Engineering | Ionis-Paris

Overview

Our project takes inspiration from the natural plant defense mechanisms RNA interference (RNAi) to protect sugar beets against the Beet Yellows Virus (BYV)[1]. We aimed to engineer bacterial strains that produce specific precursors of interfering RNAs, long hairpin RNA (lhRNA) against the BYV. In addition, we wanted to protect our RNAs using the viral capsid of the Tobacco Mosaic Virus (TMV)[2], either directly isolated from the virus or produced by engineered bacteria. The engineering decisions were based on published results and empirical findings derived from our laboratory investigations. Within this segment of Wiki, we explain our choices while engineering our solution.

Therefore, our project involved the use of the DBTL (Design, Build, Test and Learn) principle for four main parts:

Long hairpin RNA (lhRNA) engineering: with the basic parts targeting the phytoene desaturase of sugar beets (BBa_K5055001), the p21 (BBa_K5055002) and the RNA polymerase (BBa_K5055003) of the BYV.
Coat proteins engineering: with the basic (BBa_K5055000) and composite parts (BBa_K5055004) encoding the coat proteins from the TMV.
Coat proteins isolation
Beet Yellows Virus detection

lhRNA engineering

Cycle 1

Design: We selected conserved sequence in the BYV genome to integrate in pET21a(+) backbone containing the T7 promoter and terminator for expression in E. Coli. We designed our sequence on the SnapGene software. We put the conserved sequence identified in one direction after the promoter, then a sequence to form a loop and the conserved sequence in the other direction. In addition, after this sequence, we added the Origin of Assembly Sequence (OAS). This sequence is recognized by the TMV to assemble the capsid around its genome [3]. The designs of our lhRNAs are presented in Figure 1. See more details on this part in the Design page.

Figure 1: Design of the lhRNA sequences. A: lhRNA insert targeting the phytoene desaturase (PDS) of the sugar beet. B: lhRNA insert targeting the p21 of the BYV. C: lhRNA insert targeting the RNA polymerase of the BYV.

Build: Once we designed our lhRNA sequences we ordered them on Twist Bioscience.

Test: When we tested the complexity of our sequences on Twist Bioscience, we saw that it was much higher than the limit accepted to synthesize DNA sequence.

Learn: The complexity of our sequences was too high because DNA manufacturer’s are not able to synthesize DNA sequences with a repeat exceeding 19 base pairs (bp). However, our sequences contained at least 400 bp repeats since they encoded for lhRNA. Therefore, we had to find a solution and decided to order the sense and antisense sequences separatly and ligate them together before inserting them in the chosen backbone.

Click on the arrow at the top to see the next cycle.

Cycle 2

Design: To be able to order our lhRNA sequences, we chose to add the restriction site of NdeI enzyme in the loop sequence. This way, we could have 3 fragments to ligate: the pET21a(+) linearized, the sense sequence of interest with the restriction site of NdeI in 3', and the antisense sequence of interest with the restriction site in 5' and the OAS in 3'. An example is presented in the Figure 2 for the p21 construct.

Figure 2: Design of the p21 targeting lhRNA with the loop containing the NdeI restriction site. A: Sense part of the insert. B: Antisense part of the insert. C: Full insert construction.

Build: Once we received the sequences to insert into the pET21a(+) from Twist, we digested them and ligated the 3 parts together.

Test: To check the construction of our plasmids, we transformed the ligation product in E. Coli DH5a.

Learn: Adding the NedI restriction site in the loop of the lhRNAs and separating the sense and antisense inserts allowed us to order our sequences. However, we did not see any colonies on the plates for the first construction, showing that the plasmid was not constructed as expected. The results of the gel purification of our backbone, before ligation, were not satisfying. Therefore, we decided to try again with a different gel purification method.

Click on the arrow at the top to see the next cycle.

Cycle 3

Design: We performed the same experiment but used another gel purification method to fix our purification since our kit was old.

Build: We purified our digested pET21a(+) using magnetic beads, the yields were much better so we performed the ligation again. We also tested different protocols for the ligation part.

Test: We transformed the product of the ligation in bacteria to check its construction.

Learn: This time again, we saw no colonies on our plates. We think that it was because the quantity of our vector, pET21a(+), was too small in comparison with the quantity of the inserts. This meant that the ligation ratios were not optimal.

Click on the arrow at the top to see the next cycle.

Cycle 4

Design: We tried the constructions again but this time we tested different ratios of backbone and inserts. In addition, we attempted to ligate first the sense and antisense sequences together before the ligation with the backbone.

Build: We performed the different ligations according to our protocol.

Test: We then transformed the products of the ligations to check their construction. When we saw colonies on our plates, we put them to grow in liquid culture and extracted the constructs by MiniPrep. Then, we digested the obtained plasmids and migrated the digestion products by gel electrophoresis. On the gel electrophoresis the observed bands seemed to correspond to the backbone alone, without any insert ligated. See the details results on the Results page.

Learn: Even if we observed colonies this time, the isolated plasmids corresponded only to the pET21a(+) that must have religated with itself during the ligation instead of incroporating the sense and antisense inserts. We suppose that the ligation ratios were still not otpimale so we will need to try different ones again.

Coat proteins engineering

Cycle 1

Design: First, we designed our sequence of capsid protein from the virus Tobacco Mosaic Virus (TMV) on the SnapGene software (see Figure 2). We added the BsaI restriction sites around the coding sequence ends to be able to assemble our plasmid by Golden Gate. We want to express the caspid protein in E. coli to isolate and encapsulate the RNAi precursors with it.

Figure 3: Design of the Tobacco Mosaic Virus coat protein sequence. The overhangs for Golden Gate assembly are represented in blue, and the coding sequence in orange. The orange arrow corresponds to the open reading frame.

Build: Once we received our sequence from Integrated DNA Technologies (IDT), we performed Polymerase Chain Reactions (PCRs) to extract and amplify our fragments of interest: the sequence of the coat protein but also the ones for the promoter, ribosome binding site and terminator we chose.

Test: To check the efficiency of our PCRs before following the experiments, we migrated our PCR products on gel electrophoresis.

Learn: We observed the band that we expected only for the coat protein sequence. For the other sequences to amplify, we did not observe the bands of interest (see in Figure 4). Therefore, we needed to perform our PCRs again but with different annealing temperatures.

Figure 4: 2% agarose electrophoresis gel of the PCR product of the coat protein

Click on the arrow at the top to see the next cycle.

Cycle 2

Design: We calculated again the annealing temperatures of our primers and decided to test different temperatures for each part to amplify. Once we observed our fragments of interest amplified, we assembled them using Golden Gate assembly.

Build: We first performed the PCRs multiple times with different annealing temperatures to try and find the optimal one for each fragment to insert. Then, we purified our fragments of interest from the gel electrophoresis and performed the Golden Gate assembly.

Test: We migrated each time our PCR products on gel electrophoresis to see if the amplification was correctly done or not. The result of the gel electrophoresis are presented in Figure 5. To test the assembly of our construct, we transformed the product of the Golden Gate assembly in E. Coli and grew them on plates containing ampicillin.

Figure 5: 2% agarose electrophoresis gel of the PCR products. A: Gel electrophoresis of the successful Promoter and terminator PCRs. B: Gel electrophoresis of the successful PCR for the RBS.

Learn: We achieved the amplification of all the fragments of interest by modifying the annealing temperatures. We also observed colonies on the plates corresponding to the bacteria transformed with the Golden Gate products.

Coat proteins isolation

Cycle 1

Design: To isolate the coat proteins from the Tobacco Mosaic Virus (TMV) directly we first wanted to amplify our viruses. To do so, the aim was to mechanically inoculate the TMV in the leaves. Then, our goal was to isolate the virus and its proteins.

Build: Once we received the TMV, we inoculated the TMV in the sugar beet leaves using sand or silicon carbide. We then waited two weeks and performed the protein purification as presented in our protocol.

Test: To check the isolation of the coat proteins, we quantified them using BCA assay and performed a SDS-PAGE electrophoresis to see if we got proteins at the expected size of the TMV coat proteins. We did observe a band at around 17.6 kDA.

Learn: We only saw the band ones, and couldn’t replicate the result. We had several hypothesis about this. This could be due to the fact that the virus did not have the time to replicate enough in the plant leaves, creating not enough coat proteins for us to quantify, or that the inoculation did not work. In addition, the protocol to extract the coat proteins could be improved.

Beet Yellows Virus detection

Cycle 1

Design: To detect the BYV, we wanted to perform a quantitative Reverse Transcription Polymerase Chain Reaction (RT qPCR) to measure the quantity of the BYV genome in the sample. We decided to design primers on the RNA-dependent RNA polymerase (RdRp) sequence of the virus since we now it is a highly conserved sequence, the primers are presented in Figure 6. In addition, we designed primers against the mRNA of the actin of Beta vulgaris for the control. Actin being an housekeeping gene, the same quantity of actin mRNA is present in every plants. The primers against actin are also presented in Figure 6 below.

Figure 6: Design of the primers fro the RT qPCR. A: Design and position of the primers against the RNA polymerase of the BYV. B: Design and position of the primers against the messenger RNA of the sugar beet actin.

Build: Once we received the infected sugar beet leaves and the primers we extracted the RNA from our leaves and performed our RT qPCR according to the protocols presented in the Experiments page.

Test: We analyzed the results we obtained and saw that there was an amplification for both the saine and the infected sugar beet leaves with the primers against the BYV RdRp. However, there was a big difference in the CT. Therefore, we could say that we amplified the sequence of interest with our primers, but there was some contamination or off-target effects. In addition, we observed no amplification with the primers against the sugar beet actin.

Learn: To quantify the BYV genome we needed to design new primers and perform the RT qPCR again. However, we still managed to amplify the BYV genome and to detect it.

Click on the arrow at the top to see the next cycle.

Cycle 2

Design: Looking at the literature, we found two genes with the associated primers that are commonly used as housekeeping genes while performing RT qPCR on sugar beets. These genes are the sugar beet elongation factor 1 β and the glyceraldehyde-3-phosphate dehydrogenase [4]. Here are the sequences of our new primers:
BvEF2_E_1 Forward: AGCTGCGAAAATGGTGAAGT
BvEF2_E_1 Reverse: AGCGTTGATTTCCCGTGATC
BvGAPDH Forward: CACCACCGATTACATGACATACA
BvGAPDH Reverse: GGATCTCCTCTGGGTTCCTG

Build: Once we received our new primers, we performed the RT qPCR again, following the protocol presented in the Experiments page.

Test: Too check the detection of the BYV by our RT qPCR, we analyzed the data resulting from it. We observed that, as for the first time, the BYV genome was well amplified. In addition, the results for the housekeeping genes where more convicing than the ones generated with the primers against the actin mRNA of the sugar beet. See more details in the Results page.

Learn: By using different primers for the housekeeping genes, the gene of reference in our experiment, we obtained better results. We were able to detect and quantify relatively the presence of BYV in sugar beets.

References

[1] Dubrovina, A. S. & Kiselev, K. V. Exogenous RNAs for Gene Regulation and Plant Resistance. Int. J. Mol. Sci. 20, 2282 (2019).
[2] Yang, J., Zhang, L., Zhang, C. & Lu, Y. Exploration on the expression and assembly of virus-like particles. Biotechnol. Notes 2, 51–58 (2021).
[3] Saunders, K., Thuenemann, E. C., Peyret, H. & Lomonossoff, G. P. The Tobacco Mosaic Virus Origin of Assembly Sequence is Dispensable for Specific Viral RNA Encapsidation but Necessary for Initiating Assembly at a Single Site. J. Mol. Biol. 434, 167873 (2022).
[4] Wetzel, V., Willems, G., Darracq, A., Galein, Y., Liebe, S. & Varrelmann, M. The Beta vulagris-derived resistance gene Rz2 confers broad-spectrum resistance against soilborne sugar beet-infecting viruses from different families by recognizing triple gene block protein 1. Mol. Plant. Path. 22, 829-842 (2012).