banner

Thermosensor

Thermosensor

Thermosensor

Thermosensor

Scroll down

Overview ​

Due to the need for thermosensors with varying activation thresholds, we designed and tested a set of thermosensors. The following content explains the guiding concept behind our design and presents the results of the related characterization.

Design of RNA Thermosensors ​

Our thermosensor design was inspired by the JilinU_China 2018 iGEM team. We incorporated a stem-loop structure and an RNase III cleavage site (RC), which cleaves double-stranded RNA within stem loops. At lower temperatures, the mRNA stem-loop is stabilized, exposing the RNase III cleavage site and leading to transcript degradation. At elevated temperatures, the stem-loop unfolds, allowing translation to proceed. Therefore, at lower temperatures, the expression is “off,” while at higher temperatures, it is “on.”

[Figure 1] Created with BioRender.com..

There are many RNase inside cells, and RNase III was chosen for several reasons:

  1. It was essential to select an endoribonuclease that could cleave the transcript at an internal location.
  2. It was important to use an enzyme capable of cutting double-stranded RNA rather than single-stranded RNA, ensuring the transcript degrades at low temperatures.

We initiated the design process with an RNase III cutting site (RC) identified in the literature (Figure 1, Pertzev & Nicholson, 2006). This sequence does not appear elsewhere in the mCherry transcript, making it suitable for use as a reporter for characterization. The thermosensor sequence contains either one RC or two RCs separated by 2 bp. By adjusting the bases in the stem-loop, we aimed to achieve predicted melting temperatures within the 25–35°C range.

The thermosensors were named based on their length, with the first 13 sequences being 30 bp, the next four being 32 bp, and the final five being duplicates of two stem-loop structures containing RCs. To ensure that no downstream interactions would hinder stem-loop formation, the secondary structure of the 5' UTR was predicted, showing no significant deviations. Supplementary materials provide the prediction data for all thermosensors, and Figure 2 shows an example of these prediction results.

Supplementary materials

image-20240930104426701

[^Figure 2]: Base pair sequence effects on μR1.1 RNA cleavage reactivity. The diagram illustrates the sequence and proposed secondary structure of μR1.1 RNA. The arrow indicates the RNase III cleavage site, and the pb and db are also indicated. The numbers to the left of the two boxes refer to specific subsites within each box. Base pair substitutions are shown on the right, with relative reactivity provided below each substitution, representing the average of three experiments, with a standard error of ±15%. (Pertzev & Nicholson, 2006)

image-20240930105837850

[^Figure 3] Prediction of one of our thermosensors, BBa_K5280410. The left panel shows the RNA melting temperature, while the right panel displays the predicted secondary structure.

ThermosensorSequence
BBa_K5280410TATAAGAGTTTTGGCAACAGAGTTCTTATT
BBa_K5280411TATAAGGTCATTTGCAAAAGTGGTCTTATT
BBa_K5280412TATAAGGGTATTGGCAACAGTGTTCTTATA
BBa_K5280413TATAAGAGTATTTGCAAAAGTGTTCTTATA
BBa_K5280414TATAAGGGTATTCGCAAGAGTGTTCTTATA
BBa_K5280415TATAAGGTTATTGGCAACAGTGGTCTTATA
BBa_K5280416TAAAAGGTTATTGGCAACAGTGGTCTTTTA
BBa_K5280417TATAAGGTGATTGGCAACAGTTGTCTTATA
BBa_K5280418TATAAGGGTATTCGCAAGAGTGTTCTTATA
BBa_K5280419TAAAAGTGTATTCGCAAGAGTGTGCTTTTA
BBa_K5280420TAAAAGTGTATTCGCAAGAGTGTGCTTTTT
BBa_K5280421TAAAAGTGTATTTGCAAAAGTGTGCTTTTT
BBa_K5280422AAAAAGGTGATTGGCAACAGTTGTCTTTTT
BBa_K5280423ATAAAAGGTTATTGGCAACAGTGGTCTTTTAT
BBa_K5280424TTATAAGGTGATTGGCAACAGTTGTCTTATAA
BBa_K5280425TTATAAGGGTATTCGCAAGAGTGTTCTTATAA
BBa_K5280426TTATAAGAGTTTTTGCAAAAGGGTTCTTATAA
BBa_K5280427TTTAAGGGTATTCGCAAGAGTGTTCTTAATCTTAAGGGTATTCGCAAGAGTGTTCTTAA
BBa_K5280428TATAAGGGTATTGGCAACAGTGTTCTTATAGATATAAGGGTATTGGCAACAGTGTTCTTATA
BBa_K5280429AAAAAGGTGATTGGCAACAGTTGTCTTTTTGAAAAAAGGTGATTGGCAACAGTTGTCTTTTT
BBa_K5280430TATAAGGTTATTGGCAACAGTGGTCTTATAGATATAAGGTTATTGGCAACAGTGGTCTTATA
BBa_K5280431TTATAAGGTGATTGGCAACAGTTGTCTTATAAGATTATAAGGTGATTGGCAACAGTTGTCTTATAA

Testing RNA Thermosensors ​

Due to time constraints, we were unable to test all 22 thermosensors. Instead, we conducted a preliminary characterization of several to assess their ability to regulate the expression of downstream genes.

For the characterization process, we inoculated 100 μL of glycerol stock bacteria into 5 mL of LB medium containing ampicillin (100 μg/mL) in test tubes. The cultures were grown at 37°C with shaking at 220 rpm for 18 hours. The bacterial cultures were then diluted to a target Abs700 of 0.04, with 3 mL of each sample transferred to a shaker, and the remaining cultures incubated at the target temperature with shaking at 220 rpm. After 14 hours of incubation, fluorescence and Abs700 were measured using a Varioskan LUX Multimode Microplate Reader, while protecting the samples from light. The fluorescence of mCherry was measured with an excitation wavelength of 587 nm and an emission wavelength of 610 nm. We used Abs700 to represent cell density, as mCherry has significant absorption around 600 nm. Although our team members reported that the difference was not substantial, we opted to use OD700 for consistency.

[^Figure4] Among these thermosensors, the recognition sites of BBa_K5280427-BBa_K5280431 were derived from the thermosensors represented in the figure to their left. BBa_K5280427-BBa_K5280430 both contain two recognition sites, but we found no significant difference from having only one recognition site. While two recognition sites theoretically reduce leakage, they also result in a lower "on" state, which is something to be aware of.

The data indicates that nearly all of the thermosensors can detect environmental changes, as the expression level of the downstream gene fluctuates with temperature.

Further experiments are needed to fully characterize all of the thermosensors we designed.