Radeck, Jara et al. “The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis.” Journal of biological engineering vol. 7,1 29. 2 Dec. 2013, doi:10.1186/1754-1611-7-29
  • Popp, Philipp F et al. “The Bacillus BioBrick Box 2.0: expanding the genetic toolbox for the standardized work with Bacillus subtilis.” Scientific reports vol. 7,1 15058. 8 Nov. 2017, doi:10.1038/s41598-017-15107-z
  • Percival Zhang, Y. H., Cui, J., Lynd, L. R., & Kuang, L. R. (2006). A transition from cellulose swelling to cellulose dissolution by o-phosphoric acid: Evidence from enzymatic hydrolysis and supramolecular structure. Biomacromolecules, 7(2), 644–648. https://doi.org/10.1021/bm050799c
  • Guérout-Fleury, A M et al. “Antibiotic-resistance cassettes for Bacillus subtilis.” Gene vol. 167,1-2 (1995): 335-6. doi:10.1016/0378-1119(95)00652-4
  • Xi, X., Ni, K., Hao, H., Shang, Y., Zhao, B., & Qian, Z. (2021). Secretory expression in Bacillus subtilis and biochemical characterization of a highly thermostable polyethylene terephthalate hydrolase from bacterium HR29. Enzyme and Microbial Technology, 143, 109715. https://doi.org/10.1016/J.ENZMICTEC.2020.109715