EXPERIMENTS

"Not all questions are answered,
but fortunately some answers are questioned."

- Terry Pratchett

Content


  1. Introduction
  2. Saccharomyces cerevisiae
  3. OYC Shuttle Vector
  4. Escherichia coli
  5. AFB1 Growth Inhibition
  6. Protocols

Introduction


In order to approach the engineering of our desired biological functions in the laboratory, we made use of well-established and optimized protocols and developed organized experimental workflows to guarantee that our research is effective and reproducible.

The methodology applied involves the assembly and cloning of the desired parts, followed by what our PI Manuel Bernal calls “asking the question”, i.e.: determining whether our organism is performing the function of interest as expected.

Here we describe the experimental designs elaborated for the purpose of our project and gather the protocols applied during the process.

Saccharomyces cerevisiae


To approach the modification of Saccharomyces cerevisiae towards responding to aflatoxin B1 in the laboratory, we organized our goals into the following parallel modules:

Icono Evaluation of the three testing devices

This line of work is aimed to assemble and characterize the main parts of our circuit and gain insights on their individual functionality:

Icono Proof of concept of the genetic circuit

This module is meant to build and implement a first version of the whole circuit to provide knowledge on the integrated behaviour of all components.

Evaluation of the three testing devices

AFB1-dependent dimerization of scFv1 and scFv2

Following synthesis of both transcriptional units, high-fidelity Q5 PCR-amplification is performed to add the corresponding BioBrick prefixes and suffixes to the parts. The required primers are shown in the table below. The two fragments are introduced into YEplac195 by BioBricks ligation and cloned into Escherichia coli. Following purification, the resulting plasmid is transformed to Saccharomyces cerevisiae. mCerulean fluorescence is assessed with increasing concentrations of AFB1.


Primers utilized for addition of BioBrick prefixes and suffixes to both receptor's sequence

F1-scFv Forward atcggaattcgcggccgcttctagactgtctcagttcgagtttatc 46 nt
R1-scFv Reverse atcgctgcagcggccgctactagtcatctcgttcagggtaatatattttaaccgc 55 nt

Experimental workflow to build and test the split-mCerulean-fused AFB1 receptors

Assay procedure

  • 5 mL of YPD are inoculated with Saccharomyces cerevisiae cells transformed with YEplac195+split-mCer plasmid and grown O/N at 30ºC with agitation.
  • The culture is diluted in YPD to a final volume of 50 mL and OD600 of ~0.1, and is grown for about 3-5 hours to an OD600 of ~0.6.
  • A 96-well microplate is prepared by pipetting 200 μL of the grown culture to each of the wells. 22,22 μL of a stock AFB1 solution of 2 μg/mL is pipetted in the first column and decimal serial dilutions are made in the following columns by mixing 9 parts of culture with 1 part of the previous dilution. The last column is left untreated as a control. 7 replicates are made for each final concentration of AFB1, with the last row including culture mixed with the acetonitrile solvent without toxin.
  • The fluorescent intensity is assessed by using BioTek Synergy H1 Multimode Reader. Excitation light is set to 433 nm and fluorescence intensity is measured at 475 nm; a measure is taken every 2 minutes for 30 minutes at 30ºC with 150 rpm orbital agitation.

Detoxification potential of VHH synthetic receptor

A single transcriptional unit expressing the Nb28 VHH is pre-cloned into pJet1.2 using the CloneJet™ PCR Kit from Thermo Fisher. The insert is subsequently transferred to the shuttle plasmid YEplac195 by EcoRI-PstI digestion and ligation. The resulting plasmid is transformed to E. coli and S. cerevisiae after purification.


Overview of the workflow proposed for the building and evaluation of a yeast strain constitutively expressing high-efficiency surface VHHs

Assay procedure

  • 5 mL of YPD are inoculated with Saccharomyces cerevisiae cells transformed with YEplac195+Nb28-Aga2P plasmid and grown O/N at 30ºC with agitation.
  • Overnight culture is diluted to OD600 ~0.1 to a final volume of 2 mL. Six flasks are prepared.
  • The flasks are incubated at 30ºC with agitation until exponential phase is reached, OD600 ~0.4. At this time, the cultures are inoculated with 1 μL of AFB1 serial dilutions, ranging from 2.0 μg/mL to 2.0·10-5 μg/mL.
  • Cultures are incubated for an additional 1 hour.
  • The cultures are transferred to a sterile microcentrifuge tube and cells are pelleted at 3000 g for 5 minutes.
  • Supernatant is transferred to another tube.
  • AFB1 concentration in the supernatants is determined by using Bio-Shield B1 ELISA Test from ProGnosis.

Polycistronic expression of three FPs mediated by IGG6

The tricistronic expression cassette is split in half for synthesis and the two fragments are assembled onto pSEVA281 through Gibson Assembly reaction. Next, cloning to YEplac195 is performed, with final yeast transformation and fluorescence visualization through confocal microscopy.


Workflow proposed for the assembly and qualitative testing of a IGG6-mediated FPs tricistron

Proof of concept of the genetic circuit

The whole circuit is split into 5 fragments of similar length. Fragments 1 and 5, containing E and P restriction sites, respectively, are digested and ligated with an EP-digested YEplac195. The resulting linear fragment is used for a Gibson Assembly reaction together with F3, F4 and F5. Thanks to the homology regions, a vector is assembled containing the whole circuit (PoC). The plasmid is transformed to E. coli and subsequently to S. cerevisiae, with the following assays for both the measurement of reporter fluorescence and AFB1 capture, as described above. In this case, emission and detection wavelengths are set to 584 and 607 nm, respectively, and the assay is performed overnight with measures every 10 minutes.


Workflow designed to assemble and test a first version of the whole genetic circuit

OYC Shuttle Vector


To assemble a yeast episomal (YEp) and integrative (YIp) shuttle plasmid for the team, the following parts were chosen from the Open Yeast Collection (OYC) provided in iGEM Distribution Kit Plate 2:

Parts from the iGEM Distribution Kit Plate 2 chosen for assembly of YEp

Sc2micron ScURA3-marker AConL-start AConR-end OYC-bridge-AGAC-GCAA OYC-CamR
D1 O16 I12 A22 C18 E18

Parts from the iGEM Distribution Kit Plate 2 chosen for assembly of YIp

ScHR5'HO ScURA3-marker AConL-start AConR-end ScHR3'HO oriT OYC-CamR
K14 O16 I12 A22 M14 O24 E18

The parts comprising the transcriptional unit were taken from the ones available in our laboratory, including a constitutive promoter, strong RBS, double terminator and GFP coding sequence. The origin of replication was chosen to be pUC due to the thermo-sensitive nature of the one available in the OYC. It was PCR-amplified from pSEVA181.

All the parts from the OYC were transformed directly from the Kit Plate 2 to NEB® 10β and the plasmids were purified using PureYieldTM Plasmid Miniprep System from Promega. They were verified through BsaI digestion and agarose gel electrophoresis.

Escherichia coli


Despite being left behind along the project, an experimental design was also applied for the modular assembly of EMeRALD based receptors and transcriptional units during the early stages of our project.

The different protein domains conforming the receptors and other genetic elements are synthesized with flanking EcoRI, PstI and BsaI restriction sites. The first ones are leveraged for ple-cloning in pSEVA181, while the second allows for the assembly through Golden Gate of the desired receptors, which can then be stored for downstream uses.


Workflow designed to assemble and test a first version of the whole genetic circuit

AFB1 growth inhibition


We designed an assay to evaluate the inhibition exerted by AFB1 on the growth of the different species utilized in our team, which we were able to perform once AFB1 was delivered to our laboratory.

  • 5 mL of the corresponding medium are inoculated and grown O/N at the adequate conditions. YPD at 30ºC with agitation is used for S. cerevisiae and LB at 37ºC with agitation for E. coli.
  • The culture is diluted with more medium to a final volume of 25-50 mL and grown for about 3-5 hours.
  • A 96-well microplate is prepared by pipetting 200 μL of the grown cultures to each of the wells. 22,22 μL of a stock AFB1 solution of 2 μg/mL is pipetted in the second column and decimal serial dilutions are made in the following columns by mixing 9 parts of culture with 1 part of the previous dilution. The last column is left untreated as a control and the first one harbours sterile LB. 5 replicates are made for each final concentration of AFB1, with the last rows including culture mixed with the acetonitrile solvent without toxin, as well as a control of LB+acetonitrile.
  • Optical density at 600 nm is monitored by BioTek Synergy H1 Multimode Reader every 10 minutes, at the corresponding temperature and agitation, for 24 hours.
  • Data of samples is normalized to the controls and curves are adjusted to a logistic model.

Protocols


Here we list the protocols applied in our laboratory during our project. The procedures for basic molecular biology techniques and Escherichia coli manipulation were taken from the work previously developed in our laboratory as part of the 2022 StarchSTEM project. We also add protocols for Saccharomyces cerevisiae cultivation and transformation.