Experiments: Bringing Our Project to Life

Welcome to the Experiments page of the Hydro Guardian. Explore the laboratory work and protocols that form the backbone of our synthetic biology project and see which hands-on experiments have advanced our understanding and driven our innovations.

Here you find our biological experiments. If you want to have a look at our additional physical experiments, check out our Spectroscopy Analysis.  

Chemicals and Consumables


Table 1: Overview over the used chemicals in our experiments
Chemical Manufacturer
MilliQ water Q-Pod® Merck
DpnI Jena Bioscience
BamHI Jena Bioscience
SalI Jena Bioscience
NheI Jena Bioscience
AseI NEB
10X rCutsmart Buffer NEB
10X Universal Buffer Jena Bioscience
NEB HiFi Assembly Master Mix NEB
NEB positive control reaction mix NEB
Agar Fluka Chemie AG
LB (Luria/Miller) – Broth Carl Roth
Kanamycin (50 mg/mL) Carl Roth
Ampicillin (100 mg/mL) Carl Roth
SOC Outgrowth Medium NEB
10X GC Buffer NEB
10mM dNTPs PCR Biosystems
DMSO NEB
Phusion-Polymerase kind gift by Prof. Dr. Jan Faix
96 – 100% Ethanol Carl Roth
Glycerol Sigma-Aldrich
DMEM, high glucose Sigma-Aldrich
FCS Sigma-Aldrich
Pen/Strep (Penicillin and Streptomycin) Sigma-Aldrich
0.25% Trypsin/EDTA Gibco
DPBS Sigma-Aldrich
GenJet™ Reagent (Ver. II) SignaGen Laboratories
CuSO4 Carl Roth
1M HEPES Carl Roth
FACS-Buffer (DPBS + 1%FCS) Self-made
Table 1: Overview over the used consumables in our experiments
Consumable Manufacturer
Pipets Eppendorf
Pipet Tips Sarstedt
Serological Pipets Sarstedt
1.5mL Reaction Tubes Sarstedt
2mL Reaction Tubes Sarstedt
PCR-Tubes Sarstedt
Cryo-Tubes Sarstedt
15mL Canonical Tubes Sarstedt
50mL Canocical Tubes Sarstedt
Cell Culture Plates Sarstedt
Petri Dishes, 100mm Sarstedt
Zyppy™ Plasmid Miniprep Kit Zymo Research
ZymoPURE II Plasmid Midiprep Kit Zymo Research
HEK293T cells DSMZ
NEB competent E. coli DH5-alpha cells NEB

Cloning Strategy


To design and build the needed constructs, we planned the following cloning strategy. For this, in the beginning, we performed Polymerase Chain Reactions (PCR) to amplify the needed parts, which are needed for the HiFi DNA Assembly.

Experimental workflow of our cloning strategy

A PCR can serve, on the one hand, as a preparative tool for amplification of individual fragments and, on the other hand, as an analytical tool to validate the reactions performed.

Table 3: PCR protocol. The reaction setup for a 50 µL reaction based on the “Phusion™ High-Fidelity DNA Polymerase” protocol by NEB.
Component 50 µL Reaction Final Concentration
10X GC Buffer 10 µL 1X
10 mM dNTPs 1 µL 200 µM
10 µM Forward Primer 2.5 µL 0.5 µM
10 µM Reverse Primer 2.5 µL 0.5 µM
DMSO (optional) (1.5 µL) 3%
Phusion DNA Polymerase 0.5 µL 1.0 Units/50 µL PCR
Template DNA 1 µL < 250 ng
Nuclease-free water to 50 µL
Table 4: Thermocycler program. Thermocycling conditions for a routine PCR according to NEB.
Step Time Temperature Cycles
Initial denaturation 30 sec 98°C 1
Denaturation 5-10 sec 98°C 30
Annealing* 10-30 sec 50-72°C 30
Extension* 20-30 sec/kb 72°C 30
Final extension 2 min 72°C 1

*The annealing temperature and extension time depends on primer use and product length, respectively.

Table 5: Primerlist for all used primers for standard PCR.
Gene/Element Sequence 5´->3´
HGm_MRE-prom_fw CCGCCATGCATTAGTTATGCACACTGGCGCT
HGm_MRE-prom_rev TGGCGACCGGTAGCGGACGCTTAGAGGACAGC
MTF-1_fw CAGAGCTGGTTTAGTGAACCGTCAGATCCGATGGGGGAACACAGTCCAGAC
MTF-1_rev gcccttagacaccatGGGTGGCAGCTGCAGG
mRuby2_fw CTGCAGCTGCCACCCatggtgtctaagggcgaagagc
mRuby2_rev ATCCCGGGCCCGCGGTACCGTCGACTGCAGcttgtacagctcgtccatccc
MTF-1_solo_fw CAGAGCTGGTTTAGTGAACCGTCAGATCCGATGGGGGAACACAGTCCAGAC
MTF-1_solo_rev ATCCCGGGCCCGCGGTACCGTCGACTGCAGCTAGGGTGGCAGCTGCAG
Atf-2_Fragment1_fw TGAACCGTCAGATCCGatgaaattcaagttacatgtgaattctgccag
Atf-2_Fragment1_rev ggatccccacttcctgagggctgtgac
Atf-2_Fragment2_fw caggaagtggggatccaccggtcg
Atf-2_Fragment2_rev TCAGTTATCTAGATCCGGTGcttgtacagctcgtccatccc
ccpA_Fragment1_fw tggatccccttttgtagttcctcggtattcaattctgtgag
ccpA_Fragment1_rev TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc
ccpA_Fragment2_fw actacaaaaggggatccaccggtcg
ccpA_Fragment2_rev TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc
graR_Fragment1_fw TGAACCGTCAGATCCGatgcaaatactactagtagaagatgacaatactttgt
graR_Fragment1_rev tggatccccttcatgagccatatatccttttcctacttttgt
graR_Fragment2_fw ctcatgaaggggatccaccggtcg
graR_Fragment2_rev TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc
pknB_Fragment_fw AGCTTCGAATTCTGCAGAatgataggtaaaataataaatgaacgatataaaattgtagataagcttgg
pknB_Fragment_rev TCAGTTATCTAGATCCGGTGttatacatcatcatagctgacttctttttcagctacag
eGFP-C_fw GTCCTGCTGGAGTTCGTG
eGFP-N_fw CAACGGGACTTTCCAAAATG
SV40_rev cctctgcataaataaaaaaaattagtcagccatgg
H2A+ linker_Cla+PCR_rev TCCTCGCCCTTGCTCACCATggtggcgaccgg
CMV_fw CGCAAATGGGCGGTAGGCGTG
eGFP-C_rev AGCTGCAATAAACAAGTT
eGFP-C1-anti GGTTCAGGGGGAGGTGTG
SV40-pA_rev CCTCTACAAATGTGGTATGG
ATF2_miRFP_BB_rev cgatacaccatcacccggtcg
TVBB_ColE1_Ori_rev ttcgccacctctgacttgag

Beside the amplification of our parts, the restriction digest of the backbone EGFP-C2 was performed. The digested backbone is needed to bring the parts in the whole construct together. Different restriction enzymes are used, depending on where the backbone should be cut and whether the already present EGFP is needed or should be replaced by mRuby or miRFP.

Table 6: Restriction digest. The reaction setup for a 50 µL reaction according to NEB and Jena Bioscience.
Component 50 µL Reaction Final Concentration
10X rCUTSMART Buffer/10X UB Buffer 5 µL 1X
RE1 1 µL 20 units/50 µL
RE2 1 µL 20 units/50 µL
Backbone DNA 1 µg
Nuclease-free water Add to 50 µL

The reaction is incubated at 37°C for one hour. To deactivate the enzyme, the mixture is incubated at 80°C for 20 minutes.

Table 7: Restriction digest. Used enzymes to cut the backbone EGFP-C2 for HiFi DNA Assembly.
Plasmids RE1 RE2
PknB EGFP C2 SalⅠ BamHⅠ
GraR mRuby2 C2 NheⅠ BamHⅠ
CcpA mRuby2 C2 NheⅠ BamHⅠ
MTF-1 mRuby2 C2 NheⅠ BamHⅠ
ATF2 mRuby2 C2 NheⅠ BamHⅠ
ATF2 miRFP670 Promoter AseⅠ BamHⅠ
MRE EGFP Promotor AseⅠ NheⅠ

The DpnⅠ digestion is applied after the last PCR. The enzyme DpnⅠ belongs to type Ⅱ restriction endonucleases, which cleave at the methylated recognition sequence 5'-GmATC-3' in double-stranded DNA Text. This ensures that the remaining template is destroyed, as the desired PCR product is unmethylated. The procedure is analogue to the previous restriction digest.

Table 8: DpnⅠ Digest. Reaction setup for a 50 µL reaction according to Jena Bioscience.
Component 50 µL Reaction Final Concentration
10X UB Buffer 5 µL 1X
DpnⅠ  1 µL 20 units/50 µL
Backbone DNA 1 µg

The reaction is incubated at 37°C for one hour. To deactivate the enzyme, the mixture is incubated at 80°C for 20 minutes.

Finally, the HiFi DNA Assembly, a further developed version of the Gibson assembly, which was created by Daniel G. Gibson[2], is performed. It describes a cloning method, where multiple DNA fragments are joined together in a single reaction, regardless of size of DNA fragments and their overlaps. First, the overlapping 5´ ends of the DNA fragments are digested by an exonuclease and the 3´overhangs facilitate the annealing of the fragments at their overlapping regions. After that, a DNA polymerase extends the 3´ends by filling the gaps with dNTPs and lastly, a DNA ligase seals the nicks, so that a new double-stranded DNA construct emergesTextText. The protocol is shown in the next steps.

Insert & Vector preparation:

  1. Inserts and vectors were amplified with overhang primers and verified according to the PCR protocol or were ordered as GeneBlocks with overhangs.

Assembly reaction:

  1. Set up the following reaction on ice:
    Table 9: HiFi DNA Assembly. Setup protocol to assemble 1 to 2 inserts according to NEBuilder® HiFi DNA Assembly protocol by NEB.
    Component 2–3 Fragment Assembly
    Recommended DNA Molar Ratio vector:insert = 1:2
    Total Amount of Fragments X µL = 100 ng vector : 200 ng inserts *
    NEBuilderHiFi DNA Assembly Master Mix 10 µL
    Deionized H2O 10-X µL
    Total Volume 20 µL

    *Volume of fragments depends on measured concentration.

  2. Incubate samples in a thermocycler at 50°C for 1 hour. For following incubation, store samples on ice or at –20°C for subsequent transformation.
  3. Transform competent E. coli DH5 alpha (NEB) cells with 2 μl of the chilled assembled product, following the transformation protocol (NEB).

The ready to use plasmids are transferred in Competent E. coli DH5-alpha cells via heatshock transformation. The plating of the transformed cells on LB-Agar plates containing the antibiotic Kanamycin ensures that just positive cells, containing the plasmid with the Kanamycin resistance cassette, can grow.

Agar plate preparation:
Three plates of Kanamycin (50 µg/mL) containing LB-Agar plates (1.5% Agar) were prepared before starting the transformation protocol. For this, approximately 15 mL is used per plate. Two plates are for plating the bacteria, one is used as negative control and subsequent master plate.

Protocol:
Competent NEB®5-alpha E. coli bacteria, which were kindly sponsored by New England Biolabs, were used according to manufacturer´s protocol to introduce the cloned plasmids into bacteria for propagation of the expression vectors. For this purpose, 50 µL of NEB®5-alpha E. coli was mixed with 2 µL of the respective vector and incubated on ice for 30 minutes. Thereafter, heat shock was performed at 42°C for exactly 45 seconds. For recovery, the bacteria were placed on ice for a few minutes and 250 µL of SOC Outgrowth Medium (room temperature) was added. In this medium, the bacteria were shaken at 37°C and 180 rpm for one hour and then spread on agar plates containing kanamycin (50 µg/mL). Overnight, the bacteria incubated at 37°C and were selected by the antibiotic.

By picking the grown colonies from the agar plates, colony PCRs can be performed. Via this method, the correctness of the inserts can be validated and if the clones can be used for the next steps. For the colony PCR are different primers used than for the amplification.

Colony-PCR each with 20 µl preparations with for 10 clones each:

  1. Colony PCR and master plate preparation.
    • Prepare 10x 1.5 mL reaction tubes for each cloning approach by adding 20µl ddH2O into each tube.
    • Pick a nicely grown clone without visible satellite colonies using a sterile pipette tip, transfer a small amount of bacterial colony to master plate by tipping onto prepared and sufficiently labeled agar plate, and place tip – still containing bacteria – into ddH2O within prepared 1.5 mL tube.
    • Repeat previous step 9x, so that there will be ten clones to be analyzed in total.
    • Transfer 5µl ddH2O including bacteria into a PCR reaction tube for each clone.
    • Incubate PCR reaction tubes for 10 min at 80 °C. This step causes lysis of the dissolved bacteria, thereby releasing potential plasmid DNA from within the cells and facilitating the use of this preparation as template for the following analytical PCR reaction.

  2. Prepare Master-mix.

    Table 10: Colony PCR. The reaction setup for a 12.5 µL and 20 µL reaction based on the “Phusion® High-Fidelity DNA Polymerase” protocol by NEB.
    Component Volume [µL] (other constructs) Volume [µL] (PknB)
    10X GC-Puffer 2.5 4
    10 mM dNTPs 0.25 0.4
    10µM Forward Primer 0.625 1
    10 µM Reverse Primer 0.625 1
    Phusion-Polymerase 0.125 0.2
    Template 5 5
    DMSO (optional) 0.375 0.6
    ddH2O Fill up to 12.5 Fill up to 20
    Total volume 12.5 20
  3. Run the respective PCR program in the thermal cycler.

    Table 11: Thermocycler program. Thermocycling conditions for a routine PCR according to NEB.
    Step Time Temperature Cycles
    Initial denaturation 30 sec 98°C 1
    Denaturation 5-10 sec 98°C 30
    Annealing 10-30 sec 50-72°C 30
    Extension 20-30 sec/kb 72°C 30
    Final extension 2 min 72°C 1
    The annealing temperature and extension time depends on primer use and product length, respectively.

    Table 12: Conditions for Colony PCR. M1.1 to M1.4 and M3.0 for metal constructs. A1 to A5 for antibiotic constructs.
    Construct/Vector Annealing Temp Elongation time Used for primer Used rev Primer DMSO
    M1.1 72°C 15 sec HMG-MRE-Promotor_fw H2a+linker Cla+PCR_rev +
    M1.2 72°C 15 sec HMG-MRE-Promotor_fw H2a+linker Cla+PCR_rev +
    M1.3 72°C 15 sec HMG-MRE-Promotor_fw H2a+linker Cla+PCR_rev +
    M1.4 72°C 15 sec HMG-MRE-Promotor_fw H2a+linker Cla+PCR_rev +
    M3.0 56°C 1 min eGFP-N_fw eGFP-C_rev -
    A1 65°C 30 sec eGFP-N_fw eGFP-C_rev -
    A2 65°C 30 sec eGFP-N_fw eGFP-C_rev -
    A3 63°C 1 min eGFP-C_fw eGFP-C_anti +
    A4 68°C 1 min CMV_fw SV40_rev -
    A5 65°C 30 sec ATF2_miRFP_BB_rev TVBB_ColE1_Ori_rev -

After the validation of the correct insert via colony PCR, the plasmid preparation was performed. The Mini and Midi Preps are necessary to extract and purify the plasmids. Finally, the plasmids are sequenced by Microsynth SeqLab to validate the purified DNA sequences so there are no mutations introduced through the replication.

Overnight Culture:

  1. 5 ml LB
  2. Add 5 µl of kanamycin from a 50 mg/mL stock solution to achieve a final concentration of 50 µg/mL.
  3. Use the remaining 15 µL of the previously prepared solution of the picked bacterial clone within ddH2O (see section colony PCR) to inoculate the overnight culture.
    Incubate the culture at 37 °C with shaking at 180 rpm overnight.

Glycerol Stock:

  1. Prepare a 50% bacterial glycerol stock solution by mixing 500 µL of 100% glycerol with 500 µL of the overnight bacterial culture.
  2. Store the glycerol stock at -80 °C.

Plasmid Preps:
All plasmid preps were conducted using Mini and Midi Prep Kits, generously sponsored by Zymo Research, according to the manufacturer’s protocol.

For the Plasmid Midi Prep a 5 mL LB + Kan pre-culture was prepared (according to the overnight culture section) and is incubated for 3-4 hours. 1 mL from the pre-culture was used to inoculate 150 mL of fresh LB medium + 150 µL kanamycin and was incubated overnight at. The next day, 1:1000 chloramphenicol was added to the overnight culture and incubated for another one hour before prepping.

Plasmid Validation via Sequencing:
Use 1 µg of plasmid DNA after elution and add nuclease-free water to 12 µL total volume.

HEK293T Cells as a Model System


The correct validated and purified plasmids are now ready be to introduced them in the HEK293 cells enable sensing for with CuSO4 and Ampicillin. To perform the stimulation experiments the following cell culture strategy is introduced.

First of all, a functional running culture of HEK293T cells should be introduced. The cells are regularly seeded and split according to the following protocol. This enables us to estimate and plan the right number of cells for the transfection experiments.

For running culture (on Monday & Friday) and transfection culture (18 to 24 hours before transfection):

  1. Pre-heat DPBS and DMEM with 10% FCS and 1% Pen/Strep or without Pen/Strep in water bath at 37°C.
  2. Remove media from cells.
  3. Wash cells with 5 mL DPBS.
  4. Detach cells with 0.25% Trypsin+EDTA (2mL) and incubate for 5 min at 37°C.
  5. Add double volume of medium (4mL) to stop reaction.
  6. Centrifuge at 500 rcf for 5 min.
  7. Discard supernatant and resuspend pellet in 1 mL medium.
  8. Cell counting:
    1.  Dilute cells 1:50.
    2.  Prepare Neubauer chamber and add approx. 10 µL of diluted cells.
    3.  Count the 4x4 fields four times and calculated mean value.
  9. Formulas to calculate your cell number and number of cells to seed:
    Equation 1: Determination of the cell count per mL
    Equation 2: Determination of the cell suspension volume for transfection or the running culture
  10. Use for running culture 100mm Petri Dish or 24/48 Well plate.
    1.  Use 10mL of medium and transfer calculated volume of cell suspension.
    2.  Use 300µL for 48 Well plates or 500µL for 24 Well plates and transfer calculated volume of cell suspension.
  11. Incubate at 37°C with 5% CO2.

Transfection is used to insert and express foreign DNA, like our designed plasmids, into eukaryotic cellsText. For this, we use GenJet™ In Vitro DNA Transfection Reagent (Ver. II). A transfection efficiency of about 80 to 90% should be reached in HEK-293T cellsText. The transfection is proceeded by following the protocol of SignaGen® Laboratories.

Table 13: The transfection setup for transfectiong cells in 6 Well, 24 Well and 48 Well Culture Dishes based on the “GenJet™ In Vitro DNA Transfection Reagent (Ver. II)” protocol by SignaGen® Laboratories.
Culture Dish Culture Medium [mL] Plasmid DNA [µg] Diluent Volume [mL] GenJet™ Reagent [µL]
48 Well Plate 0.3 0.25 2 x 0.015 0.75
24 Well Plate 0.5 0.5 2 x 0.025 1.5
6 Well Plate 2 1 2 x 0.05 3
  • Part 1 – Cell Seeding:
    1.  Plate the cells 18 to 24 hours before transfection.
    2.  A confluency of 70 to 80% is recommended.
    3.  Change medium 30 to 60 minutes before transfection (Use DMEM High Glucose with 10% FCS and 1% Pen/Strep or without Pen/Strep).

  • Part 2 – Preparation of GenJet-DNA Complex and Transfection Procedures:
    1. The recommended GenJet™ (µL)-DNA (µg) ratio of 3:1 (Table 13) is used.
    2. Use serum-free DMEM with High Glucose with 1% Pen/Strep or without Pen/Strep to dilute the GenJet Reagent and the plasmid DNA.


      The following steps depending on culture dish size (Table 13):

    3. Add X mL fresh DMEM with 10% FCS and 1% Pen/Strep or without Pen/Strep 30-60 min before transfection.
    4. Dilute X µg DNA to X mL serum-free DMEM with High Glucose with 1% Pen/Strep or without Pen/Strep; diluent volume -> mix by gently vortexing.
    5. Dilute X µL GenJet™ Reagent into X mL serum-free DMEM with High Glucose with 1% Pen/Strep or without Pen/Strep; diluent volume -> mix by pipetting 3-4 times.
    6. Transfer diluted GenJet™ Reagent to diluted DNA and mix by pipetting 3-4 times and incubate for approx. 10 mins at room temperature to form the GenJet™ -DNA Complex.
    7. Add the GenJet™-DNA Complex drop wise onto the media in each well and swirl gently.
    8. Change medium after 12 to 18 hours.

    Note: for transfection with two constructs divide the total amount of DNA and use equal amounts of each plasmid DNA (µg) (Table 13).
    -> volume of GenJet™ Reagent does not change

After successful transfection, the HEK293T cells should be able to indicate the presence of copper sulphate and ampicilin. Different concentrations were used to stimulate the expression of the fluorescent proteins and thus the detection of metals and antibiotics. The stimulation protocol is shown below.

CuSO4:
The metal solutions were added after 24 h after of transfection. Before stimulation, the transfected cells were imaged to check the basal fluorescence signal. Moreover, 10 mM HEPES was added to fresh medium. The bivalent ions getting in the cells and bind to the MTF-1, which induces the MRE-containing promoters, which leads to eGFP expression. The maximal concentration of 2 mM, for CuSO4, is according to WHO guidelines.

Table 14: Copper stimulation. Used concentrations for viability test and induction.
Concentration viability test [µM] Concentration for induction [µM]
2000 500
1000 300
500 250
250 200
50 100
0 50
0

Ampicillin:
Ampicillin was added after 24 h after transfection. Before the stimulation, the transfected cells were imaged to check the basal fluorescence signal before and after. The PASTA domain of PknB recognize beta-lactams, leading to phosphorylation of ATF2, which then binds to the AP1 and CRE sites in the promoter. The binding leads to the expression of miRFP670.

Table 15: Ampicillin stimulation. Used concentrations for viability test and induction.
Concentration viability test [µg/mL] Concentration for induction [µg/mL]
500 100
100 25
50 10
25 5
5 2.5
0 0

Before stimulation and after an incubation time of 4 hours, the cells were imaged by confocal microscopy. By this, we can qualitatively validate the reporter gene expression and localization of our membrane protein (PknB) and transcription factors.

To check the localization and expression of the proteins, confocal microscopy is used. Confocal microscopy is an advanced optical imaging technique that enhances the resolution and contrast of micrographs by using a spatial pinhole to block out-of-focus light. Unlike conventional wide-field microscopy, which captures light from all focal planes, confocal microscopy focuses on a single plane at a time, producing high-resolution, three-dimensional images. This is achieved by scanning the specimen point by point with a laser and collecting the emitted light through a pinhole that aligns with the focus plane. The result is sharp images with minimal background noise, making confocal microscopy ideal for detailed studies of cells, tissues, and other biological specimens. The images were recorded with a 25x/0.9 water-immersion objective. For the detection of the fluorescent signal, lasers with wavelengths of 488nm, 543nm & 630nm were used. The pictures were recorded with a frame average of four and a format of 1014 x 1024 pixel.

Later, the pictures were taken with a Leica camera system. For this, channels for eGFP (488 nm), mRuby (543 nm) and miRFP670 (630 nm) were chosen to validate the fluorescent signal. For brightfield recordings exposure times of 1 ms are used, for eGFP up to 70 ms and for mRuby between 100 ms and 1000 ms depending on signal strenght.
 
For both setups a pinhole of 58 µM and 75 µM was used to adjust the brightness. In general, all setup points depending on the sample and the fluorescent signal.
 
The pictures were analyzed via the Fiji (ImageJ) software.

Beside the qualitative validation of the gene expression, we want to quantify the expression level of the promoter coupled reporter genes. FACS analysis is an appropriate method to verify the functionality of the bio sensors.

Fluorescent Activated Cell Sorting (FACS) is a specialized type of flow cytometry that allows sorting and analysis of cells based on specific characteristics. Cells are first labeled with eGFP (metal promoter) or miRFP670 (antibiotic promoter). As the cells pass through a laser beam in a fluid stream, they emit light at different wavelengths depending on the markers present. In our experiments we use lasers with wavelengths of 488 nm (blue) and 635 nm (red). Detectors capture this light, and the cells are then sorted into different containers based on the fluorescent signals they emit. We use this technique to quantify our promoter activities with and without metal or antibiotic induction.

Protocol:

  1. Discard media and wash with 300 µL DPBS.
    •  Discard DPBS.
  2. Add 150 µL 0.25% Trypsin-EDTA.
    •  Incubate at 37°C for 5 min.
  3. Stop reaction with 300 µL DMEM with 10% FCS & 1% Pen/Strep and transfer volume to FACS-Tubes.
  4. Centrifuge at 800 rcf for 5 min.
  5. Discard flow-through.
    •  Resuspend pellet in 1 mL FACS-Buffer.
    •  Repeat step 4.
  6. Resuspend pellet in FACS-Buffer (volume depends on pellet size and cell number).
  7. FACS measurement.
  8. Analysis with FCSalyzer software and Microsoft Excel.
  • Item 1
  • Item 2
  • Item 3
  • Item 4
Back to the Top