New Basic Parts
The TPS1 gene encodes Trehalose-6-phosphate synthase 1, an enzyme involved in the biosynthetic pathway of trehalose. It catalyzes the conversion of glucose-6-phosphate and glucose-1-phosphate into trehalose-6-phosphate. In Saccharomyces cerevisiae, overexpression of this enzyme can increase trehalose levels. Trehalose, as a protective sugar molecule, plays a crucial role in promoting cell survival and growth under environmental stress, enhancing the stability of yeast under adverse conditions.
2024 NJU-China After reviewing the literature, it was determined that overexpression of the TPS1 gene enhances trehalose expression as a means to improve the resistance of Saccharomyces cerevisiae in various aspects. Three strong promoters, TEF2, TDH3, PGK1, were provided by the Prometheus model. We successfully constructed plasmids using TEF2 and TDH3. The mRNA expression of TPS1 was significantly increased, and the yeast overexpressing the TPS1 gene was tested for increased resistance to high temperatures.
TPS1 gene sequence: BBa_K5367001
atgactacggataacgctaaggcgcaactgacctcgtcttcagggggtaacattattgtggtgtccaacaggcttcccgtgacaatcactaaaaacagcagtacgggacagtacgagtacgcaatgtcgtccggagggctggtcacggcgttggaagggttgaagaagacgtacactttcaagtggttcggatggcctgggctagagattcctgacgatgagaaggatcaggtgaggaaggacttgctggaaaagtttaatgccgtacccatcttcctgagcgatgaaatcgcagacttacactacaacgggttcagtaattctattctatggccgttattccattaccatcctggtgagatcaatttcgacgagaatgcgtggttggcatacaacgaggcaaaccagacgttcaccaacgagattgctaagactatgaaccataacgatttaatctgggtgcatgattaccatttgatgttggttccggaaatgttgagagtcaagattcacgagaagcaactgcaaaacgttaaggtcgggtggttcctgcacacaccattcccttcgagtgaaatttacagaatcttacctgtcagacaagagattttgaagggtgttttgagttgtgatttagtcgggttccacacatacgattatgcaagacatttcttgtcttccgtgcaaagagtgcttaacgtgaacacattgcctaatggggtggaataccagggcagattcgttaacgtaggggccttccctatcggtatcgacgtggacaagttcaccgatgggttgaaaaaggaatccgtacaaaagagaatccaacaattgaaggaaactttcaagggctgcaagatcatagttggtgtcgacaggctggattacatcaaaggtgtgcctcagaagttgcacgccatggaagtgtttctgaacgagcatccagaatggaggggcaaggttgttctggtacaggttgcagtgccaagtcgtggagatgtggaagagtaccaatatttaaggtctgtggtcaatgagttggtcggtagaatcaacggtcagttcggtactgtggagttcgtccccatccatttcatgcacaagtctataccatttgaggagctgatttcgttatatgctgtgagcgatgtttgtttggtttcgtccacccgtgatggtatgaacttggtttcctacgaatatattgcttgccaagaagaaaagaaaggttccttaatcctgagtgagttcacaggtgccgcacaatccttgaatggtgctattattgtaaatccttggaacaccgatgatctttctgatgccatcaacgaggccttgactttgcccgatgtaaagaaagaagttaactgggaaaaactttacaaatacatctctaaatacacttctgccttctggggtgaaaatttcgtccatgaattatacagtacatcatcaagctcaacaagctcctctgccaccaaaaactga
Contribution to Existing Parts
The Prometheus model provided us with multiple promoters, and we used two of them to successfully construct plasmids for TPS1 gene expression. They are TDH3 No. BBa_K124002, TEF2 No. BBa_K3753003. We overexpressed the TPS1 gene in Saccharomyces cerevisiae using TDH3, TEF2, and the original promoter of the pYET plasmid ADH2. By comparing the intensities of the expressed mRNAs of the three and their relationship with the blank group, we characterized the promoter strength of TDH3 and TEF2.
The mRNA concentrations of the three promoters (TDH3, TEF2, and ADH2) expressing TPS1 were determined using fluorescence quantitative PCR. The relative expression of mRNAs expressing TPS1 from the four promoters was compared by Ct values, as a means of comparing the relative strengths of the expression of the three promoters as well as the elevation of the mRNA concentration with respect to the blank group.
Each promoter included a blank group. We used two yeast monoclones that were successfully transferred into the promoter for fermentation. After three days, 1ml was removed and centrifuged at 4000g at 4°C to obtain the bacteriophage for mRNA extraction, reverse transcription, and fluorescent quantitative PCR.
Amplification curves were plotted and melting curves were determined based on Ct values.
From the amplification curves, it can be seen that all six experimental groups of the three promoters greatly increased the expression of TPS1, and the Ct values were all in the range of 20-25. The Ct values of the blank group were all after 30. The successful expression of the promoters TDH3 and TEF2 provided by Prometheus was demonstrated, proving the usefulness of the model. Comparing the expression of TDH3 promoter and the original ADH2 of the pYET plasmid, the TDH3 promoter increased the mRNA concentration of TPS1 by nearly 50% compared to ADH2. The strength of the TDH3 and TEF2 promoters can be characterized by this experiment.
Relative expression data:
- Relative expression of TDH3 relative to blank group: 2(31.48-19.92) = 3019
- Relative expression of TEF2 relative to blank group: 2(31.48-23.32) = 286
- Relative expression of ADH2 relative to blank group: 2(31.48-20.49) = 2033
- Relative expression of TDH3 relative to ADH2 group: 2(20.49-19.92) = 1.484