Table 1 LB medium formula
| Tryptone | 10g/L |
| NaCl | 10g/L |
| Yeast | 5g/L |
The fusion tags NusA, TrxA, and MBP were individually cloned from plasmids previously stored in the laboratory. The AJC7 gene was amplified from a pET-28a(+)-AJC7 plasmid, which had been synthesized by a commercial provider.
Table 2 Primers used in the experiments
| Primers | Sequence |
| AJC7-Rev | GCCGCTGCTGTGATGATGATGATG |
| AJC7-For | ATGTTCGCAGAATTTCAGCATCTG |
| Crbq-Rev | CAGATGCTGAAATTCTGCGAACATACTGCCACCGCCACCGCTACCG |
| MBP-For | CATCATCATCATCACAGCAGCGGCARGAAAATCGAAGAAGGTAAAC |
| NusA-For | CATCATCATCATCACAGCAGCGGCAACAAAGAAATTTTGGCTGTAG |
| TrxA-For | CATCATCATCATCACAGCAGCGGCAGCGATAAAATTATTCACCTG |
Table 3 reaction syste
| Component | Volume |
| ddH2O | Up to 50 µL |
| 2 × Phanta SE Buffer | 25 µL |
| Primer F (10 μM ) | 2 µL |
| Primer R(10 μM ) | 2 µL |
| Phanta SE Super-Fidelity DNA Polymerase | 1 µL |
| Template DNA | x µL |
Table 4 reaction system
| Component | Volume |
| ddH2O | Up to 50 µL |
| 2 × Phanta SE Buffer | 25 µL |
| Primer F (10 μM ) | 2 µL |
| Primer R(10 μM ) | 2 µL |
| Phanta SE Super-Fidelity DNA Polymerase | 1 µL |
| Template DNA | x µL |
Table 5 Standard reaction procedure
| Cycle steps | Temperature | Time | Number of Cycles |
| pre-denaturation | 98℃ | 30 sec | |
| denaturation | 98℃ | 10 sec | 28-35cycles |
| annealing | Tm | 5 sec | 28-35cycles |
| extension | 72℃ | 5 - 10 sec/kb | 28-35cycles |
| Complete extension | 72℃ | 1 min |
1. Gibson Assembly:The appropriate DNA fragments and vector were mixed, and ddH2O was added to adjust the final volume to 5 µL.5 µL of 2× CE Mix was then added.The reaction was carried out using Vazyme’s ClonExpress Ultra One Step Cloning Kit V2.
2. Heat Shock Transformation:
a. Remove competent BL21 (DE3) cells from the -80°C freezer and place them on ice.
b. Once thawed (10 minutes), 10 µL of plasmid was added to 100 µL of competent cells, followed by incubation on ice for 30 minutes.
c. Heat shock the cells at 42°C for 90 seconds, then immediately return them to ice for 2–3 minutes.
d. Add 700 µL of antibiotic-free LB medium and incubate at 37°C on a shaker for 1 hour.
e. Plate 100 µL of the transformed cells onto LB agar plates containing the appropriate antibiotics.
f. Invert the plates and incubate them overnight at 37°C in a constant temperature incubator.
3. Screening and Colony Verification:After heat shock transformation, LB plates containing Kanamycin were used for initial screening.Inverted plates were incubated at 37°C for 12 hours to allow for colony growth, which was subsequently used for verification.
1. Preparation of Plasmid Mixture:Equal amounts of the molecular chaperone plasmid and the pET-28a(+)-AJC7 plasmid were mixed.
2. Heat Shock Transformation:
a. Remove competent BL21 (DE3) cells from the -80°C freezer and place them on ice.
b. After thawing (10 minutes), 10 µL of the plasmid mixture was added to 100 µL of competent cells, followed by incubation on ice for 30 minutes.
c. Heat shock the cells at 42°C for 90 seconds, then immediately place them back on ice for 2 minutes.
e. Plate 100 µL of the transformed cells onto LB agar plates containing the appropriate antibiotics.
f. Invert the plates and incubate overnight at 37°C in a constant temperature incubator.
3. Screening and Colony Selection:After heat shock transformation, LB plates containing Kanamycin (Kan) and Chloramphenicol (Cm) were used for initial screening.The plates were inverted and incubated at 37°C for 12 hours to allow for colony growth and subsequent verification.
The 10× DNA loading buffer was mixed with the PCR amplification product at a 1:10 ratio and gently mixed. The mixture was subjected to 1% agarose gel electrophoresis in 1× TAE buffer, running at 105 V for approximately 30 minutes. The gel was then examined under UV light to verify that the bands corresponded to the target fragment size.
Target fragments were recovered using the FastPure R Gel DNA Extraction Mini Kit (Nanjing Novogene Bioinformatics Technology Co. Ltd.), following the detailed protocol provided. The purified DNA products were stored at -20°C for future use.
Table 6. Primers used in the experiments
| Primer | Sequence |
| AJC7-S125D-F | GCACAGCAGGATGTTCGCGAAATTAGTCGTACC |
| AJC7-S125D-R | TTCGCGAACATCCTGCTGTGCAAAAATCGG |
| AJCT-I129T-F | GTTCGCGAAACCAGTCGTACCGAACGTAATTG |
| AJCT-I129T-R | GGTACGACTGGTTTCGCGAACACTCTGC |
| AJCT-L140P-F | CTGGATGTGCCGCATAGTGCCGTTTGGGG |
| AJCT-L140P-R | GGCACTATGCGGCACATCCAGCCAATTACGT |
| AJC7-T181A-F | ACCATGTTTGCTATTGATCCGAGTGATCATGTTAA |
| AJC7-T181A-R | CGGATCAATAGCAAACATGGTATAACCGGCAC |
| AJC7-H342L-F | CTGAGCCTGCTTAGTGGTAGTGATAAATTTTCTGTTTACCC |
| AJC7-H342L-R | ACTACCACTAAGCAGGCTCAGGCGATAAC |
Table 7 reaction system
| Competent | Volume |
| ddH2O | Up to 50 µL |
| 2 × Phanta SE Buffer | 25 µL |
| Primer F (10 μM ) | 2 µL |
| Primer R (10 μM ) | 2 µL |
| Phanta SE Super-Fidelity DNA Polymerase | 1 µL |
| Template DNA | x µL |
Table 8 special reaction procedures
| Cycle steps | Temperature | Time | Number of Cycle |
| pre-denaturation | 98℃ | 30 sec | |
| denaturation | 98℃ | 10 sec | 28-35cycles |
| annealing | Tm | 5 sec | 28-35cycles |
| extension | 72℃ | 5 - 10 sec/kb | |
| Complete extension | 72℃ | 1 min |
At the end of the PCR reaction, 1 µL of DpnI and 5 µL of 10× EC Buffer were added to the reaction mixture for demethylation. The mixture was incubated at 37°C for 40 minutes, followed by a heat inactivation step at 80°C for 20 minutes. After digestion, 5 µL of the reaction was taken for verification by nucleic acid gel electrophoresis.
For PCR validation of the fusion tag colonies, the following primers and systems were used:AJC7-Rev and AJC7-For were utilized to verify the presence of the AJC7 target gene on the plasmid.MBP-For, NusA-For, TrxA-For, and Crbq-Rev were employed to confirm the successful attachment of the fusion tags to the plasmid.
Table 9 Primers used in the experiments
| Primer | Sequence |
| AJC7-Rev | GCCGCTGCTGTGATGATGATGATG |
| AJC7-For | ATGTTCGCAGAATTTCAGCATCTG |
| Crbq-Rev | CAGATGCTGAAATTCTGCGAACATACTGCCACCGCCACCGCTACCG |
| MBP-For | CATCATCATCATCACAGCAGCGGCARGAAAATCGAAGAAGGTAAAC |
| NusA-For | CATCATCATCATCACAGCAGCGGCAACAAAGAAATTTTGGCTGTAG |
| TrxA-For | CATCATCATCATCACAGCAGCGGCAGCGATAAAATTATTCACCTG |
Table 10 Colony PCR reaction system
| Component | Volume |
| 2×Rapid Taq Master Mix | 5 µL |
| Primer F(100µM) | 0.4 µL |
| Primer R(100µM) | 0.4 µL |
| bacterial colony | not include |
| ddH2O | Up to 10 µL |
1.The PCR reaction solution was prepared according to the system described above.
2.Multiple single colonies were picked from the petri dishes cultured overnight after transformation, and each was introduced into the PCR reaction system using sterile tips.
3.After the PCR reaction was completed, nucleic acid gel electrophoresis was used to verify the presence of the desired fragment. If a fragment of the expected size was observed, the corresponding colony was streaked onto a fresh plate and subsequently transferred to a liquid medium for growth.
4.The strains were preserved by mixing the bacterial culture with glycerol at a 1:1 ratio. Remaining samples were prepared and sent for sequencing.
1.After successful sequencing, the retained strains were inoculated into a shake tube containing 5 mL of LB (Kan) liquid medium and incubated at 37°C with shaking for approximately 5 hours.
2.Subsequently, 2 mL of the bacterial culture was transferred to a flask containing 50 mL of LB (Kan) medium.
3.The culture was shaken at 200 rpm at 37°C until the OD600 reached 0.6.
4.IPTG was then added to the culture to a final concentration of 0.5 mM in a sterile environment.
5.The culture was incubated at 20°C with shaking at 200 rpm for 16 hours.
1.Microorganism Collection:After induction, the bacterial culture was centrifuged at 8000 rpm for 5 minutes, and the supernatant was discarded. The bacterial pellet was resuspended in 5 mL of PBS to wash away any residual medium. The suspension was centrifuged again at 8000 rpm for 5 minutes, the supernatant was discarded, and the pellet was resuspended in 3 mL of PBS.
2.Cell Disruption:The resuspended cells were placed in an ultrasonic crusher set at approximately 300 W. High-frequency ultrasonic vibrations were applied in cycles of 3 seconds on, followed by a 5-second interval, for a total of 10 minutes, until the bacterial solution became visibly clarified.
3.Protein Harvesting:Following ultrasonic disruption, the solution was centrifuged at 4°C at 12,000 rpm for 30 minutes to separate the supernatant (containing soluble proteins) from the pellet.
1.Nickel Column Preparation:The nickel affinity column (stored in alcohol at -20°C) was prepared by first removing the alcohol. The column was then sequentially washed with 5 mL of Buffer A, followed by 3 mL of Buffer B, and finally another 5 mL of Buffer A.
2.Protein Binding and Washing:The crude enzyme solution was loaded onto the prepared nickel column. The column was washed twice with 5 mL of Buffer A to remove any impurity proteins. Subsequently, 3 mL of Buffer B was added, and the eluate was collected in a pre-marked beaker to obtain the target protein.
3.Column Maintenance:After collecting the target protein, another 3 mL of Buffer B was passed through the column. The column was then washed with 5 mL of Buffer A and stored in 20% alcohol for future use.
4.Protein Concentration via Ultrafiltration:The crude enzyme solution collected in the beaker was transferred into an ultrafiltration tube, which was sealed with ultrapure water. The tube was centrifuged at 4°C, 6500 rpm for 30 minutes.
5.Buffer Exchange:After centrifugation, 2 mL of ultrapure water was added to the ultrafiltration tube, and centrifugation was repeated at 6500 rpm for another 30 minutes.
6.Final Concentration:Finally, an additional 2 mL of ultrapure water was added, and the solution was centrifuged at 6500 rpm for 15 minutes. If the volume of the purified enzyme solution exceeded 500-700 µL, further centrifugation (for an additional 5-15 minutes) was performed to increase the protein concentration.
7.Storage:The concentrated purified enzyme solution was stored at -20°C for future use.
Following the SDS-PAGE protocol detailed in [protocol], the sample preparation was done based on the protein concentration. The supernatant, pellet, and purified enzyme solution were then subjected to SDS-PAGE electrophoresis to determine if a band corresponding to the target protein was present.
The 500 µL reaction system consisted of the following components: purified enzyme solution at a final concentration of 1 mg/mL, D-fructose at a final concentration of 10 g/L, and 1 mM of the metal catalytic ion Ni2+. The required volumes of enzyme solution and substrate were added, and the final volume was brought to 500 µL with 50 mM Tris-HCl buffer (pH 9.0). The reaction was conducted at 70°C for 5 hours.
After the reaction, 5 µL of 1% H2SO4 was added to stop the reaction. The enzyme was then inactivated by heating at 100°C for 10 minutes. Following centrifugation, the supernatant was filtered through a 0.22 µm pore size membrane and analyzed using HPLC.
1.Optimum pH of the Reaction: The enzyme solution was incubated in a 50 mM buffer solution (pH 3–11) with a substrate concentration of 100 g/L D-fructose and a final enzyme concentration of 0.1 mg/mL for 3 hours. The following buffer systems were used:pH 3–5: Citric acid-sodium citrate;pH 6–7: Na2HPO4-NaH2PO4;pH 8–9: Tris-HCl;pH 10–11: NaOH-NaH2PO4
2.Optimum Reaction Temperature: The reaction mixture contained 100 g/L D-fructose in the buffer, a final enzyme concentration of 0.1 mg/mL, and 1 mM Ni2+, with the remaining volume brought to 500 µL using Tris-HCl buffer (pH 9.0). The reaction was performed at five different temperatures: 50°C, 60°C, 70°C, 80°C, and 90°C, each for 2 hours.
3.Maximum Conversion Rate of the Reaction: The reaction system contained 100 g/L D-fructose, a final enzyme concentration of 23 mg/mL, and 1 mM Ni2+, with the total volume adjusted to 500 µL using Tris-HCl buffer (pH 9.0). The reaction was carried out at 70°C in a metal oscillator. Samples (40 µL) were collected every 20 minutes for a total of 180 minutes. To stop the reaction, 1 µL of 1% H2SO4 was added to each sample, which was then diluted to 200 µL using Tris-HCl buffer (pH 9.0).
The substrate concentration gradient for D-fructose was set as follows: 5 g/L, 10 g/L, 20 g/L, 40 g/L, 50 g/L, 60 g/L, 80 g/L, and 100 g/L. The final enzyme concentration in the reaction system was 5 mg/mL, with 1 mM Ni2+ as the catalytic metal ion. The remaining volume was adjusted with 50 mM Tris-HCl buffer (pH 9.0). The reaction was performed at 70°C for 20 minutes on a metal oscillator. The concentration of tagatose in the samples was determined using HPLC.
The HPLC analysis was performed using an Ultimate® XB-NH2 column (4.6 × 250 mm, 5 µm).
Table 11 Chromatographic Conditions:
| Mobile phase | 75 % acetonitrile solution |
| Flow velocity Sample size | 1.0mL/min 10μL |
| Column temperature | 30℃ |
| Detector | RID |
| Detection wavelength | RID detection temperature：35℃ |
Preparation of the Mobile Phase: Combine 750 mL of chromatographically pure acetonitrile with 250 mL of ultrapure water. Mix thoroughly and degas the solution using ultrasonic treatment to ensure homogeneity.
Preparation of Mixed Reference Solution: Weigh approximately 1 mg each of D-fructose and D-tagatose, and dissolve them in 300 µL of ultrapure water in the same injection vial. Then, add 700 µL of chromatographic-grade pure acetonitrile and shake the vial to ensure complete mixing.