The mevalonate pathway (MVA) is the first step in the biosynthesis pathway for linalool. The pathway is a series of reactions that produce molecules in many cellular processes and plays an important role in protein signaling and transport. In order to produce linalool, the metabolic flux of the MVA pathway can be regulated. By over-expressing the MVA pathway, the supply of geranyl pyrophosphate (GPP) will increase, which will lead to an increase in the production of linalool (Zhang, Cao, Wang, & Tang, 2022). Linalool is a floral-scented terpene commonly found in lavender, basil, and coriander. It acts as a natural pest repellent while contributing a calming, pleasant floral scent to the compost, which helps mask the less desirable smells associated with the decomposition process (Biome, 2023).

Figure 1: Biosynthesis of Linalool from the Mevalonate Pathway (Agudelo et.al, 2020) ERG20= Farnesyl Diphosphate Synthase; MVD1= mevalonate diphosphate decarboxylase 1; IPP= isopentyl diphosphate; DMAPP=dimethylallyl diphosphate; GPPS= geranyl diphosphate synthase; LIS= linalool synthase

Menthol is a terpene alcohol commonly found in peppermint, spearmint and other plants in the mint family. Menthol can repel insects, rats, mice, and other rodents, species that disrupt the composting process. Studies have shown that menthol successfully deters these species by overwhelming the scent receptors of these animals with an irritating cooling sensation (Müller et.al, 2009). The use of menthol and similar scent molecules in composting is strategic; they act as natural pest deterrents while providing a pleasant aroma, making compost piles less attractive to insects and more tolerable to surrounding environments. Menthol biosynthesis begins with the compound GPP, which undergoes a series of enzymatic reactions, including cyclization, reduction, and hydroxylation, to produce menthol (Croteau et.al 2005). Key enzymes in the menthol pathway include limonene synthase, which converts GPP into limonene, followed by menthone reductase, which eventually leads to menthol formation.

Figure 2: Monoterpoid Synthesis of Menthol (Jones et.al, 2015) IDI = isopentenyl-diphosphate delta-isomerase; GPPS = geranyl diphosphate synthase; LimS = (−)-limonene synthase; L3H = (−)-limonene-3-hydroxylase; CPR = cytochrome P450 reductase; IPDH = (−)-trans-isopiperitenol dehydrogenase; IPR = (−)-isopiperitenone reductase; IPGI = (+)-cis-isopulegone isomerase; PGR = (+)-pulegone reductase; MMR = (−)-menthone:(−)menthol reductase; MNMR = menthone:(+)-neomenthol reductase; MFS = (+)-menthofuran synthesis

Both linalool and menthol synthesis rely on GPP as a precursor, which is linked via the MVA pathway. Linalool synthase catalyzes the reaction of GPP into linalool, while in menthol GPP is catalyzed by limonene synthase into limonene, which undergoes subsequent enzymatic reactions to eventually form menthol.

Our first step in the production of our desired compounds was the MVA pathway. Previous work done by the 2018 GreatBay_China team showed that monoterpene synthesis by E. coli is inhibited by the lack of a viable MVA pathway in E. coli. To supplant this issue, we decided to use pJBEI-6409 (Keasling et al. 2013) which contains an optimized MVA pathway.

Figure 1: PJBEI-6409; Mevalonate Pathway in E.coli

Now that we had a plasmid to produce our precursors, we shifted to the actual production of our compounds, beginning with menthol. Given our background research, we were skeptical about only inserting the native enzymes of the pathway into a plasmid, so we wanted to take some steps to optimize its pathway.

To start all proteins were codon optimized for expression in E. coli. This was done before any other modifications were made to ensure that all other modifications were best designed for E .coli expression.

To start, most monoterpoid synthesis in plants occurs in a specific organelle known as the plastid. To target the synthesis enzymes to the plastid, the native plant sequences contain hydrophobic N-terminal targeting sequences. Our first step was to remove the N-terminal targeting sequence from the limonene-3-hydroxylase and replace it with the N-terminal targeting sequence of the bovine-17a-hydroxylase, a eukaryotic enzyme whose N-terminal sequence has been used to great effect by previous groups (Haudenschild et al. 2002).

The next step was to engineer the Isopulegone-Isomerase. This enzyme is known as the “missing link” in menthol production since it has not been characterized or sequenced (citation). To work around this, we performed a literature review, which suggested that the 3,5 Ketosteroid from P. Putida can act as a viable substitute (Currin et al. 2018). Additionally, we made four single amino acid modifications that had been shown to increase yield; V88I, L99V, V101A, D103S (Currin et al. 2018).

Our final step was to engineer the ribosome binding sites. Previous work has suggested that the best ribosome binding site is sometimes found inside the protein and suggested that optimal expression occurs at certain molar ratios (Currin et al. 2018, Yoshida et al. 2021). Therefore, we used the Salis Lab Ribosome Binding Site Calculator to engineer our proteins with the following predicted translation rates.

Protein	RBS Sequence	Predicted Translation Rate in Arbritary Units
3, 5 Ketosteroid	GGGTTGCAACATACACTTAAGGGTCATTTTC	16,000
Limonene – 3 – Hydroxylase	TATCATCACCAAACACTTCAGTCGGTATTTTT	16,400
Isopipertone Reductase	AAGTTCAGCGTCTCAAGGGGGGGAG	2,400
Pulegone Reductase	CGCCGGACACAAGAGGAAGCAATA	940
Isopipertenol Dehydrogenase	AATTAAGAAGCTGAAGGAGGCAACT	960
Menthone Menthol Reductase	CGGGTCCTAATTCTGTAGGATTTTA	490

Finally, three different “G blocks” were created with two proteins in each. 3,5 Ketosteroid and the Limonene-3-hydroxylase were in G Block 1, G Block 2 consisted of Isopipertone Reductase and Pulegone Reductase and finally G block 3 consisted of Isopipertenol Dehydrogenase. This division was to meet DNA synthesis requirements from IDT. Spacer sequences were then generated using NEBuilder and uploaded to benchling. The plasmid map for our engineered menthol plasmid is below.

Figure 2: Menthol Plasmid in E.coli

Construction of the linalool plasmid was a much simpler path than the menthol plasmid. Since no previous work had been done to produce linalool in E.coli, we codon optimized the linalool synthase from Mentha Citra using the IDT codon optimization tool. Spacer sequences were constructed using NEBuilder.

Figure 3: Linalool Pathway in E.coli

Agudelo, S. C., Álvarez, D. M., Quiñones, C. B., Niño-Bautista, C., & Romero-Cano, L. A. (2020). Strategies for the improvement of linalool production through metabolic engineering: A review. Process Biochemistry, 94, 323–336.

https://doi.org/10.1016/j.procbio.2020.03.005

Croteau, R. B., & Karp, F. (2005). Menthol biosynthesis and molecular genetics. National Center for Biotechnology Information.

https://pubmed.ncbi.nlm.nih.gov/16292524/

Jones, J. A., Vernacchio, V. R., Sinkoe, A. L., Collins, S. M., Ibrahim, M. H., Lachance, D. M., ... & Pfleger, B. F. (2015). Experimental and computational optimization of isopentenol production in Escherichia coli. ACS Synthetic Biology, 5(1), 14–21.

https://doi.org/10.1021/acssynbio.5b00092

Müller, G. C., Junnila, A., Butler, J., Kravchenko, V. D., Revay, E. E., Weiss, R. W., & Schlein, Y. (2010). Efficacy of the botanical repellents geraniol, linalool, and citronella against mosquitoes. Journal of Vector Ecology, 35(2), 363–367.

https://pubmed.ncbi.nlm.nih.gov/20836800/

Biome. (2023, January 29). Natural pest control: How to repel pests using peppermint oil. Biome

https://www.biomestores.com/blogs/clean/natural-pest-control-peppermint-oil

Zhang, Y., Cao, X., Wang, J., & Tang, F. (2022). Enhancement of linalool production in Saccharomyces cerevisiae by utilizing the isopentenol utilization pathway. Microbial Cell Factories, 21(1), 212.

https://doi.org/10.1186/s12934-022-01934-x

Alonso-Gutierrez, J., Chan, R., Batth, T. S., Adams, P. D., Keasling, J. D., Petzold, C. J., & Lee, T. S. (2013). Metabolic engineering of Escherichia coli for limonene and perillyl alcohol production. Metabolic engineering, 19, 33–41.

https://doi.org/10.1016/j.ymben.2013.05.004

Salis, H. M., Mirsky, E. A., & Voigt, C. A. (2009). Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology, 27(10), 946–950.

https://doi.org/10.1038/nbt.1568

Currin, A., Dunstan, M. S., Johannissen, L. O., Hollywood, K. A., Vinaixa, M., Jervis, A. J., Swainston, N., Rattray, N. J. W., Gardiner, J. M., Kell, D. B., Takano, E., Toogood, H. S., & Scrutton, N. S. (2018). Engineering the “Missing Link” in Biosynthetic (−)-Menthol Production: Bacterial Isopulegone Isomerase. ACS Catalysis, 8(3), 2012–2020.

https://doi.org/10.1021/acscatal.7b04115

Yoshida, E., Kojima, M., Suzuki, M., Matsuda, F., Shimbo, K., Onuki, A., Nishio, Y., Usuda, Y., Kondo, A., & Ishii, J. (2021). Increased carvone production in Escherichia coli by balancing limonene conversion enzyme expression via targeted quantification concatamer proteome analysis. Scientific Reports, 11(1), 22126.

https://doi.org/10.1038/s41598-021-01469-y

Reis, A. C., & Salis, H. M. (2020). An Automated Model Test System for Systematic Development and Improvement of Gene Expression Models. ACS Synthetic Biology, 9(11), 3145–3156.

https://doi.org/10.1021/acssynbio.0c00394

Cetnar, D. P., & Salis, H. M. (2021). Systematic Quantification of Sequence and Structural Determinants Controlling mRNA stability in Bacterial Operons. ACS Synthetic Biology, 10(2), 318–332.

https://doi.org/10.1021/acssynbio.0c00471

Espah Borujeni, A., Cetnar, D., Farasat, I., Smith, A., Lundgren, N., & Salis, H. M. (2017). Precise quantification of translation inhibition by mRNA structures that overlap with the ribosomal footprint in N-terminal coding sequences. Nucleic Acids Research, 45(9), 5437–5448.

https://doi.org/10.1093/nar/gkx061

Espah Borujeni, A., Channarasappa, A. S., & Salis, H. M. (2014). Translation rate is controlled by coupled trade-offs between site accessibility, selective RNA unfolding and sliding at upstream standby sites. Nucleic Acids Research, 42(4), 2646–2659.

Espah Borujeni, A., Channarasappa, A. S., & Salis, H. M. (2014). Translation rate is controlled by coupled trade-offs between site accessibility, selective RNA unfolding and sliding at upstream standby sites. Nucleic Acids Research, 42(4), 2646–2659.

Espah Borujeni, A., & Salis, H. M. (2016). Translation Initiation is Controlled by RNA Folding Kinetics via a Ribosome Drafting Mechanism. Journal of the American Chemical Society, 138(22), 7016–7023.

https://doi.org/10.1021/jacs.6b01453

Haudenschild, C., Schalk, M., Karp, F., & Croteau, R. (2000). Functional Expression of Regiospecific Cytochrome P450 Limonene Hydroxylases from Mint (Mentha spp.) in Escherichia coli and Saccharomyces cerevisiae. Archives of Biochemistry and Biophysics, 379(1), 127–136.

https://doi.org/10.1006/abbi.2000.1864