Parts

The Building Blocks of Our Project

Parts

Parts Table

Circuit 2

Name Link Length (bp) Function
RBS BBa_J61100 12 bp Controls the efficiency of translation initiation, which directly affects the rate of protein production in synthetic biology experiments.
LuxI BBa_C0061 643 bp Encodes an enzyme called LuxI, which synthesizes a signaling molecule (acyl-homoserine lactone or AHL) involved in quorum sensing by interacting with the LuxR protein to regulate gene expression in Vibrio fischeri.
Constitutive promoter BBa_J23119 35 bp Used to drive continuous gene expression in various organisms without the need for induction, often employed for benchmarking and tuning expression levels of target genes such as fluorescent proteins or enzymes.A constitutive promoter is continuously active in a cell, regardless of external conditions. Unlike regulatory promoters, which are activated in response to specific stimuli, constitutive promoters drive ongoing transcription of the desired gene without being influenced by transcriptional factors. As an unregulated promoter, it ensures a constant level of gene expression and does not require any external signals to initiate or maintain transcription.
LuxR BBa_C0062 781 bp Encodes the LuxR protein, which binds to the signaling molecule AHL (acyl-homoserine lactone) to regulate gene expression in quorum sensing systems.
Reporter protein (RFP) BBa_E1010 Unknown The biobrick part BBa_E1010 encodes a red fluorescent protein (RFP), which is widely used as a reporter gene in synthetic biology experiments. This part allows for easy visualization of gene expression in E. coli and other organisms, and has been characterized to perform optimally at 37°C and in alkaline environments. It is non-allergenic, shows stability under different pH and temperature conditions, and is frequently used for fluorescence tracking in biological studies.
Inducible promoter (Lux pR) BBa_R0062 55 bp The BBa_R0062 part is a LuxR and HSL-regulated promoter derived from Vibrio fischeri. It is a widely used promoter in quorum sensing circuits. The promoter becomes activated when LuxR forms a complex with the autoinducer HSL (3-oxo-hexanoyl-homoserine lactone). This complex then binds to the palindromic site on the promoter, enhancing transcriptional activity.
Lux A BBa_K1725200 1065 bp Subunit of the luciferase enzyme in the lux operon, involved in bioluminescence.
Lux B BBa_K216000 990 bp Another subunit of the luciferase enzyme, necessary for bioluminescence in conjunction with Lux A.
EL Linker BBa_K5394226 42 bp A flexible amino acid sequence that connects protein domains without disrupting their functions.
cp157 Venus BBa_K5394227 735 bp Fusion of cp157 (a functional domain) and Venus (a yellow fluorescent protein), used as a fluorescent marker.
LuxB: cp157 Venus BBa_K5394228 1767 bp A fusion protein combining Lux B (bioluminescence) and cp157 Venus (fluorescence), for both light production and fluorescent tracking.
Terminator BBa_B0010 80 bp The BBa_B0010 part is a transcriptional terminator derived from the Escherichia coli rrnB gene, specifically the T1 terminator region. This terminator consists of a 64 bp stem-loop structure and is highly efficient in terminating transcription in both in vivo and in vitro systems. It has been widely used as a reliable component for terminating transcription in synthetic biology applications.
Signal Peptide BBa_K4952001 69 bp (Does not show up)
His-tag (degradation) catcaccatcaccatcactaataa 24 bp Helps conduct protein purification.

Circuit 1

Name Link Length (bp) Function
Fusaric acid induced promoter Part:BBa_K216000 1207 bp The fusaric acid induced promoter (FAiP), BBa_K1493000, is derived from the efflux pump operon found in Pseudomonas putida. This operon is responsible for expelling fusaric acid from the cell, a mechanism controlled by the pp1262 gene, which encodes a LysR-type transcriptional regulator. In normal conditions, pp1262 represses the operon by preventing RNA polymerase from binding to the promoter, but in the presence of fusaric acid, this repression is lifted, allowing transcription to occur.
Quorum sensing promoter Part:BBa_K216000 55 bp The LuxR-HSL regulated promoter (lux pR) is an inducible promoter that is part of the quorum sensing system in Vibrio fischeri. An inducible promoter activates gene expression in response to specific stimuli, such as chemical agents, temperature, mechanical injury, or light. Once activated, it binds to RNA polymerase and transcription factors to initiate transcription. These promoters ensure controlled gene expression, only triggering transcription when the appropriate stimulus is present. This promoter is regulated by the LuxR protein in combination with the autoinducer homoserine lactone (HSL). Specifically, LuxR, in the presence of the signaling molecule 3-oxo-hexanoyl-homoserine lactone (HSL)