| Buffer S |
| Buffer SP1 |
| Buffer SP2 |
| Buffer SP3 |
| Buffer DW1 |
| Wash solution |
| Elution buffer |
| Absorption column |
| Collection tube |
| Centrifuge |
| EP tube |
a.Check that RNase A has been added to Buffer SP1.
b.Check whether 100% ethanol has been added to the Wash Solution.
c.Check whether Buffer SP2 and SP3 are precipitated.
a.Place a Miniprep column into a collection tube.
b.Add 500 μL Buffer S to the adsorption column, centrifuge at 12,000 ×g for 1 min, discard the liquid in the collection tube, and put the column back into the collection tube.
3) Take 5 mL of overnight cultured bacterial, centrifuge at 8,000 ×g for 2 min to collect bacterial, discard the supernatant.4) Resuspend the bacterial were completely suspended by adding 250 μL Buffer SP1, make the pellet complete resuspended.
5) Add 250 µL Buffer SP2 and gently invert the tube for 10 times. And incubate at room temperature for 4 min.
6) Add 350 µL Buffer SP3 and gently invert the centrifuge tube 10 times for mixing.
7) Centrifuge at 12,000 ×g for 10 min. Transfer the supernatant into the adsorption column, centrifuge 8,000 ×g for 30 sec, discard the liquid in the collection tube.
8) Add 500 μL Buffer DW1, centrifuge at 9,000 ×g for 30 sec, and discard the liquid in the collection tube.
9) Add 500 μL Wash Solution, centrifuge at 9,000 ×g for 30 sec, and discard the liquid in the collection tube.
10) Repeat Step 9.
11) Place the column back into the collection tube and centrifuged at 9,000 ×g for 1 min.
12) Put the adsorption column into a clean 1.5 mL centrifuge tube, add 75 μL Elution Buffer in the center of the adsorption membrane, incubate at room temperature for 1 min, and centrifuge at 9,000 ×g for 1 min. Preserve the DNA solution in the tube.
| PrimeStar Max Premix (2×) |
| Primers |
| Template DNA |
| ddH2O |
| PCR Thermal Cycler |
| Pipettes and Tips |
| PCR tube |
a.Thaw all reagents on ice and keep them on ice throughout the setup.
b.Prepare a master mix for the number of reactions plus one extra to account for pipetting errors. The master mix should include the following per 50 μL reaction:
| Reagent | Volume (µL) |
|---|---|
| PrimeStar Max Premix (2×) | 25 |
| Primer F | 1 |
| Primer R | 1 |
| DNA template | 1 (~10 ng) |
| ddH2O | 22 |
| Total | 50 |
| Primer name | Sequence |
|---|---|
| plyV12C-R | agtggtggtggtggtggtgctcgagttatttgaaagtaccccacgcctc |
| plyV12C-F | gggtcgcggatccgaattcatgctaaatgggggatcaacaccccc |
| plyV12C-pET28a-F | gcgtggggtactttcaaataactcgagcaccaccaccaccaccactgaga |
| plyV12C-pET28-R | tgatcccccatttagcatgaattcggatccgcgacccatttgctgtccac |
| tailspike-F | gtggtggtggtgctcgagttaggctaacgtcagacgagtatagc |
| tailspike-R | tcgcggatccgaattcatgagttcaggatgtggggatgtactatctc |
| tailspike- pET28a-F | ctgacgttagcctaactcgagcaccaccaccaccaccactgagatccgg |
| tailspike- pET28a-R | ccccacatcctgaactcatgaattcggatccgcgacccatttgctgtcca |
| gp17-R | ggtggtggtgctcgagttaaacatcttcaaccgcaat |
| gp17-F | tcgcggatccgaattcatggctaatgttataaaaactgtactaacata |
| gp17- pET28a-F | attgcggttgaagatgtttaactcgagcaccaccaccaccaccactg |
| gp17- pET28a-R | ttttataacattagccatgaattcggatccgcgacccatttgctgtc |
3) Place the PCR tubes in the PCR thermal cycler and set the following parameters:
| Process | Temperature | Time | Cycle |
|---|---|---|---|
| Pre-Denaturation | 98℃ | 2 min | 1 |
| Denaturation | 98℃ | 10 sec | |
| Annealing | 70℃ | 30 sec | 30 |
| Extension | 72℃ | 2.5 min | |
| Final Extension | 72℃ | 10 min | 1 |
| Hold | 4℃ | until samples are removed | 1 |
| Agarose Powder |
| TAE or TBE Buffer |
| Loading Dye |
| GelRed (Beyotime- D0139) |
| Trans15K DNA Marker |
| Microwave oven |
| Gel Casting Tray and Comb |
| UV Transilluminator |
| Electrophoresis Apparatus |
a.Dissolve Agarose: For a 1% gel, weigh out 1 gram of agarose in 100 mL of 1X TAE buffer. And heat the mixture in a microwave until the agarose is completely dissolved. Be cautious of boiling over.
b.Cool the Agarose: Allow the molten agarose to cool to about 50-60°C before pouring. Add 10 µL GelRed and mix thoroughly.
2) Casting the Gela.Set Up the Gel Tray: Place the gel tray in the casting stand and insert the comb to form wells.
c.Pour the Agarose Solution: Pour the cooled agarose solution into the gel tray, ensuring no bubbles form. Allow the gel to solidify at room temperature for 20-30 min.
d.Remove the Comb: Carefully remove the comb once the gel is set.
3) Add Loading Dye: Mix DNA samples with loading dye to a final concentration of 1X.4) Setting Up Electrophoresis
a.Place the Gel in the Electrophoresis Tank: Position the gel in the electrophoresis apparatus and cover it with 1× TAE buffer until the gel is fully submerged.
b.Load the Samples: Carefully pipette the DNA samples and the DNA ladder into the wells of the gel.
c.Run the gel at 150 V for 25 min
5) Visualizing the DNA: Place the gel on a UV transilluminator to visualize the DNA bands. And capture images of the DNA bands Documenting Results6) Analyze the Results: Compare the bands of your samples to the DNA ladder to determine the sizes of the DNA fragments.
| Wash Solution |
| Buffer B2 |
| Elution Buffer |
| Column with collection tube |
| Centrifuge |
| Razor Blade |
| Microcentrifuge Tubes |
| Pipettes and Tips |
a.Visualize the DNA Bands: Place the agarose gel on a UV transilluminator and identify the DNA band of interest.
b.Excise the DNA Band: Using a clean razor blade, carefully cut out the DNA band from the gel. Minimize the amount of excess agarose around the band. Place the excised gel slice into a clean microcentrifuge tube.
3) Incubate the tube at 50°C water bath for 5-10 min or until the gel is completely dissolved. Vortex the tube briefly every 2-3 min to facilitate dissolution.
4) Place a column into a collection tube. And transfer the dissolved gel mixture to the column.
5) Centrifuge at 8000 ×g for 30 sec. Discard the flow-through and place the column back into the collection tube.
6) Add 500 μL wash buffer to the column. And centrifuge at 9000 ×g for 30 sec. Discard the flow-through and place the column back into the collection tube.
7) Repeat step 6
8) Spin the column at 9000 ×g for an additional 1 min to remove any residual wash buffer.
9) Place the column into a clean microcentrifuge tube. Add 35 μL elution buffer directly onto the center of the column. Let it sit at room temperature for 1 min to increase yield.
10) Spin the column at 10,000 - 16,000 ×g for 1 min to elute the DNA.
| 2× ClonExpress Mix |
| Linearized Vector |
| Gene fragment |
| PCR Tube |
| Pipettes and Tips |
| PCR Thermal Cycler |
2) Prepare the Cloning Reaction in a PCR tube, set up the reaction as follows:
| Reagent | Volume (µl) |
|---|---|
| Linearized Vector | [0.02 × length bp] ng |
| Gene fragment | [0.04 × length bp] ng |
| 2× ClonExpress Mix | 5 |
| ddH2O | - |
| Total | 10 |
| Competent Cells |
| SOC Medium |
| LB Agar Plates with Antibiotics |
| Water Bath |
| Incubator |
| Pipettes and Tips |
2) Add 10 μL of cloning reaction to 50 μL of competent cells. Gently mix by flicking the tube.
3) Incubate the mixture on ice for 30 min.
4) Heat-shock the cells at 42°C for 45 sec.
5) Recover Cells: Immediately transfer the cells back to ice for 2 min.
6) Add 700 μL of pre-warmed SOC medium to the cells.
7) Incubate the cells at 37°C with shaking (200-250 rpm) for 1 hour.
8) Spread 200 μL of the transformed cells onto the LB agar plate with kanamycin.
9) Incubate the plates at 37°C overnight.
| PCR Master Mix |
| Primers |
| PCR Tube |
| Sterile Pipette Tips |
| PCR Thermal Cycler |
2) Suspend the picked colony in 100 μL LB medium with kanamycin in a microcentrifuge tube. Incubate at 37°C for 1 hour.
3) Use 1-2 μL of this bacterial suspension as the template for the PCR reaction.
4) PCR reaction setup as follows
| Reagent | Volume (µl) |
|---|---|
| PCR Master Mix (2×) | 5 |
| Primer F | 1 |
| Primer R | 1 |
| DNA template | 1 |
| ddH2O | 2 |
| Total | 10 |
6) Place the PCR tubes in the PCR thermal cycler and set the following parameters:
| Process | Temperature | Time | Cycle |
|---|---|---|---|
| Pre-Denaturation | 95℃ | 2 min | 1 |
| Denaturation | 95℃ | 10 sec | 30 |
| Annealing | 70℃ | 30 sec | |
| Extension | 72℃ | 2.5 min | |
| Final Extension | 72℃ | 10 min | 1 |
| Hold | 4℃ | until samples are removed | 1 |
| IPTG |
| LB medium |
| Kanamycin |
| Shaker Incubator |
2) Incubate overnight at 37°C with shaking (200-250 rpm).
3) Dilute the overnight culture 1:100 into 50 mL fresh LB medium containing the 50 μg/mL kanamycin.
4) Incubate at 37°C with shaking until the OD600 reaches 0.4-0.6.
5) Add IPTG to a final concentration of 1 mM to induce protein expression.
6) Incubate at 16°C for 18 hours with shaking.
7) Harvesting Cells: centrifuge the culture at 4,000 ×g for 15 min at 4°C to pellet the cells. Discard the supernatant and proceed to protein purification.
| IPTG |
| Beyotime His-tag Protein Purification Kit (Denaturant-resistant), P2229S |
| Sonicator |
| 50 mL Centrifuge Tubes |
| Centrifuge Tubes |
| Pipettes and Tips |
a.Resuspend the cell pellet in 10 mL lysis buffer provided in the Purification Kit. Use non-denaturing condition for tailspike protein and denaturing condition for plyV12 and gp17 protein.
b.Lyse the cells by sonication on ice (30 sec on, 30 sec off, for a total of 15 min).
c.Centrifuge the lysate at 12,000 ×g for 30 min at 4°C to remove cell debris. Take 100 µL of supernatant as a sample for subsequent analysis, and transfer the remaining supernatant to a new, clean centrifuge tube.
2) Protein Bindinga.Take 1 mL of well-mixed 50% BeyoGold™ His-tag Purification Resin and add it to the column. Add 0.5 mL of lysis buffer, mix to equilibrate, and discard the liquid. Repeat the equilibration 1-2 times and discard the liquid.
b.Add the cell lysis supernatant to a column containing Purification Resin
c.Incubate the mixture at 4℃ with gentle shaking for 1 hour to allow binding.
3) Protein Washa.Open the cap at the bottom of the purification column and let the liquid flow out by gravity. Collect approximately 100 µL of the flow-through for subsequent analysis.
b.Wash the resin 5 times, each time adding 0.5-1 mL wash buffer. Collect approximately 100 µL of the flow-through wash buffer each time for subsequent analysis.
4) Protein Elution: Elute the target protein 6-10 times, each time using 0.5 mL elution buffer. Collect each elution fraction into different centrifuge tubes. The collected elution fractions are the purified His-tagged protein samples.| 15% SDS-PAGE Color Preparation kit, C671104 |
| Tris-Glycine-SDS buffer |
| Protein Ladder |
| Loading Buffer |
| SDS-PAGE Gel Casting System |
2) Mix protein samples with 2× loading buffer and heat at 95°C for 10 min.
3) Load the samples and protein ladder into the wells of the SDS-PAGE gel.
4) Place the gel in the electrophoresis tank and add 1×Tris-Glycine-SDS running buffer.
5) Run the gel at 100 V for the stacking gel and then increase to150 V for the resolving gel until the dye front reaches the bottom.
| Coomassie Brilliant Blue R-250 Stain Solution |
| Destaining Solution |
| Gel Imaging Systems |
2) Cover the gel with the staining solution and gently agitate on a shaker for 30 min at room temperature
3) Replace the staining solution with the destaining solution and gently agitate on a shaker.
4) Change the destaining solution periodically until the background is clear and protein bands are distinctly visible.
5) Once the gel is adequately destained, place it in distilled water to remove any residual destaining solution. Visualize the gel using a gel imaging system.
| Aurochlorohydric acid (HAuCl4) Solution: 10 mg/mL |
| Sodium Citrate Solution: 10 mg/mL |
| Potassium Carbonate Solution: 100 mM |
| 1% Bovine Serum Albumin (BSA) |
| Phosphate Buffered Saline (PBS) |
| Round-Bottom Flask |
| Magnetic Stirrer and Stir Bar |
| Shaker |
| Spectrophotometer |
| Microplate |
a.Add 100 mL of ultra-pure water to a round-bottom flask.
b.Add 1 mL of 10 mg/mL HAuCl4 solution to the flask. And place the flask on a magnetic stirrer and heat the mixture to boiling, allowing it to reflux.
c.After the mixture reaches boiling, add 1 mL of 10 mg/mL sodium citrate solution to the flask.
d.Continue stirring and heating until the solution turns a deep purple-red color, indicating the formation of gold nanoparticles.
e.Continue heating and stirring for an additional 10 min to ensure complete reaction.
f.Remove the flask from the heat and allow the solution to cool to room temperature. Store the solution at 4°C in the dark for future use.
2) Protein Conjugation with AuNPsa.Adjusting pH of AuNPs Solution: Take 1 mL of the AuNPs solution prepared in the previous steps. Then gradually add 7-8 μL of 100 mM potassium carbonate solution to adjust the pH to 8.0. Monitor pH carefully.
b.Add 100 μg of PBP protein to the pH-adjusted AuNPs solution. Incubate the mixture on a shaker at room temperature for 30 min to allow protein binding.
c.Centrifuge the mixture at 12,000 rpm for 5 minutes at 4°C. Then carefully discard the supernatant to remove unbound protein.
d.Add 1% BSA solution to resuspend the pellet and incubate at room temperature for 30 min to block any remaining binding sites on the AuNPs.
e.Centrifuge again at 12,000 rpm for 5 min at 4°C and discard the supernatant.
f.Resuspend the AuNPs@PBP pellet in 333 μL of PBS buffer.
g.Store the conjugated AuNPs@PBP solution at 4°C for future use.
3) Measurement of AuNPs@PBP Absorbancea.Scan the full wavelength range to determine the maximum absorption peak of the AuNPs@PBP solution using a spectrophotometer.
b.Note that AuNPs typically have a maximum absorption peak at 530 nm. Successful conjugation with PBP protein should result in a red shift of 2-3 nm in the absorption peak.
| AuNP suspension |
| Carbon-coated copper grids (300 mesh) |
| Potassium Carbonate Solution: 100 mM |
| Ultrapure water |
| Micropipette (0.5-10 μL) |
| Forceps |
| Filter paper |
| Desiccator |
| Talos F200x TEM (Thermo Fisher, USA) |
Hold the carbon-coated copper grid with fine-tipped forcepsand ensure the carbon-coated side is facing up.
2)Sample preparation:
a.Sonicate the AuNP suspension for 5 min to ensure homogeneous dispersion.
b.Dilute the AuNP suspension with ultrapure water (concentration should be approximately 0.1-1 mg/mL).
c.Place a 5 μL droplet of the prepared AuNP suspension onto the carbon-coated side of the grid.
d.Allow the sample to adsorb for 60 sec.
e.Gently touch the edge of the grid with a piece of filter paper to remove excess liquid.
f.Be careful not to touch the center of the grid where the sample is deposited.
g.Place the grid in a desiccator for 30 min to ensure complete drying.
3)TEM imaging:
a.Load the prepared grid into the TEM according to the instrument's guidelines.
b.Operate the TEM at an accelerating voltage of 80-200 kV, depending on the instrument and sample requirements.
c.Capture images at various magnifications to observe the size, shape, and distribution of the AuNPs.
| Phosphate Buffered Saline (PBS) |
| Bacterial culture |
| Smartphone with camera |
| RGB analysis software or app |
| Fresh lettuce and apples from a local supermarket |
a.Cultivate the target bacteria to achieve an OD600 of 1 (approximately 10^9 CFU/mL).
b.Collect the bacterial cells by centrifuging the culture and discard the supernatant.
c.Resuspend the bacterial pellet in PBS and adjust the suspension to an OD600 of 1 (approximately 10^9 CFU/mL).
d.Perform serial dilutions in PBS to achieve concentrations ranging from 10^3 to 10^9 CFU/mL.
2) Add 200 μL of each bacterial dilution to 100 μL of AuNPs @ PBP solution and incubate the mixtures at room temperature for 30 min. Include appropriate controls, such as pET28a empty vector controls, to validate the assay specificity and accuracy.3) After incubation, Transfer 200 μL of the supernatant into new 1.5 mL centrifuge tubes for imaging.
4) Imaging and Data Collection:
a.Assemble the smartphone and lightbox setup. Ensure the lightbox is equipped with a white LED light tube and black curtains to minimize external light interference.
b.Place the centrifuge tubes containing the supernatant in the lightbox. Capture images of the samples using the smartphone camera.
5) Data Analysisa.Extract the RGB values from the captured images using the RGB analysis software or app.
b.Generate a standard curve based on the RGB values corresponding to known bacterial concentrations.
c.Import the standard curve into the app for subsequent analysis.
| LB solid medium |
| near-infrared light (808 nm) |
| thermal imaging camera (TIC) |
a.The bacterial solution was diluted to a concentration of 10^6 CFU/mL and reacted with the above AuNP@PBP detection method for bacteria.
b.After the above detection part was reacted for 30 min at room temperature, the sample tube was irradiated under near infrared light (NIR) with a wavelength of 808 nm and a power of 2 W for 10 min (at a distance of 8 cm).
c.The temperature rise of the samples after NIR treatment was monitored using a photothermal camera.
d.Plates were coated with the irradiated samples and incubated at 37°C overnight
e.Bacterial survival was determined by plate counting method.