| Name |
Link |
Length (bp) |
Function |
| RBS |
BBa_J61100 |
12 bp |
Controls the efficiency of translation initiation, which directly affects the rate of protein production in synthetic biology experiments. |
| LuxI |
BBa_C0061 |
643 bp |
Encodes an enzyme called LuxI, which synthesizes a signaling molecule (acyl-homoserine lactone or AHL) involved in quorum sensing by interacting with the LuxR protein to regulate gene expression in Vibrio fischeri. |
| Constitutive promoter |
BBa_J23119 |
35 bp |
Used to drive continuous gene expression in various organisms without the need for induction, often employed for benchmarking and tuning expression levels of target genes such as fluorescent proteins or enzymes.A constitutive promoter is continuously active in a cell, regardless of external conditions. Unlike regulatory promoters, which are activated in response to specific stimuli, constitutive promoters drive ongoing transcription of the desired gene without being influenced by transcriptional factors. As an unregulated promoter, it ensures a constant level of gene expression and does not require any external signals to initiate or maintain transcription. |
| LuxR |
BBa_C0062 |
781 bp |
Encodes the LuxR protein, which binds to the signaling molecule AHL (acyl-homoserine lactone) to regulate gene expression in quorum sensing systems. |
| Reporter protein (RFP) |
BBa_E1010 |
Unknown |
The biobrick part BBa_E1010 encodes a red fluorescent protein (RFP), which is widely used as a reporter gene in synthetic biology experiments. This part allows for easy visualization of gene expression in E. coli and other organisms, and has been characterized to perform optimally at 37°C and in alkaline environments. It is non-allergenic, shows stability under different pH and temperature conditions, and is frequently used for fluorescence tracking in biological studies. |
| Inducible promoter (Lux pR) |
BBa_R0062 |
55 bp |
The BBa_R0062 part is a LuxR and HSL-regulated promoter derived from Vibrio fischeri. It is a widely used promoter in quorum sensing circuits. The promoter becomes activated when LuxR forms a complex with the autoinducer HSL (3-oxo-hexanoyl-homoserine lactone). This complex then binds to the palindromic site on the promoter, enhancing transcriptional activity. |
| Lux A |
BBa_K1725200 |
1065 bp |
Subunit of the luciferase enzyme in the lux operon, involved in bioluminescence. |
| Lux B |
BBa_K216000 |
990 bp |
Another subunit of the luciferase enzyme, necessary for bioluminescence in conjunction with Lux A. |
| EL Linker |
BBa_K5394226 |
42 bp |
A flexible amino acid sequence that connects protein domains without disrupting their functions. |
| cp157 Venus |
BBa_K5394227 |
735 bp |
Fusion of cp157 (a functional domain) and Venus (a yellow fluorescent protein), used as a fluorescent marker. |
| LuxB: cp157 Venus |
BBa_K5394228 |
1767 bp |
A fusion protein combining Lux B (bioluminescence) and cp157 Venus (fluorescence), for both light production and fluorescent tracking. |
| Terminator |
BBa_B0010 |
80 bp |
The BBa_B0010 part is a transcriptional terminator derived from the Escherichia coli rrnB gene, specifically the T1 terminator region. This terminator consists of a 64 bp stem-loop structure and is highly efficient in terminating transcription in both in vivo and in vitro systems. It has been widely used as a reliable component for terminating transcription in synthetic biology applications. |
| Signal Peptide |
BBa_K4952001 |
69 bp |
(Does not show up) |
| His-tag (degradation) |
catcaccatcaccatcactaataa |
24 bp |
Helps conduct protein purification. |