To amplify the TPS1 gene and the promoters ordered from Genscript (PGK1, TEF2, TDH2) in preparation for constructing a recombinant expression vector for transformation, corresponding homologous arm sequences were designed for the primers. Sequences homologous to the pYET vector and the TPS1 gene were amplified at both ends of the promoter, with additional sequences homologous to the pYET vector added downstream of the TPS1 gene for subsequent ligation.

-TPS with TDH3 Forward Primer(F): acttagtttcgaataaacacacataaacaaacaaaATGACTACGGATAACGCTAAGGC

- TPS with TEF2 Forward Primer(F): cggtcaacgaactataattaactaaacATGACTACGGATAACGCTAAGG

-TPS with Vector Lacking ADH2p Promoter Reverse Primer(R): tcgtgaaggcatgtttaaacTCAGTTTTTGGTGGCAGAGG

- TDH3 with Vector Lacking ADH2p Promoter Forward Primer(F): cggatccatttagcggccgctcagttcgagtttatcattatcaa

- TDH3 with TPS1 Gene Reverse Primer (R): tttgtttgtttatgtgtgtttattc

-TEF2 with Vector Lacking ADH2p Promoter Forward Primer(F): cggatccatttagcggccgcattacccataaggttgtttgt

- TEF2 with TPS1 Gene Reverse Primer (R): Gtttagttaattatagttcgttgacc

• To amplify the TPS1 gene from yeast S288c.

1. Pick an appropriate amount of yeast S288c and add 50 µL of 0.1 M NaOH. Let it sit for 10 minutes, then centrifuge and discard the supernatant. Add 50 µL of ddH2O and incubate in a 98°C metal bath for 10 minutes.
2. Prepare a 10 µL PCR system (annealing temperature: 55°C):
   • - ddH2O: 3.3 µL
   • - 2x Phanta Buffer: 5 µL
   • - DMSO: 0.4 µL
   • - dNTP: 0.2 µL
   • - Forward Primer (F): 0.4 µL
   • - Reverse Primer (R): 0.4 µL
   • - Template (yeast): 0.2 µL
   • - Phanta: 0.1 µL
3. Electrophoresis:
   • - Gel Preparation: 1% agarose TAE solution. Dissolve 4 g of agarose in 200 mL TAE by heating, then add 4 µL of nucleic acid dye after cooling slightly.
   • - Electrophoresis: Marker: DL8000; run at 180 V for 20 minutes.
4. Gel Recovery:
   • - Cut out the target band from the gel and place it in a clean centrifuge tube, then weigh it.
   • - Add an equal volume of V1 gel solution to the tube, incubate at 55°C for 10 minutes, inverting 2-3 times to ensure complete melting.
   • - Briefly centrifuge to collect the liquid from the tube walls.
   • - Place the adsorption column in a collection tube, add the gel solution to the column, and centrifuge at 12,000 rpm for 1 minute.
   • - Add 500 µL of wash solution W2 (with anhydrous ethanol) to the column, centrifuge at 12,000 rpm for 2 minutes.
   • - Repeat the previous step.
   • - After a final spin at 12,000 rpm for 2 minutes, place the column in a clean centrifuge tube, open the lid, and let it dry for 5 minutes.
   • - Add 5 µL of TE to the adsorption membrane, let it sit at room temperature for 2 minutes, then centrifuge at 12,000 rpm for 1 minute to collect the target gene and measure its concentration.

Successfully amplified the TPS1 gene.

TPS1 PCR Electrophoresis Validation Image

• To amplify the TEF2 and TDH3 promoters.

1. Prepare a 10 µL PCR system (annealing temperature: 51-55°C):
   • - ddH2O: 3.3 µL
   • - 2x Phanta Buffer: 5 µL
   • - DMSO: 0.4 µL
   • - dNTP: 0.2 µL
   • - Forward Primer (F): 0.4 µL
   • - Reverse Primer (R): 0.4 µL
   • - Template (pYET): 0.2 µL
   • - Phanta: 0.1 µL
2. Gel Electrophoresis:
   • - Gel Preparation: 1% agarose TAE solution. Dissolve 4 g of agarose in 200 mL TAE by heating, then add 4 µL of nucleic acid dye after cooling slightly.
   • - Electrophoresis: Marker: DL8000; run at 180 V for 20 minutes.
3. Gel Recovery:
   • - Cut out the target band from the gel and place it in a clean centrifuge tube, then weigh it.
   • - Add an equal volume of V1 gel solution to the tube, incubate at 55°C for 10 minutes, inverting 2-3 times to ensure complete melting.
   • - Briefly centrifuge to collect the liquid from the tube walls.
   • - Place the adsorption column in a collection tube, add the gel solution to the column, and centrifuge at 12,000 rpm for 1 minute.
   • - Add 500 µL of wash solution W2 (with anhydrous ethanol) to the column, centrifuge at 12,000 rpm for 2 minutes.
   • - Repeat the previous step.
   • - After a final spin at 12,000 rpm for 2 minutes, place the column in a clean centrifuge tube, open the lid, and let it dry for 5 minutes.
   • - Add 5 µL of TE to the adsorption membrane, let it sit at room temperature for 2 minutes, then centrifuge at 12,000 rpm for 1 minute to collect the target gene and measure its concentration.

Successfully amplified the TDH3 and TEF2 promoters.

TDH3 TEF2 PCR Electrophoresis Validation Image

• To obtain a pYET plasmid with the original ADH2p promoter removed, using an existing pYET that has the target gene excised, in preparation for subsequent connections with TDH3 and TEF2.

1. Prepare a 50 µL restriction enzyme system at 37°C for 2 hours:
   • - Amplified pYET: 10 µL
   • - NotI: 5 µL
   • - MssI: 5 µL
   • - 10x Buffer: 5 µL
   • - ddH2O: 25 µL
2. Gel Electrophoresis:
   • - Gel Preparation: 1% agarose TAE solution. Dissolve 4 g of agarose in 200 mL TAE by heating, then add 4 µL of nucleic acid dye after cooling slightly.
   • - Electrophoresis: Marker: DL8000; run at 180 V for 20 minutes.
3. Gel Recovery:
   • - Cut out the target band from the gel and place it in a clean centrifuge tube, then weigh it.
   • - Add an equal volume of V1 gel solution to the tube, incubate at 55°C for 10 minutes, inverting 2-3 times to ensure complete melting.
   • - Briefly centrifuge to collect the liquid from the tube walls.
   • - Place the adsorption column in a collection tube, add the gel solution to the column, and centrifuge at 12,000 rpm for 1 minute.
   • - Add 500 µL of wash solution W2 (with anhydrous ethanol) to the column, centrifuge at 12,000 rpm for 2 minutes.
   • - Repeat the previous step.
   • - After a final spin at 12,000 rpm for 2 minutes, place the column in a clean centrifuge tube, open the lid, and let it dry for 5 minutes.
   • - Add 5 µL of TE to the adsorption membrane, let it sit at room temperature for 2 minutes, then centrifuge at 12,000 rpm for 1 minute to collect the target gene and measure its concentration.

Successful enzyme digestion.

pYET Enzyme Digestion Electrophoresis Validation Image

• To connect TEF2, TDH3 with the pYET vector lacking the ADH2p promoter and the TPS1 gene.
• To connect the pYET vector retaining the ADH2p promoter with the TPS1 gene.
• To transform into E. coli and select for ampicillin-resistant single colonies.

• - For the multi-fragment recombination reaction:
  • - pYET vector: 0.02 × number of base pairs in the cloning vector (ng)
  • - TPS1: 0.02 × number of base pairs in the TPS1 gene
  • - Promoter: 0.02 × number of base pairs in the promoter
• - 10 µl Connection System
  • - pYET vector: 1 µl
  • - TPS1: 2 µl
  • - Promoter: 2 µl
  • - ddH2O: 5 µl
  • - Mix gently, incubate at 50°C for 15 min, then immediately place on ice.

• - For the single-fragment recombination reaction:
  • - pYET vector: 0.02 × number of base pairs in the cloning vector (ng)
  • - TPS1: 0.04 × number of base pairs in the TPS1 gene
• - 10 µl Connection System
  • - pYET vector: 1 µl
  • - TPS1: 2 µl
  • - Promoter: 2 µl
  • - ddH2O: 5 µl
  • - Mix gently, incubate at 50°C for 15 min, then immediately place on ice.

• - Place the E. coli DH5α competent cells on ice to thaw.
• - Add 10 µl of the recombinant product to 50 µl of competent cells, gently mix by flicking the tube, and incubate on ice for 30 min.
• - Heat shock at 42°C for 30 s, then immediately place on ice for 3 min.
• - Add 500 µl of LB liquid medium (without antibiotic) and incubate at 37°C for 1 h with shaking.
• - Centrifuge at 5000 rpm for 5 min, discard most of the supernatant, and plate the remaining supernatant on LB medium with ampicillin, and culture overnight.

Successful enzyme digestion.

Screening of E.coli transformed with TPS1

• To obtain amplified plasmids through E. coli culture.
• To acquire relatively pure target plasmids.
• To conduct PCR verification of the target plasmids.

1. Check Equipment:
   • - Confirm that RNase A has been added to Buffer P1.
   • - Verify that anhydrous ethanol is present in the Wash Solution.
   • - Check for precipitation in Buffers P2 and P3.
2. Cell Collection:
   • - Take 1.5-5 mL of overnight cultured bacterial liquid, centrifuge at 8,000 × g for 2 minutes to collect cells, and discard the supernatant.
3. Lysis:
   • - Add 250 μl of Buffer P1 to the pellet and resuspend thoroughly.
   • - Add 250 μl of Buffer P2, gently invert the tube 5-10 times to mix. Incubate at room temperature for 2-4 minutes.
4. Centrifuge:
   • - Add 350 μl of Buffer P3, gently invert the tube 5-10 times to mix.
5. Collect Supernatant:
   • - Centrifuge at 12,000 × g for 5-10 minutes. Transfer the supernatant to a binding column, and centrifuge at 8,000 × g for 30 seconds; discard the collection.
6. Washing:
   • - Add 500 μl of Wash Solution, centrifuge at 9,000 × g for 30 seconds, discard the liquid, and repeat once.
   • - Centrifuge the empty binding column at 9,000 × g for 1 minute.
7. Elution:
   • - Place the binding column into a clean 1.5 mL centrifuge tube, add 50-100 μl of Elution Buffer to the center of the membrane, let sit at room temperature for 1 minute, then centrifuge for 1 minute. Save the DNA solution in the tube.
8. Construct PCR System for Plasmid Verification

• To confirm the successful insertion of the TPS1 gene and promoters TEF2, TDH3 into the pYET plasmid.

1. Take 3 positive clones, add 10 μl of sterile water, and mix.
2. Use 1 μl of the bacterial liquid as PCR template. Add the remaining liquid to 500 μl of LB(Amp) medium and shake at 37°C for 5 hours.
3. 10 μl PCR System:
   • - ddH2O: 3.2 μl
   • - Taq enzyme: 5 μl
   • - DMSO: 0.4 μl
   • - Primer F: 0.2 μl
   • - Primer R: 0.2 μl
   • - Template (bacterial liquid): 1 μl
   • - Annealing temperature: 56°C
4. Perform agarose gel electrophoresis.
5. Select the culture liquid containing the correct positive clone and add to 3 mL of LB(Amp) medium, shaking for 5 hours.

PCR validation shows TDH3, TEF2 are ligated to pYET plasmid.

Successful enzyme digestion.

DH5-alpha TDH3 TEF2 TPS1 PCR Electrophoresis Validation Image

PCR validation shows TPS1 ligated to pYET plasmid without removal of the ADH2p promoter

Successful enzyme digestion.

DH5-alpha ADH2 TPS1 PCR Electrophoresis Validation Image

• To extract plasmids from the correct positive clones.

1. Check that RNase A has been added to Buffer P1; verify that anhydrous ethanol is present in the Wash Solution; check for precipitation in Buffers P2 and P3.
2. Take 3 mL of bacterial liquid, centrifuge at 8,000 × g for 2 minutes to collect cells, and discard the supernatant.
3. Add 250 μl of Buffer P1 to the pellet, resuspend thoroughly.
4. Add 250 μl of Buffer P2, gently invert the tube 5-10 times to mix. Incubate at room temperature for 2-4 minutes.
5. Add 350 μl of Buffer P3, gently invert the tube 5-10 times to mix.
6. Centrifuge at 12,000 × g for 5-10 minutes. Transfer the supernatant to a binding column, centrifuge at 8,000 × g for 30 seconds; discard the collection.
7. Add 500 μl of Wash Solution, centrifuge at 9,000 × g for 30 seconds; discard the collection.
8. Repeat the last step once.
9. Centrifuge the empty binding column at 9,000 × g for 1 minute.
10. Place the binding column into a clean 1.5 mL centrifuge tube, add 30 μl of Elution Buffer to the center of the membrane, let sit for 1 minute, then centrifuge for 1 minute. Save the DNA solution in the tube and measure the concentration.

• 10 μl Enzyme Cutting System:
  • - Plasmid: 8 μl
  • - HindIII: 0.5 μl
  • - BglII: 0.5 μl
  • - 10× Green Buffer: 1 μl
• Incubate in a 37°C water bath for 0.5 hours, followed by gel electrophoresis.

Enzyme digestion validation shows TDH3, TEF2 ligated to pYET plasmid.

DH5-alpha TDH3 TEF2 TPS1 Enzyme Digestion Electrophoresis Validation Image

Enzyme digestion validation shows TPS1 ligated to pYET plasmid without removal of the ADH2p promoter.

Enzyme digestion validation shows TDH3, TEF2 ligated to pYET plasmid.

DH5-alpha ADH2-TPS1 Enzyme Digestion Electrophoresis Validation Image

• To introduce the target plasmid into competent yeast cells.
• To obtain individual yeast colonies containing the target plasmid.

1. Prepare the pre-mix solution. For each plasmid transformation (one reaction), 360 μL of pre-mix solution is required:
   • - Solution C: 350 μl
   • - Plasmid (approximately 200 ng/μl): 5 μl
   • - ddH2O: 5 μl
2. Pipette 360 μL of the pre-mix solution into the competent cells, and repeatedly pipette to thoroughly suspend the yeast cells at the bottom of the centrifuge tube in the pre-mix solution.
3. Place in a 30°C water bath for heat shock for 45-60 minutes, mixing every 10 minutes. After the water bath, centrifuge at 3,000 g for 3 minutes.
4. Discard the supernatant and resuspend the pellet in 0.5 mL of YPD Plus, then incubate on a shaking incubator at 30°C for 30-60 minutes. Centrifuge at 3,000 g for 5 minutes and discard the supernatant.
5. Add 1 mL of sterile water or 0.9% NaCl to resuspend the pellet. Dilute separately to 10-fold and 100-fold, and plate onto the appropriate selective media.
6. Incubate at a constant temperature of 30°C for 3-5 days until yeast colonies appear on the plates.

• All steps of the transformation should be conducted under sterile conditions. YNB Plus should be stored at -20°C after opening to prevent contamination.
• To ensure transformation efficiency, competent cells should not be directly frozen in liquid nitrogen.
• Increasing the quality of the yeast plasmid can improve transformation efficiency.

Yeast monoclonal to pYET plasmid containing TDH3,TEF2 promoter

S288c TDH3 TEF2 pYET Cultivation Image

Yeast monoclonal to pYET plasmid containing ADH promoter

S288c ADH2 Cultivation Image

Half of the yeast monoclonal clone was picked for PCR verification, and the other half was successfully verified for fermentation culture. The results of PCR verification proved that the plasmids in the yeast monoclonal clone contained TDH3, TEF2 and ADH promoters.

S288c TDH3 TEF2 TPS1 PCR Electrophoresis Validation Image

S288c ADH2 pYET PCR Electrophoresis Validation Image

• Compare the mRNA intensity using TDH3, TEF2, ADH2p, and blank groups
• To demonstrate overexpression of the TPS1 gene.
• To demonstrate the utility of the Prometheus model recommended promoters TDH3 and TEF2.

1. Add 200ul of PBS to the yeast precipitate and resuspend, take 50ul of RNA extraction.
2. Add 950ul Trizol, shake vigorously and place on ice.
3. Add 200ul chloroform, shake vigorously and mix well, let it stand at room temperature for 10min, centrifuge at 16000rpm for 20min (4℃).
4. Pipette the supernatant 500ul into a new centrifuge tube, add equal volume of isopropanol, shake and let it stand at -20℃ for 1h.
5. Centrifuge at 16000rpm for 20min (4℃) and discard the supernatant.
6. Configure 75% ethanol (DEPC water: anhydrous ethanol = 1:3), take 800ul into the centrifuge tube, turn up and down.
7. 12000rpm centrifugation for 20min (4℃), discard the supernatant, dry.
8. Add 20ul DEPC water, mix well and measure the concentration.

1. Genomic RNA removal
   • RNase-free centrifuge tube is configured with the following mixture, then blow and mix well, 42 ℃ for 2min.
   • RNase-free ddH2O 10ul
   • 4x gDNA wiper Mix 4ul
   • Template RNA 2ul
2. Preparation of reverse transcription reaction system
   • Add 4ul of 5x HiScript III qRT SuperMix to the reaction solution in the first step, blow and mix well.
3. Perform reverse transcription reaction
   • 37℃ 15min
   • 85℃ 5sec

1. Prepare 20ul of system in a qPCR tube.
   • ddH2O 7.2ul
   • 2x ChamQ SYBR qPCR Master Mix (Without ROX) 10ul
   • cDNA 2ul
   • Primer F 0.4ul
   • Primer R 0.4ul
2. qPCR was performed under the following conditions
   • Pre-denaturation Rep:1 95℃ 30s
   • Cycle Rep:40 95℃ 10s ; 60℃ 30s
   • Melting curve Rep:1 95℃ 15s ; 60℃ 60s; 95℃ 15s

The mRNA concentrations of the three promoters TDH3, TEF2, and ADH2 expressing TPS1 were determined using fluorescence quantitative PCR, and the relative expression of mRNAs expressing TPS1 from the four promoters was compared by Ct values as a means of comparing the relative strengths of the expression of the three promoters, as well as the elevation of the mRNA concentration with respect to the blank group.

Each promoter included a blank group, we used two yeast monoclones that were successfully transferred into the promoter for fermentation, and after three days 1ml was removed and centrifuged at 4000g at 4°C to obtain the bacteriophage for mRNA extraction, reverse transcription, and fluorescent quantitative PCR.

Amplification curves were plotted and melting curves were determined based on Ct values.

Fluorescent Quantitative PCR Data Table

Amplification curve of TDH3, TEF2, ADH2 and pYET
Legend: Light blue: ADH2-1; Gray: pYET-1; Orange: ADH2-2; Yellow: pYET-2; Green: TEF2-1; Pink: TEF2-2; Dark blue: TDH3-1; Red: TDH3-2.

Dissolution Curve of TDH3, TEF2, ADH2 and pYET
Legend: Light blue: ADH2-1; Gray: pYET-1; Orange: ADH2-2; Yellow: pYET-2; Green: TEF2-1; Pink: TEF2-2; Dark blue: TDH3-1; Red: TDH3-2.

From the amplification curves, it can be seen that all six experimental groups of the three promoters greatly increased the expression of TPS1, and the Ct values were all in the range of 20-25. The Ct values of the blank group were all after 30. The successful expression of the promoters TDH3 and TEF2 provided by Prometheus was demonstrated, proving the usefulness of the model. Comparing the expression of TDH3 promoter and the original ADH2 of pYET plasmid, the TDH3 promoter increased the mRNA concentration of TPS1 by nearly 50% compared to ADH2, proving once again the superiority of Prometheus in component selection.

• Relative expression of TDH3 relative to blank group: 2^{(31.48 - 19.92)} = 3019
• Relative expression of TEF2 relative to blank group: 2^{(31.48 - 23.32)} = 286
• Relative expression of ADH2 relative to blank group: 2^{(31.48 - 20.49)} = 2033
• Relative expression of TDH3 relative to ADH2 group: 2^{(20.49 - 19.92)} = 1.484

Relative expression to blank group

• To verify that alginate is resistant to yeast growth.
• To investigate whether there is a difference in resistance between different promoters expressing alginate.

1. In the aseptic operating table, take 500μl of bacterial solution from the seed vials of two experimental groups with different promoters and add it into 50ml of culture medium, incubate at 37°C and 220rpm for 40h for amplification and fermentation.
2. Every 2h interval, take 1ml culture solution and add it to the cuvette, measure the OD value of the bacterial solution.

• Aseptic operation is required throughout the process, and all culture conditions are strictly controlled to be consistent.
• Set up experimental group (TEF2, TDH3, ADH2), negative control group (pYET), blank control group (blank culture solution added without sterile solution).

By plotting the time and OD curves, the yeast with different promoters showed a better growth trend at thirty-seven degrees Celsius than the blank group.

OD value versus time curve under cultivation at 37°C.

OD600 over Time Data Table

Photos of cultivation at 37°C.
Legend: From left to right: TDH3, TEF2, ADH2, pYET.

The above figure shows the shaker flasks incubated for 12 h. From left to right are TDH3, TEF2, pYET, and ADH2. a clear difference in the resilience of the blank group and the yeasts that achieved TPS1 overexpression to the unsuitable temperature can be seen.