Building on BBa_K4119002, we modified the promoters to express the protein Bs2, a fluorescent protein reliant on flavin mononucleotide (FMN). Unlike green fluorescent protein (GFP), which necessitates oxygen for fluorescence emission, Bs2 is an oxygen-independent fluorescent protein that can function in an anaerobic fluorescence gene reporting system [1].
To optimize the expression of Bs2, we harnessed the J23119 promoter-BBa_K5366073. J23119 is a prokaryotic constitutive super strong promoter expression vector plasmid, which offers several advantages: Firstly, the J23119 promoter is one of the strongest constitutive promoters reported in its wild-type form, capable of efficiently driving the expression of foreign genes in E. coli without any addition of inducers, such as IPTG. Secondly, the addition of an UP element (designated as UPa) upstream of the core J23119 promoter further enhances expression efficiency, resulting in a 1.34-fold increase in relative fluorescence units (RFU). We assessed its characteristics, including excitation and emission wavelengths, unit fluorescence intensity in facultative anaerobes, and imaging of facultative anaerobes harboring recombinant plasmids under UV light.
The recombinant plasmid pET29a-Bs2 (including T7 promoter) was used as template, and j23119-For-20240719 and j23119-Rev-20240719 were used as primers to linearize vector (5695 bp) and one-step assembly was performed directly to construct pET29a-Bs2 (J23119) (Fig 1). Using yanzheng23119-For and yanzheng23119-Rev as primers, colony PCR (734 bp) was performed on the transformed colonies. Positive colonies were transferred and plasmid was extracted. After sequencing verification, the recombinant plasmid pET29a-Bs2 (J23119) was obtained.
Figure 1 Construction maps of plasmids of pET29a-Bs2(J23119).
Table 1 Primer sequences
| Primers | Sequences |
| j23119-For-20240719 | AGCTCAGTCCTAGGTATAATGCTAGCGGAATTGTGAGCGGATAACAATTC |
| j23110-Rev-20240719 | GCTAGCATTATACCTAGGACTGAGCTAGCTGTCAAATTTCGCGGGATCGAGATC |
| yanzheng23119-For | ATCTTCCCCATCGGTGATGT |
| yanzheng23119-Rev | CAGCCAACTCAGCTTCCTTT |
Further, we employed the facultative anaerobic E. coli strain BL21(DE3) to express Bs2 in plasmid pET29a-Bs2 (J23119). The pictures of recombiant strains on the LB plate and fluorescence microscopic image indicated the successful expression of Bs2 (Fig 2). Following 48 hours of cultivation, the excitation wavelength of Bs2 expressed from the pET29a-Bs2 (J23119) recombinant plasmid was approximately 448 nm, with an emission wavelength around 509 nm, as measured by a multifunctional microplate detector (Fig 3).
Figure 2 A) E.coli BL21 with pET29a-Bs2 (J23119) on LB solid medium with kanamycin(10μg/ml) incubated in 37 ℃ for 24h. All was observed under UV. B) A fluorescence microscopic image taken from the exponential growth phase when OD600=0.8.
Figure 3 Excitation maximum and emission peak.
The Ex Wavelength in nm (Em: 520) indicates that there is one peak values of excite wavelength and it is 448 nm. The Em Wavelength in nm (Ex: 448 nm) shows excluding the impact of three peaks value of excite wavelength, the emission wavelength is around 509 nm.
The recombinant plasmid pET29-Bs2 (J23119) was introduced into Escherichia coli strain BL21(DE3) (notated as J23119). The transfected Escherichia coli was cultured in LB medium till OD600 reached 0.8, 1.0 and 1.2, and the fluorescence intensity was detected. Escherichia coli BL21(DE3) transfected with pET29a empty vector as a blank control (notated as BL21).
Compared with the blank control (261.97, 287.54, 304.34), J23119 achieved efficient expression of Bs2 gene with high RFU of 566.44, 1943.8 and 2767.61 under OD600 of 0.8, 1 and 1.2 (Fig 4).
Figure 4 Comparison of RFU of Escherichia coli strain BL21(DE3) transfected with recombinant plasmid pET29-Bs2(J23119) and that transfected with pET29a empty vector (RFU: Relative fluorescence unit)
Finally, we adjusted cultivation temperature and time to evaluate changes in unit fluorescence intensity of E. coli BL21(DE3) with the pET29a-Bs2 (J23119) plasmid. OD600 and fluorescence intensity were recorded hourly until steady state, after which measurements were taken every two hours. The unit fluorescence intensity of Bs2 in E. coli BL21 with recombinant plasmids pET29a-Bs2 (J23119) was determined (Fig. 4). Fig 4A-4C indicated that the recombiant strain showed better fluorescence intensity at 30℃ and 37℃.
Figure 5 RFU and RFU/OD600 under the growth curve of E. coli with pET29a-Bs2 plasmid (J23119). (A) is incubated at 20 ℃; (B) is incubated at 30℃. (C) is incubated at 37 ℃.
1. Chi Cheng, Meng Lin, Wenyan Jiang, Jingbo Zhao, Weiming Lib,, Shang-Tian Yang (2019) ‘Development of an in vivo fluorescence based gene expression reporter system for Clostridium tyrobutyricum.’, Journal of Biotechnology, 305, pp18-22.