Plasmid Transformation

For DH5 alpha and K12

(1) Place the bacterial liquid on ice for 8min to melt;
(2) Mix 50μL bacterial liquid with around 100ng plasmid and place on ice for 30min;
(3) 42℃ metal bath heat hit 45s;
(4) Place the mixture on the ice again for 2-3min;
(5) Add 800μL Autoclaved bacterial culture medium, shake on the shaker for 1h (37℃, 220rpm).
(6) Preheat the corresponding resistant LB solid medium plate in a 37℃ incubator. Centrifuge at 5,000 rpm(2,500×g) for 5 min and discard 870 ul supernatant. Suspend the bacteria with the remaining medium (30ul) and lightly coated with a sterile coating stick on a plate containing the correct resistance. Invert the culture in 37℃ incubator for 12-16 h, usually overnight culture.
(7) After culture for 12-14h, pick out single colonies on plates and add into resistant 5ml medium

Plasmid Mini extraction

Using FastPure Plasmid Mini Kit(DC201, Vazyme).

Polymerase chain reaction

(1) To the reaction system, upstream and downstream primers, template DNA, 2xPhenta Max Master Mix(P525-01, Vazyme) and ddH2O are added proportionally;
(2) Cycling Conditions: Step 1: 95℃, 30s; Step 2: 95℃, 15s; Step 3: Primer melting point minus 3 degrees, 15s; Step 4: 72℃, 1kb for 30s; Step 5: Go to Step2, repeat for 35 cycles; Step 6: 72℃, 5min; Step 7: 4℃, infinite.

DNA agarose gel electrophoresis

(1) Configure 30ml 1% agarose solution, heat and melt, add 3μL 10000x dye Gelred;
(2) Add 10x loading buffer with around 100 ng plasmid in each well;
(3) 110V electrophoresis for 30min;
(4) Fluorescence chromogenic photography

DNA Gel Extraction and purification

Using FastPure Gel DNA Extraction Mini Kit(DC301-01, Vazyme)

Construction of Plasmids

We construct plasmids with Homologous Recombination

(1) To the reaction system, insert fragments, linearized vector, 5*CE II buffer, Exnase II (ClonExpress® II One Step Cloning Kit C112) and ddH(2)O are added proportionally;
(2) Reaction Condition: 37℃, 30min;

Colony PCR

(1) Pick the monoclonal with the pipet tip;
(2) Streak on a blank bacterial culture plate using the pipet tip with colony on;
(3) Add the remaining bacteria on the pipet tip to the pre-prepared PCR system as the template;
(4) Cycling Conditions: Step 1: 95℃, 5min; Step 2: 95℃, 15s; Step 3: Primer melting point minus 3 degrees, 15s; Step 4: 72℃, 1kb for 30s; Step 5: Go to Step2, repeat for 35 cycles; Step 6: 72℃, 5min; Step 7: 4℃, infinite.

Competent cells preparation

(1) Spread competent cells onto the bacterial culture plate;
(2) Take single clone in 3mL liquid medium for small amount amplification;
(3) 1:100 inoculation of bacterial solution from shaking tube into 1000ml shaking bottle with 200mL liquid medium for bulk amplification;
(4) Cultivate the bacteria on the shaker until the OD600 of the bacterial solution is about 1.0-1.2 andto 0.5-0.7;
(5) Centrifuge the bacterial solution at 4℃, 5000xg for 5min, and collect all the bacteria into a 50mL centrifuge tube in several times;
(6) Gently resuspend the bacteria with 40 ml of pre-colded 10% glycerol and centrifuge again(4℃, 5000xg for 5min);
(7) Repeat the operation(6) again;
(8) Resuspend the bacteria with 16mL of 10% glycerol and dispense 50ul per tube into 1.5mL centrifuge tubes, freeze in liquid nitrogen and transfer to -80℃ refrigerator.

Function verification of salicylic acid receptors

(1) Co-transform nahR-RhlR-pSC101 and psal-Jump29A into DH5alpha E. coli cells.
(2) Select single colonies for overnight culture in LB medium and sequence to ensure successful co-transfer.
(3) Dip the bacterial solution and striat the LB solid medium containing 3e-3uM salicylic acid，and do the same for DH5alpha containing only pCAL-JUMP29a as a negative control.
(4) The next day, illuminate the colonies with a green laser to see if there is green fluorescence.

Sensitivity analysis of salicylic acid recepter

We use the salicylic acid concentration curve of sfGFP fluorescence intensity to simulate the salicylic acid sensitivity analysis

(1) Co-transform nahR-RhlR-pSC101 and psal-Jump29A into DH5alpha E. coli cells.
(2) Incubate the co-transformed bacteria in LB medium supplemented with various concentrations of salicylic acid at 37°C on a shaker overnight. The gradient of salicylic acid concentrations includes: 1e-6 µM, 2e-6 µM, 4e-6 µM, 8e-6 µM, 1.6e-5 µM, 3.2e-5 µM, 6.4e-5 µM, 1.3e-4 µM, 2.6e-4 µM, 5.1e-4 µM, 1e-3 µM, and 2e-3 µM. Also, include a control group without salicylic acid.
(3) Standardize the OD600 of different groups to 0.5, divide each into three replicates, and then dilute 1:100 into 4 ml of LB medium containing both spectinomycin and kanamycin. Incubate at 37°C on a shaker for induction.
(4) After 15 hours of induction, measure the sfGFP fluorescence intensity of each group using a fluorometer. Set the excitation wavelength at 485 nm and the emission intensity at 535 nm.
(5) Plot the sfGFP fluorescence intensity versus salicylic acid concentration curve based on the experimental data.

Function verification of C4-HSL synthase

(1) Culture the wild-type E.coli K12 and the E.coli K12 which heterogenetically expresses C4-HSL molecules in 100ml LB medium at 37 degrees Celsius and 220rpm until OD600 is approximately 0.6
(2) Add equal volume of ethyl acetate into the fermentation solution and stir them for 40min by magnetic stirrer.
(3) Let the mixture stand for about 1h and use separating funnel to completely separate the organic phase from the water phase.
(4) Use a rotary evaporator to completely evaporated the ethyl acetate in the organic phase at 40 ℃ and 10 kpa.
(5) Add 500μL of methanol to evaporate the dissolved substance
(6) Utilize ESI-MS/MS to obtain the mass spectrum of the final solution.
(7) Compare the mass spectra of wild-type E.Coli and E.coli heterologous expressing AHL molecules, extract the mass graph of m/z=102.055 (which corresponds to m/z of the daughter ions common to AHL molecules) and find out the different peak between two strains. The different peak between two strains’ mass spectras might be the peak of AHL and And it tells you the peak time of the AHL molecule and there may be parent ion peaks of AHL molecules in the mass spectra produced at this time point. According to the structure of AHL molecules, the following calculation formula can be used to find AHL molecules more quickly：
for Cn×2+4-HSL, n = (m/z-1-171)/28
for 3-hydroxyl-Cn×2+4-HSL, n = (m/z-1-187)/28
for 3-oxo-Cn×2+4-HSL, n = (m/z-1-185)/28

Controlled pigment synthesis

Exogenous signal molecules induce pigment synthesis

(1) Culture the strain with P_rhlR-vioC-P_nahR plasmid and double receptor plasmid in LB solution at 37 ℃ and 220rpm overnight
(2) Add 5μl of overnight bacterial solution to two tubes with 5mL LB. Add salicylic acid (final concentration 1x10-5M) to one tube, add salicylic acid (final concentration 1x0-5) and C4-HSL (final concentration 80μM), and culture them for 15 hours.
(3) Take 1ml induced bacterial solution into 1.5ml centrifugation to observe the color of bacterial solution
(4) Centrifuge the bacterial solution at 12000rpm and observe the color of the bacteria

Functional verification of signal transduction

(1) Culture the strain with P_rhlR plasmid and double receptor plasmid, the strain with P_nahR plasmid and double receptor plasmid, the strain with pchBA plasmid, and the strain with pagI plasmid in LB solution at 37 ℃ and 220rpm overnight
(2) pTake 1ul of the bacterial solution containing the pchBA plasmid and point it to the center of the two LB plates. At different distances on the diameter of the two LB plates, point 1ul of the bacterial solution containing the RhlR+PRhlR plasmid and 1ul of the nahR+Psal plasmid. The two LB were incubated overnight in a 37 degree incubator, and then photographs were taken by observing and recording the green fluorescence intensity of the different recipient colonies with a fluorescent stereoscope.Do the same for pagI.

Gene editing efficiency verification

(1) Colony PCR
(2) DNA agarose gel electrophoresis and calculate the area and relative gray of the strip at the correct location for editing efficiency estimation
(3) Pick out right single colonies on plates and add into resistant 5ml medium
(4) Measure the sfGFP fluorescence intensity of each group using a fluorometer. Set the excitation wavelength at 485 nm and the emission intensity at 535 nm.

Toehold switch verification

(1) Strain preparation
The plasmids encoding active enzyme cre and toe switch were co-transformed in E. coli Dh5a,and cultured in LB AGAR plate until single colonies with gene editing activity were separated

(2) bacterial colony separation and keeping
Appropriate amount of bacterial spots were placed on the RNAase free LB plate and then cultured until obvious colony morphology appeared

(3) Clean the brenche
Use 1:10 solid phase RNA enzyme scavenger to wipe the ultra-clean table and the surface of the experimental instrument to keep the experimental environment clean

(4) RNA preparation
Since RNA Oligo is attached to the tube wall as a light dry powder, it is easy to be lost when it is opened. Before opening the tube, it is centrifuged at the speed of 3000-4000 RPM for 1min, and then the tube cover is slowly opened. When dissolving, DEPC water is added and the tube cover is covered, and the tube is dissolved by shaking.

(5) Trigger RNA addition
Calculate the target RNA dosage and dilute RNA stock solution with DEPC water, and tip1ul RNA solution on the surface of the target bacterial colony.

(6) GFP expression test
Culture in 37℃ overnight, and observe morphology and fluorescence degree of bacterial colony under stereofluoroscope

Point Mutation for mutated HYER construction

Kit: Beyotime#D0206S

(1) Reaction system:

(2) Add the reagents in the same order as above into the tube, mix them, then add 1μl BeyoFusion™ DNA Polymerase and mix well

(3) Set the PCR instrument according to the following parameters

Note: The 30sec/kb in the table above indicates that if the plasmid to be mutated is 6kb, then the extension time at 68 ° C is 3 minutes. 60sec/kb has the same meaning.

(4) DpnI digestion: After PCR reaction, 1μl DpnI was added directly into the PCR reaction system, mixed and incubated at 37℃ for 5min. Incubation at 37℃ can be performed on a PCR apparatus or in a water bath

(5) Transformation

qRT-PCR for HYER and sfGFP(readout)

(1) Prepare the bacteria for the test, culture it to logarithmic phase
(2) Add 20ul of the culture solution into 5ml LB(with antibiotic)
(3) After 6h, collect 1ml of the bacteria solution, 12000r 1min, discard the supernatant(the bacteria can be kept in -80℃ fridge for a short while or liquid nitrogen for longer time)
(4) Extract RNA as quickly as possible, we use the kit Tiangen#DP430
(5) Acquire cDNA with the kit Vazyme#R423-01
(6) Carry out qPCR with the kit Vazyme#Q712-02

Point mutation saturated library building

(1) Design point saturation mutation primers
With 151Asp and 187Phe of the enzyme vioE as the preset mutation sites, a saturation point mutation
primer was designed based on the pJUMP29-1A(sfGFP) plasmid:
Mu - F: TCCGAGCACCCTGTATCTGNNKGCAGCGTCCGGCGAACC
Mu - R: CGTTAACGNNKAGCGGCAAACACAGTCCGGGATCTCC

(2) Design skeleton primers
On the basis of ensuring that there are homologous fragments of 15~20bp between skeleton and mutant insert fragment, design skeleton PCR primers as follows:
V-F: GCCGCTAAACGTTAACGGATCC
V-R: CAGATACAGGGTGCTCGGACC

(3) The point mutation fragment and skeleton were obtained by PCR using 2×Phata Mix Taq enzyme, and the DpnI enzyme was added and digested at 37℃ for 1 hour. After the target fragment was extracted by agarose nucleic acid gel electrophoresis, pure single point mutation fragment and skeleton were obtained by using FastPure DNA gel extraction kit.

(4) The ligation was obtained by homologous recombination, and the ligation product plasmid was transformed into DH5α receptor cells.

(5) After a large number of bacterial colonies grow on the petri dishes, wash them with 2ml dd H(2)O and uniformly add them into 1.5ml EP tubes. The plasmid was extracted and sequenced using FastPure plasmid small dose kit (DC201, Vazyme).

vioE enzyme activity measurement module

(1) The obtained point mutation saturated library plasmid was transformed into strain BL21, and the first 44 strains with faster growth rate were selected and placed in 1.5mlEP tube, in which 1mlLB liquid medium containing resistance was added in advance. At the same time, 3 positive control strains were selected and cultured simultaneously.

(2) When the OD600 value of the bacterial solution reaches about 0.2, the OD600 value of the bacterial solution is measured with a 96-well enzyme labeled plate. The bacterial solution with the lowest OD600 value is diluted 1:50 into 15ml shaking tube (5mlLB liquid medium containing resistance has been added to the tube in advance), and the dilution ratio of other strains is adjusted in a linear way according to the OD600 value.

(3) After incubation for 12-13 hours, take 1ml bacterial solution and centrifuge it at 13000rpm for 3min, remove the supernatant, add 150μl methanol, shake well, and incubate at 220rpm at 30℃.

(4) After incubating for 5 to 6 hours, the purple bacillin was basically dissolved in methanol, and centrifuged at 13000rpm for 1min. The OD578 value of the purple bacillin methanol solution was determined by 96-well plate and enzymochromator.

In order to further reduce the experimental error, the above steps are repeated three times.

Overlap PCR for tandem repeats

(1) For primer design, there should be at least a 20bp complementary site at 3’ end of the pair of primer.

Mix materials below together as reaction system of overlap PCR:

(2) Set PCR program as below:

RCA reactions for tandem repeats

1.PCR amplified single copy sequence (with XbaI cleavage site)
2.Run the gel electrophoresis and recovered the DNA fragments
3.Use vazyme T4 ligase was cyclify the digested fragments
4.Use NEB vazymephi29 polymerase for rolling circle amplificatio of the cycled fragment
5.Digest the amplified product for approprite time with vazyme FD XbaI (no thorough digestion)
6.Run the gel electrophoresis and recovered the target DNA fragments

modified bacteria cellulose

1.Conditions：
β-CD：0.8%
CA（sodium citrate）：0.2%
sodium dihydrogen phosphate：0.15%
Temperature: 100℃
Time：45min

2.Steps：
(1)The bacteria cellulose immersed in a bath containing 0.8% β-CD, 0.2% CA, and 0.15% sodium dihydrogen phosphate was cured in 100℃ temperatures for 45 min to graft β-cyclodextrin.
(2) Finally, the modified bacteria cellulose was squeezed and dried at 50°C. The weight percentage is calculated from the weight difference between the ungrafted and grafted fabric.