• Inducing doubling

Date: February 2022

Using diploid cultivated rice (O.sativa SSP) (hybrid rice of indica (2n=24) and japonica (2n=24)) as materials, the callus tissue of rice seeds was treated with a 0.05% colchicine aqueous solution at 28 ℃ for 48 hours.
The culture medium used for doubling rice:
Induction medium: N6 contains 50ml of Cacl2+50ml of N6 without Cacl2+0.5g/L of organic trace iron salts+2,4-D 2mg/L, IAA+6-BA+20g of sucrose+8g of agar powder, distilled water to a volume of 1L, adjusted pH=5.8;
Rice doubling solution: N6 with 50ml Cacl2+N6 without 50ml Cacl2+0.5g/L organic trace iron salt+0.05% colchicine+30g sucrose, distilled water to a volume of 1L, adjusted pH=5.8;
Differentiation medium: MS+organic trace iron salt 0.8mg/L sorbitol 30g/L+L-proline 0.6mg/L+sucrose 30g/L+KT 2mg/L+NAA 0.2mg/L+phytogel 3.5g/L, pH=5.8;
Rooting medium: MS+6-BA (0.5mg/L) 3ml+NAA (0.3mg/L) 600 μ l+C powder 0.2g/L+organic trace iron salt+sucrose 20g/L+agar powder 8g/L;
Gene editing vector transformation medium formula:
Ym liquid medium: 2g/L glutamine+10g/L mannitol+2g/L inositol+300mg/L acid hydrolyzed casein+50mg/LAS+10g/L agar powder+2mg/L 2,4-D, pH=5.8;
Co culture medium: N6+2g/L inositol+300mg/L acid hydrolyzed casein+2,4-D2mg/L+50mg/LAS+10g/L agar powder, pH=5.8;
Screening medium: N6+2,4-D 2mg/L+plant gel 3g/L+sucrose 30g/L+100mg/L hygromycin, PH=7.8

• Tetraploid identification

Date: June 2022

Our team conducted a tetraploid identification experiment, which is a key biological research method that includes two key steps: root tip chromosome observation and ploidy analysis.
Firstly, during the sample preparation stage, select plants that grow well and cut approximately 12 centimeters of root tips. Then, place the root tip in fixative for 24 hours to maintain the integrity of the cell structure. Next, wash the root tips multiple times with distilled water to remove any residual fixative. During the enzyme treatment stage, place the root tip in an enzyme solution and incubate at 37 ℃ for 12 hours to soften the cell wall. Subsequently, the processed root tips were placed on microscope slides, gently cut and torn open to obtain a monolayer of cells. Stain the cells with staining solution for 10-15 minutes to facilitate chromosome observation. Finally, observe the stained chromosomes under a microscope and record the number of chromosomes observed.
In the ploidy analysis stage, root tip cells or leaf cells are first taken and prepared into a uniformly dispersed suspension. Then, the cell suspension was analyzed using a ploidy analyzer. The instrument irradiates cells with laser and detects the fluorescence intensity of DNA in the cells. Collect data and analyze the fluorescence intensity of cells to determine their ploidy, such as diploid, tetraploid, etc. Based on the results of flow cytometry, draw a histogram or scatter plot to calculate the proportion of cells with different ploidy levels.
In order to improve breeding efficiency, we repeated the key steps of chromosome doubling and polyploid identification in our experiment. The tetraploid materials required for the next step of the experiment were directly selected from the PMeS strain reserve of our polyploid rice research group.
The research group used excellent diploid indica japonica hybrid rice as the basic material, and obtained a large number of tetraploid lines through breeding methods such as doubling, hybridization, and backcrossing. The PMeS line was screened, and the breeding process included seven steps: parent selection, hybridization or compound hybridization, continuous backcrossing, chromosome doubling, polyploid identification, seed setting selection, and self stable finished lines. Both diploid and tetraploid require 48 generations of self pollination, and the ear bagging method is used to prevent cross pollination and obtain genotype stable paired materials.

• Changes of total protein, glutelin, globulin, amino acid content and aleurone layer thickness after doubling

1. Detection of total protein content in diploid and tetraploid rice seeds

Method and Process: The detection of total protein content was carried out using the Kjeldahl method, with reference to the national standard (GB2905-82). The harvested rice seed materials in pairs are dried and hulled, and the brown rice is grinded with a swinging flour beater. The Rice noodles passes through a 270 mesh round hole sieve. The sample is kept at room temperature to balance the moisture for 24 hours, and dried in an oven at 60 ℃ for 48 hours; Weigh three 0.1g samples into the digestive tract, accurate to 0.0001g, and slowly dissolve them by adding 12mL of concentrated sulfuric acid, 0.2g of CuSO4, and 6g of K2SO4; Vacuum for 5 minutes, digest for 1 hour, and the sample appears as a blue-green liquid; Cool to room temperature and load the sample to FOSS automatic Kjeldahl nitrogen analyzer to measure the nitrogen content in Rice noodles and convert it into total protein content; The measured data was processed using EXCEL and SPSS.

2. Detecting the content of globulin in rice seeds

Dry and shell the harvested paired rice seed materials, grind them into powder, and collect the powder through a 270 mesh sieve; Weigh 0.1g of powder and add 1ml of globulin extract (0.5M NaCl, 50mM Tris HCl, pH 6.8) in a mass to volume ratio of 1:10, shake well, and treat at room temperature for 2 hours on a shaker at 280rpm; Collect the extract by centrifugation at 12000 rpm for 20 minutes at 4 ℃, and precipitate it for the next step of alcohol soluble protein extraction. Store the extract at -20 ℃ for content determination using the Bradford method. Purchase Bradford Protein Assay Kit (Sigma Aldrich, St. Louis, MO, USA), draw a standard curve according to the instructions, and detect the content of globulin in the sample.

3. Detecting the content of soluble proteins in rice seeds

Collect the precipitate from the previous step, wash the precipitate with 1ml of ddH2O, shake and mix well, centrifuge at 4 ℃ and 12000rmp for 20 minutes to collect the precipitate; After repeating three times, add 1ml of alcohol soluble protein extract (70% ethanol), shake well, and treat with a shaking table at 280rpm for 2 hours; At 4 ℃, 12000rmp centrifugation for 20min was used to collect the extract, precipitate for the next step of glutelin extraction, and store the extract at -20 ℃ for Bradford method to determine the content.

4. Detecting Grain Protein Content in Rice Seeds

Dry and shell the harvested paired rice seed materials, and grind the brown rice into powder using a swing type pulverizer. The screened Rice noodles was sent for inspection, and the amino acid content was detected by the amino acid automatic analyzer, referring to the national standard (GB 5009.124-2016). The obtained data was processed using EXCEL and SPSS.

5. Detecting changes in the thickness of rice seed endosperm layer cells

Using rice seed HWC-4x as the research object and its corresponding diploid HWC-2x as the control, the cellular morphology of polyploid rice seeds was studied. Fix rice seeds developed to 17DAF with 2.5% glutaraldehyde, cut them horizontally to a thickness of 1mm-2mm, and then perform a series of dehydration treatments. Embed them in LR white and cut thin slices with a thickness of 1 μ m. Use methylene blue, PAS shiff's reagent, and Coomassie Brilliant Blue (CBB) double staining for observation. And the seeds that developed to 17 and 25 DAF were observed by scanning electron microscopy and transmission electron microscopy.

• Constructing CRISPR vectors

Time: (Two CRISPR vector constructions with different target genes were carried out, and the construction method and design were exactly the same except for adding one target gene.)
The first round of targeted OsGluB1 gene vector construction will be carried out in June 2022
The second round of targeted OsGluB1/OsGlb dual gene vector construction will be carried out in December 2023
The carrier skeleton and construction method were donated and authorized for use by Liu Guangyao's research group at South China Agricultural University

1. Strain activation and plasmid extraction preparation: pYLCRISPR/Cas9 strain (TOP10F ') and CRISPR/sgRNA vectors strain (DH10B) were streaked and cultured overnight in agar containing kanamycin (25 μ g/ml) and ampicillin (50 μ g/ml), respectively. Single colonies were selected and cultured with 1ml of seed solution, and then expanded for plasmid extraction. Cut~150ng plasmid with 2-3U Bsa I (10 μ l reaction), and check by electrophoresis whether a 690bp ccdB band is cut (the uncut 80ng plasmid is used as the control).

2. Design of target site sequence and corresponding PCR sequencing primers (5 '→ 3'): First round: OsGluB1 GGTAAGTCGCAGGGCAACC (Pr-CGGAAAGTGAGGTCAGAAGC,Pl-GAGAAGATGTTTGCTGTCGTTC) Second round:

OsGluB1
GGTAAGTCGCAGGGCAACC
(Pr-CGGAAAGTGAGGTCAGAAGC,
Pl-GAGAAGATGTTTGCTGTCGTTC)
OsGlb
TCGTCGTCGGAGTACTACGG
(Pr-TGGCTAGCAAGGTCGTCTTC,
Pl-ATGCAACGAGATAGTGATCAAAACA)
3. Preparation of target adapter: Dissolve the adapter primer TE into 100 μ M mother liquor, take 1 μ l each and add it to 98 μ l of 0.5x TE, mix and dilute to 1 μ M. Approximately 90 ℃ for 30 seconds, then move to room temperature and cool to complete annealing.

4. SgRNA vector enzyme digestion: Take 1 μ g of pYLgRNA-OsU3/LacZ and other plasmids, react with 10 U Bsa I enzyme at 25 μ l for 20 minutes, and store frozen.

5. SgRNA expression cassette ligation reaction: Enzyme cleaved plasmids such as pYLgRNA-OsU3/LacZ are ligated to their corresponding adapters

Component Addition amount Final concentration (quantity)
10×T4 DNA ligase Buffer 1 μl 1×
PYLsgRNA-U # plasmid 0.5 μl 10~20 ng
Connector 0.5 μl 0.05 μM
T4 DNA ligase (Takara) 0.05 μl ∼18 U
ddH2O Make up to 10 μl  

Connect at room temperature (20-28 ℃) for about 10-15 minutes

6. First round amplification: Each sgRNA expression cassette is divided into 2 PCR reactions, each with 15 μ l of reaction system: take 0.5 μ l of the ligation product as a template, use the U-F/adapter reverse primer (reaction 1) and adapter forward primer/gR-R (reaction 2) on page 6, each with 0.2 μ M, and an appropriate amount of high fidelity PCR enzyme. 25-28 cycles: 10 seconds at 94 ℃, 15 seconds at 60 ℃, and 20 seconds at 68 ℃. Take 4 μ l of electrophoresis (reaction 2 product length of approximately 140 bp, using 2% agarose gel). If the amplification product is weak, the second round of PCR can also be continued.

7. Second round PCR:
Mix the position specific primer pairs into 10 x working solution, each with 1.5 μ M, as described for the following universal primers:
Primer combination
1 target: PT1R;
2 targets: PT1, PT2R;
Three targets: PT1, PT2, PT3R;
4 targets: PT1, PT2, PT3, PT4R;
5 targets: PT1, PT2, PT3, PT4, PT5R;
6 targets: PT1, PT2, PT3, PT4, PT5, PT6R;
7 targets: PT1, PT2, PT3, PT4, PT5, PT6, PT7R;
8 targets: PT1, PT2, PT3, PT4, PT5, PT6, PT7, PT8R
Take 1 μ l of the first round PCR product and dilute it 10 times with H2O. Mix 1 μ l of each product as a template. 20-50 μ l PCR for each expression cassette (50 μ l for 1 target; 30 μ l for 2-3 targets; 20 μ l for 4 or more targets). Add 1/10 of each primer combination working solution (final concentration 0.15 μ M). Use an appropriate amount of KOD Plus or other high fidelity PCR enzymes.

Amplification cycle 17-20 (adjusted according to actual conditions): 10 seconds at 95 ℃, 15 seconds at 58 ℃, and 20 seconds at 68 ℃.

Take 2-3 μ l of electrophoresis to check if the product length matches (Note 1), and estimate the approximate concentration of the sample.

1st PCR
Position Primer Sequence (5’--3’)
U-F CTCCGTTTTACCTGTGGAATCG
gR-R CGGAGGAAAATTCCATCCAC
2nd PCR
Site B-L

Site 2
Pps-GGL FTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG
gs-GG2 AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC
Site 2

Site 3
Pps-GG2 FTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG
Pgs-GG3 AGCGTGggtctcGtcttcacTCCATCCACTCCAAGCTC
Site 3

Site 4
Pps-GG3 FTCAGAggtctcTaagacttTGGAATCGGCAGCAAAGG
Pgs-GG4 AGCGTGggtctcGagtccttTCCATCCACTCCAAGCTC
Site 4

Site 5
Pps-GG4 FTCAGAggtctcTgactacaTGGAATCGGCAGCAAAGG
Pgs-GG5 AGCGTGggtctcGgtccacaTCCATCCACTCCAAGCTC
Site 5

Site 6
Pps-GG5 FTCAGAggtctcTggactagTGGAATCGGCAGCAAAGG
Pgs-GG6 AGCGTGggtctcGcagatagTCCATCCACTCCAAGCTC
Site 6

Site 7
Pps-GG6 FTCAGAggtctcTtctgcaaTGGAATCGGCAGCAAAGG
Pgs-GG7 AGCGTGggtctcGacctcaaTCCATCCACTCCAAGCTC
Site 7

Site 8
Pps-GG7 FTCAGAggtctcTaggtttcTGGAATCGGCAGCAAAGG
Pgs-GG8 AGCGTGggtctcGagcgttcTCCATCCACTCCAAGCTC
Site 8

Site B-R
Pps-GG8 FTCAGAggtctcTcgctgatTGGAATCGGCAGCAAAGG
Pgs-GGR AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC
Flanking PB-L GCGCGCgGTctcGCTCGACTAGTATGG
Primers PB-R GCGCGCggtctcTACCGACGCGTATCC

8. Based on the estimated amount of each sample product, mix approximately equal amounts of all products, extract with phenol and precipitate with ethanol, or purify with PCR product purification kit.

9. Take 2-5 ng pYLgRNA OsU # plasmid as a template and use four primers in one reaction: U-F and gR-0.2 μ M each, U # T # - and gRT #+(Table S2) 0.1 μ M each. 25-28 cycles: 10 seconds at 94 ℃, 15 seconds at 58 ℃, and 20 seconds at 68 ℃. During the amplification process, in the first few cycles, U-F/U # T # - expands the U # - T # sequence, and gR/gRT #+expands the T # - sgRNA sequence. In the later stage of the cycle, overlapping PCR is used to generate two merged sgRNA expression cassette fragments.

10. Dilute 1 μ l of the first round PCR product 10 times with H2O, take 1 μ l as the template, and perform the second round PCR according to step 6 above.

11. Enzyme digestion ligation reaction between binary vector and sgRNA expression cassette

Reagent Addition amount (μl) Final concentration
10×CutSmart Buffer 1.5 1×
10 mM ATP 1.5 1 mM
PYLCRISPR/Cas9 plasmid 60-80 ng 4-6 ng/μl
SgRNA expression cassette mixture 10-15 ng per expression box  
Bsa I-HF 10 U 0.1-0.2 U/μl
T4 DNA ligase H2O to final 15 μl 2-3 U/μl

12. Connection product conversion (electric stimulation method): Drop the connection product onto a suspended dialysis membrane Millipore VSWP04700 (0.025 μ m pore size) for dialysis desalination of 0.2 x TE for 15-30 minutes (preferably in a 4 ℃ freezer). Take 1-1.5 μ l of the connected product for electrical conversion E Coli DH10B competent cells (Note 2) were cultured at 37 ℃ for 1-1.5 hours with 1 ml SOC added after electrical stimulation. The coated culture medium is LB+25 μ g/ml Kan, 0.3-0.5 mM IPTG (Note 3), and an appropriate amount of X-gal. IPTG induced lethal expression of ccdBs in empty vector transformants without complete removal of ccdBs. Positive clones containing the target insertion sequence (LacZ OsU3 gRNA expression cassette) were expressed by LacZs and produced blue plaques

13. Extract plasmids and detect sgRNA expression cassette linked fragments by Mlu I or Asc I enzyme digestion electrophoresis. If the following steps of sequencing are performed, PCR detection may not be necessary. Take a small amount (1-3 ng) of plasmid as a template and perform PCR detection on all targets (also use empty plasmids as negative controls). The primer pairing form is: SP-DL primer paired with the first target adapter reverse primer; Pair the first target adapter forward primer with the second target adapter reverse primer; Pair the forward adapter primer for the second target with the reverse adapter primer for the third target; Pair the forward primer of the third target adapter with the reverse primer of the fourth target adapter Similarly, in the end, the target forward adapter primer is paired with the SP-R primer. In this way, the forward and backward directions of each target have been detected once. Perform electrophoresis to confirm if its size meets expectations.

14. Sequencing detection (if confirmed in step 13, this sequencing can be skipped): Using the specificity of each target primer, sequence specific targets as shown in the following figure.

15. Import Agrobacterium. Obtained cloned Agrobacterium tumefaciens (EHA105). Stability testing of Agrobacterium tumefaciens (optional): Extract plasmids from Agrobacterium tumefaciens (the quality of plasmids extracted from Agrobacterium tumefaciens is poor and only suitable for PCR), take about 2-5 ng of plasmids as templates, and then pair all target adapter forward and reverse primers for PCR confirmation.

16. The positive Agrobacterium obtained can be used to infect plant tissues.

17. Testing the targeting effect of gene edited T0 plants: Successfully targeted transformants often produce single base insertions or deletions of several bases at the target site. Synthesize primers for PCR amplification with the target as the center, approximately 200-300 bp apart on each side. Key point: Design internal primers as sequencing primers approximately 150-250bp upstream of the target (this distance provides the best sequencing quality, but should not be less than 100bp or greater than 400bp), and directly sequence the PCR product (do not use primers that have been amplified by PCR for sequencing again, as it will produce high-level mixed signals). If there are overlapping peaks after a certain base, it indicates heterozygous or biallelic mutations, which can be based on Ma et al., 2015 (Mol. Plant 2015, DOI: http://dx.doi.org/10.1016/j.molp.2015.02.012 )The Web Program DSDecode for DSD Method( http://dsdecode.scgene.com/ )Perform decoding; If there are no overlapping peaks in the sequencing peak map, it can also be determined as wild-type or homozygous mutation using DSDecoder.

• Transforming Agrobacterium

Time:
Transformation of OsGluB1 gene vector targeting in November 2022
Transformation of OsGluB1/OsGlb dual gene vector targeting in February 2024

1. Strain recovery: Resuscitate frozen Agrobacterium strains in a suitable culture medium and shake overnight at 37 ° C

2. Plasmid preparation: extract the plasmid DNA containing the target gene, and verify its size and purity through gel electrophoresis

3. Agrobacterium culture: Take overnight cultured Agrobacterium and continue to culture until a certain value is reached

4. Chemical conversion preparation: Centrifuge and collect the cultured Agrobacterium, resuspend it in calcium chloride solution, and adjust it to the appropriate concentration

5. Mixing plasmid DNA with Agrobacterium: Mix the two together and gently shake well

6. Heat shock treatment: Heat shock the mixture at 42 ℃ for 2 minutes, then quickly cool it on ice for 5 minutes.

7. Recovery culture: Add the mixture after heat shock to LB medium containing antibiotics, shake at 37 ℃ for 2-3 hours to restore the growth of Agrobacterium.

8. Conversion efficiency testing: Take a portion of the culture medium and coat it on LB plates containing kanamycin and rifampicin, respectively, to screen for transformants.

9. Screening and validation: Select monoclonal colonies for PCR validation to confirm whether the target gene has been successfully integrated into Agrobacterium.

10. Save and record: Store the successfully transformed Agrobacterium strains at -80 ℃ and record experimental data and results.

• Cultivation of callus tissue - Agrobacterium transformation

Time: Infection of callus tissue with Agrobacterium carrying targeted OsGluB1 gene vector in November 2022
Infection of callus tissue by Agrobacterium targeting OsGluB1/OsGlb dual gene vector in February 2024

Remove the husks from rice seeds and inoculate them on N6 medium containing 2mg/L ABA and 2mg/L 2,4-D for about 20 days in the dark at 27 ℃. Cut the callus tissue for Agrobacterium transformation. Inoculate Agrobacterium tumefaciens EHA105 containing plasmid pC19ZK into YEP liquid medium (containing 100mg/L Kan and 25mg/L rifampicin) and shake at 28 ° C until 0 ∙ 8-0 ∙ 9/OD600 is collected. Dilute appropriately with N6 liquid medium containing 10g/L glucose, 100 μ mol/L As, and 2mg/L 2,4-D for later use. Place the callus blocks into the aforementioned dilution solution, soak for 10 minutes, then remove and dry them using sterile filter paper. Incubate them in a solid co culture medium (with the same composition as N6 liquid medium) in the dark for 48 hours. Wash the callus tissue with a 0.1 mol/L mannitol solution until the cleaning solution is clear, discard the supernatant and transfer it to a solution containing 500mg/L cephalosporin and 200mg/L carbenicillin for shaking and sterilization for 4-5 hours. Use sterile filter paper to absorb and dry the callus tissue blocks. Transfer the callus tissue blocks to N6 medium containing 500mg/L cephalosporin, 100mg/L G418, and 2mg/L L24-D for 14 days of screening and subculture. After about 45 days of screening, transfer the well grown callus tissue blocks to MS medium containing 2mg/L 6-BA, 0.2 mg/L NAA, 0.2 mg/L Zeatin, and 500mg/L cephalosporin for differentiation under light. Transfer the seedlings to 1/2MS medium containing 100 mg/L G418 and 1 mg/L paclobutrazol for further cultivation when they are 1-2cm tall; Transplant to the greenhouse when the seedling height is 7-15cm. (The above culture media all contain 30g/L sucrose, and except for liquid culture media, they are all added with 2.5-3g/L phytogel)

• Identification of gene edited positive plants

time: (The methods and steps for two rounds of identification are exactly the same)First round: Identification of OsGluB1 gene mutation positive plants in December 2022Second round: Identification of OsGluB1/OsGlb dual gene mutation positive plants in May 2024

→ 1. Screening and identification of resistance genes in gene edited plants

Extract gene edited and wild-type plant leaf genomic DNA using CTAB method, and use it as a template for PCR detection. There are mainly two methods for detecting positive plants. Firstly, specific primers are designed based on the hygromycin resistance gene
The product was detected by 1% agarose gel electrophoresis, and specific bands of about 600bp to 700bp were amplified, and the positive plants were preliminarily screened; Then sequence and detect the target site sequences of the screened strains.

→ 2. Detection of target site mutations in gene edited plants

Design a pair of specific primers at both ends of the knockout target site sequence based on the nucleotide sequence of the target gene, and amplify the genome sequence containing the target site through PCR. Take the preliminarily screened genes containing hygromycin resistance genes to edit the plant genomic DNA, and use this as a template, respectively use gene location primers to amplify the PCR fragments. The amplification system and procedures refer to the above methods. The 1% agarose gel electrophoresis detection products are sent to Wuhan Biotech for sequencing. Comparing the sequencing results with the original sequence on the reference genome, the phenomenon of overlapping double peaks in sequencing can be decoded and analyzed using the online tool DSDecode to determine the type of mutation (synonym or missense or nonsense or code shift). There may be three types of wild type, mutant homozygote and mutant heterozygote, and the mutant homozygote can be screened out.

• Determination of Total Protein Content in Rice Seeds with Two Types of Mutations

Time: (The detection methods and steps used for both measurements are the same) In November 2023, determine the content of total protein, glutelin and globulin in tetraploid rice with OsGluB1 single gene mutation
In September 2024, determine the content of total protein, glutelin and globulin in tetraploid rice with OsGluB1/OsGlb double gene mutation

→ 1. Extraction of Total Protein from Brown Rice

Dry and shell fresh rice seeds, grind brown rice into powder using a swing type pulverizer, and sieve through a 270 mesh circular sieve; Weigh 0.1g of powder, accurate to 0.0001g, and add 1ml of whole protein extract (4% SDS, 8Murea, 20% glycerol, 5% 2-mercaptoethanol, 250mM Tris HCl, pH 6.8) in a mass to volume ratio of 1:10. Shake and mix well at room temperature using a shaker at 280rpm overnight; Collect the extract by centrifugation at 12000 rpm for 20 minutes at 4 ℃, and store it at -20 ℃ for SDS-PAGE analysis.

→ 2. SDS-PAGE protein separation

According to the molecular weight of the protein studied (10-57kDa), 4-20% pre made gradient gel was selected for SDS-PAGE electrophoresis analysis of the extracted total protein from rice grains; Place the pre made gel in the electrophoresis tank, add protein electrophoresis buffer, and vertically remove the comb. The buffer should not pass through the sample well; Mix the sample with 5 * loading buffer at a ratio of 5:1 and place it in a 100 ℃ metal water bath for 10 minutes to completely denature the protein. After cooling, take 10 μ L of protein sample and load it into the loading well; After the sample is loaded, adjust the voltage directly to 120V and electrophorese for about 1 hour until the electrophoresis band approaches the bottom and stops; After electrophoresis, take out the gel plate, place it in Coomassie staining solution (250mL methanol, 100mL glacial acetic acid, Coomassie brilliant blue R/G-2501g, ddH2O 1L) for 2h, add decolorizing solution (250mL methanol, 100mL glacial acetic acid, ddH2O 1L) for 5 times, and decolorize for at least 30min each time until the completion of decolorization, so that protein bands can be observed well; Use ImageJ software to scan and analyze the grayscale of the bands, and determine the accumulation of each component protein.

• Three methods for detecting amino acid content in mutant strains

The following three rounds of amino acid content detection steps and methods are completely the same
Determination of Amino Acid Content in Wild Type Tetraploid Rice Seeds in October 2022
Determination of the content of OsGluB1 single gene mutant tetraploid rice seeds in November 2023
Determination of amino acid content in OsGluB1/OsGlb double gene mutant tetraploid rice seeds in September 2024