banner

Contribution

Contribution

Contribution

Contribution

Scroll down

Parts Contribution ​

Light Sensor Characterisation Protocols ​

Given the sensitivity of light sensors, accurately measuring their behavior can be challenging. Additionally, it is sometimes difficult to determine which specific characteristics should be examined. Notably, in the iGEM Registry or on teams' individual wiki pages, there is rarely comprehensive information on how these measurements are conducted. To address this gap, we aimed to develop a standardized light sensor characterization protocol that could assist future iGEM teams in performing precise and reliable measurements.

We applied engineering principles to iteratively refine our measurement protocols. For more details on the process, please refer to our engineering page. Below is our finalized light sensor characterization protocol:

Time-Course Characterization Protocol ​

  1. Culture Preparation: Revive the glycerol stock by culturing in 5 ml of LB medium with appropriate antibiotics for 16 hours at 37°C and 220 rpm.
  2. Dilution and Grouping: After 16 hours, dilute the culture at a 1:100 ratio into 30 ml volumes. Divide into 2 groups: light-induced and non-induced (dark) conditions, each with three replicates, and culture in separate shakers to maintain distinct conditions.
  3. Incubation and Sampling: Incubate the cultures under their respective conditions for 25 hours with shaking at 220 rpm. Sample 1000 µl from each tube at regular intervals (e.g., every 2 hours).
  4. Sample Preparation for Flow Cytometry: Add 3.3 mg/ml chloramphenicol and 0.4 mg/ml tetracycline to each sample immediately after collection to stop gene expression. Place the samples in an ice-water bath for 10 minutes. Prepare the samples for flow cytometry analysis.
  5. Flow Cytometry Measurement: Analyze the prepared samples using flow cytometry to measure mCherry fluorescence intensity (Ex 587 nm, Em 610 nm). Use the median fluorescence intensity from the flow cytometry data to represent the overall expression level for each time point.

Reversibility Analysis Protocol ​

  1. Culture Preparation: Revive the glycerol stock by culturing in 5 ml of LB medium with appropriate antibiotics for 16 hours at 37°C and 220 rpm.
  2. Dilution: After 16 hours, dilute the culture at a 1:100 ratio into 30 ml volumes.
  3. Incubation and Sampling: Incubate the cultures under dark conditions for 25 hours with shaking at 220 rpm. Sample 1000 µl from each tube at regular intervals (e.g., every 2 hours). Reverse the inducable condition every 3 hours.
  4. Sample Preparation for Flow Cytometry: Add 3.3 mg/ml chloramphenicol and 0.4 mg/ml tetracycline to each sample immediately after collection to stop gene expression. Place the samples in an ice-water bath for 10 minutes. Prepare the samples for flow cytometry analysis.
  5. Flow Cytometry Measurement: Analyse the prepared samples using flow cytometry to measure mCherry fluorescence intensity (Ex 587 nm, Em 610 nm). Use the median fluorescence intensity from the flow cytometry data to represent the overall expression level for each time point.

Threshold Characterization Protocol ​

  1. Culture Preparation: Revive the glycerol stock by culturing in 5 ml of LB medium with appropriate antibiotics for 16 hours at 37°C and 220 rpm.
  2. Dilution and Grouping: After 16 hours, dilute the culture at a 1:100 ratio into 30 ml volumes. Divide into several groups with different light conditions, each with three replicates, and culture in separate shakers to maintain distinct conditions.
  3. Incubation and Sampling: Incubate the cultures under their respective conditions for 25 hours with shaking at 220 rpm. Sample 1000 µl from each tube at regular intervals (e.g., every 2 hours).
  4. Sample Preparation for Flow Cytometry: Add 3.3 mg/ml chloramphenicol and 0.4 mg/ml tetracycline to each sample immediately after collection to stop gene expression. Place the samples in an ice-water bath for 10 minutes. Prepare the samples for flow cytometry analysis.
  5. Flow Cytometry Measurement: Analyze the prepared samples using flow cytometry to measure mCherry fluorescence intensity (Ex 587 nm, Em 610 nm). Use the median fluorescence intensity from the flow cytometry data to represent the overall expression level for each time point.

Cell Toxicity Analysis Protocol ​

  1. Culture Preparation: Revive the glycerol stock by culturing in 5 ml of LB medium with appropriate antibiotics at 37°C and 220 rpm for 16 hours.
  2. Dilution and Grouping: Dilute the culture at a 1:100 ratio. Transfer 1 ml of the diluted culture into separate wells of a 24-well plate. Set up three or more groups: one expressing LexRO and the other containing empty vectors as a control, each with multiple replicates. Include one or more positive control group expressing a known cell-toxic gene to benchmark the effects of LexRO expression.
  3. Incubation and Data Acquisition: Incubate the plate using the Thermo Fisher Scientific Varioskan LUX with continuous shaking. Measure OD600 every 10 minutes to monitor cell growth and obtain the k-value of each group.
  4. Randomized Plate Layout: Randomize the layout of the plate to minimize the impact of uneven heating across different wells, ensuring consistent experimental conditions.
  5. Data Analysis: Aggregate data from multiple experiments, compare growth curves, and perform statistical analysis to assess the impact of LexRO expression on cell growth.

New Parts ​

In this year's iGEM project, we submitted 24 new parts to the Registry, and all of them can play as a regulatory element in genetic circuits. These are all sensor, and they can be divided into two categories: light sensor and thermosensors.

For more technical details, you can access the parts' main pages on the Registry. The new parts are:

Part NumberTypeDescriptionCategory
BBa_K5280129CodingLexROBasic Part
BBa_K5280401RegulatoryPcolE408Basic Part
BBa_K5280402RegulatoryBBa_J23110 promoter-LexA408-operatorComposite Part
BBa_K5280410RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280411RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280412RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280413RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280414RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280415RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280416RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280417RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280418RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280419RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280420RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280421RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280422RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280423RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280424RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280425RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280426RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280427RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280428RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280429RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280430RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part
BBa_K5280431RBSA RNA thermosensor that turns on protein translation at high temperatures.Basic Part

Light Sensor ​

The light induced regulating system we submitted into Registry is called eLightOn, which consists of two basic components: LexRO, the regulator, and a corresponding promoter (in our project we used and submitted PcolE408).

LexRO (BBa_K5280129) is a recombinant protein consisting of 3 parts: a DNA-binding domain from LexA(408), a light sensing domain from RsLOV, and the linker between them.

  • RsLOV is a blue light (450~465nm) sensor from Rhodobacter sphaeroides that possesses a contrary light-inducible behavior to Vivid domain.
  • LexA(408) repressor is a mutant of LexA that recognizes a symmetrically altered operator mutant but not a wild-type operator. Thus, as long as a promoter can be repressed by LexA(408), it can be regulated by LexRO.

PcolE408 (BBa_K5280401)

While utilising it in our project and submitting it into the Registry, we examined its characteristics. Here are our experiment results.

Cell Toxicity ​

To explore whether LexRO possesses cytotoxicity, we designed a series of plasmids and cultured ''E. coli'' transformed with these plasmids under suitable conditions, measuring their biomass at fixed intervals. The results are illustrated in the figure below. The findings indicate that strong expression of LexRO does not significantly affect cell division, and significant fluorescence can be observed under cultivation conditions, suggesting that LexRO shares similar fluorescent characteristics with EL222. We note that the excitation wavelength of EGFP is 487 nm, which is very close to the excitation wavelengths of LexRO and EL222, implying that the expression of these regulators might affect the detection of EGFP as a reporter in future applications. Further experiments are still necessary to determine whether there is any impact in real-world scenarios.

In the experiments, E. coli transformed with an empty vector were used as negative controls.

Figure 1.

To further ascertain the presence or absence of cytotoxicity and to compare the characteristics with EL222, we cultivated bacteria expressing high levels of EL222 in parallel. The results are illustrated in the figure below. It was observed that there were no significant differences in the growth curves of bacteria expressing an empty vector, EL222, and LexRO, suggesting that LexRO does not exhibit cytotoxicity.

In the experiments, E. coli transformed with an empty vector were used as negative controls.

Figure 2.

Effectiveness of Regulation ​

To assess the efficacy of LexRO as a photosensor, we constructed an expression vector featuring mCherry as a reporter gene. Subsequently, bacteria harboring the reporter gene were cultivated under inducing and non-inducing conditions, with results as illustrated in the figure. Statistical analysis revealed that LexRO, as a regulatory protein for gene expression, can achieve a switch ratio of approximately 6. This performance exceeds that of commonly used optogenetic regulatory elements such as EL222, whose switch ratio is approximately less than 5 folds (Li et al., 2020), suggesting its relatively high efficacy.

In the experiments, E. coli transformed with an empty vector were used as negative controls.

Figure 3.

Time-Course Characterisation ​

To refine the description of LexRO's regulatory performance on a temporal scale, we characterized the time-course relationship of LexRO under induced and non-induced conditions. The results indicate that during the early stages of growth, LexRO exhibits a high capacity for gene expression repression in the dark, and this repression is relatively complete. For the reversibility group, it was observed that the fluorescence intensity responds significantly to light conditions but with a certain degree of lag. This experiment serves as a preliminary characterization and there are many constrains (for details please refer to our engineering page and the part's main page), but still, it can provide us some useful information.

In the experiments, E. coli transformed with an empty vector were used as negative controls.

Figure 4.

Thermosensor ​

To meet our need for tunable thermosensors, we began designing and testing various thermosensor constructs. Inspired by the JilinU_China 2018 iGEM team, we incorporated an RNase III cleavage site into our designs to enhance functionality. Below are the thermosensors we developed, and for more detailed information, you can refer to our Thermosensor page.

ThermosensorSequence
BBa_K5280410TATAAGAGTTTTGGCAACAGAGTTCTTATT
BBa_K5280411TATAAGGTCATTTGCAAAAGTGGTCTTATT
BBa_K5280412TATAAGGGTATTGGCAACAGTGTTCTTATA
BBa_K5280413TATAAGAGTATTTGCAAAAGTGTTCTTATA
BBa_K5280414TATAAGGGTATTCGCAAGAGTGTTCTTATA
BBa_K5280415TATAAGGTTATTGGCAACAGTGGTCTTATA
BBa_K5280416TAAAAGGTTATTGGCAACAGTGGTCTTTTA
BBa_K5280417TATAAGGTGATTGGCAACAGTTGTCTTATA
BBa_K5280418TATAAGGGTATTCGCAAGAGTGTTCTTATA
BBa_K5280419TAAAAGTGTATTCGCAAGAGTGTGCTTTTA
BBa_K5280420TAAAAGTGTATTCGCAAGAGTGTGCTTTTT
BBa_K5280421TAAAAGTGTATTTGCAAAAGTGTGCTTTTT
BBa_K5280422AAAAAGGTGATTGGCAACAGTTGTCTTTTT
BBa_K5280423ATAAAAGGTTATTGGCAACAGTGGTCTTTTAT
BBa_K5280424TTATAAGGTGATTGGCAACAGTTGTCTTATAA
BBa_K5280425TTATAAGGGTATTCGCAAGAGTGTTCTTATAA
BBa_K5280426TTATAAGAGTTTTTGCAAAAGGGTTCTTATAA
BBa_K5280427TTTAAGGGTATTCGCAAGAGTGTTCTTAATCTTAAGGGTATTCGCAAGAGTGTTCTTAA
BBa_K5280428TATAAGGGTATTGGCAACAGTGTTCTTATAGATATAAGGGTATTGGCAACAGTGTTCTTATA
BBa_K5280429AAAAAGGTGATTGGCAACAGTTGTCTTTTTGAAAAAAGGTGATTGGCAACAGTTGTCTTTTT
BBa_K5280430TATAAGGTTATTGGCAACAGTGGTCTTATAGATATAAGGTTATTGGCAACAGTGGTCTTATA
BBa_K5280431TTATAAGGTGATTGGCAACAGTTGTCTTATAAGATTATAAGGTGATTGGCAACAGTTGTCTTATAA

We were able to characterize and validate some of the sequences, confirming that several could indeed function as thermosensors, despite time constraints. The experimental results are presented below. Each experiment involved culturing E. coli transformed with a regulator-reporter expression vector under different temperature conditions for several hours. After incubation, we measured the reporter expression levels to determine whether the thermosensors were functional. The result shows that almost all of our thermosensor are temperature responsive regulatory parts.

In the experiments, E. coli transformed with an empty vector were used as negative controls.

Figure 5.

Characterisation to Existing Parts ​

While characterizing LexRO (BBa_K5280129), we sought to compare it with an existing light sensor to assess whether our light sensor could outperform established alternatives. For this comparison, we selected the widely used blue light sensor EL222 (BBa_K2332004) as a baseline. Although time constraints prevented us from conducting comprehensive characterization of EL222 as we did with LexRO, we encountered some interesting observations during our literature review and experimental process.

We transformed E. coli cells with an empty vector, the LexRO expression vector, and the EL222 expression vector, and incubated them under appropriate conditions. We recorded OD600 data every 20 minutes. After several hours, we obtained the results shown in the figure below.

In the experiments, E. coli transformed with an empty vector were used as negative controls.

Figure 6.

Our results indicated that all three cell types—those transformed with the empty vector, LexRO expression vector, and EL222 expression vector—did not exhibit any signs of toxicity. However, some studies have reported that EL222 can induce cellular toxicity, leading to abnormal growth curves in E. coli. The discrepancy between our findings and those reported in the literature warrants further investigation and may provide valuable insights.

Contribution in Coral Issues ​

Since the 20th century, coral bleaching has consistently been a prominent topic, not only in the scientific community but also in policy-making and social governance. However, few synthetic biologists have found innovative and effective ways to address this issue. In the context of iGEM, teams have primarily focused on the downstream effects of environmental factors, attempting to eliminate ROS or other harmful chemicals within the symbiotic system. While these approaches may have potential, due to the complexity of metabolic pathways and the lack of understanding of the specific signaling pathways involved in coral bleaching, these attempts often face a trade-off between improving growing conditions and over-modifying cellular processes (which can ultimately lead to negative outcomes). Our team is the first iGEM team to protect corals by modifying environmental factors to return them to a normal range. We firmly believe that because altering environmental factors does not significantly disrupt internal metabolic processes, our project could serve as a catalyst to inspire more iGEM teams to protect corals through innovative approaches.

Furthermore, to simplify future iGEMers' approach to this topic—given the potential challenges in understanding the mechanisms behind coral bleaching—we have summarized the definition and mechanisms of coral bleaching based on the latest discoveries in academia, and we have compiled a list of important articles in this area. We sincerely hope that these resources will one day be utilized to make meaningful contributions toward solving this problem.

For these resources, please refer to our Project Description page.

Algae Cultivation ​

Cultivating algae may seem straightforward, but without proper guidance, it can become a tedious process, especially when optimizing cultivation protocols for beginners. For iGEMers, growing algae (particularly Zooxanthellae) under varying environmental conditions, such as different light intensities and temperatures, can also be costly. Thus, we believe that our trials and experiments could significantly benefit future teams' work. Over time, we developed a relatively inexpensive and convenient algae cultivation method.

For detailed information, please refer to our Algae Cultivation page. There you could see our failures and experiences.

Contribution in Dry Lab ​

In today's landscape, where various large language models are gaining prominence, we are keen to avoid the disappearance of books and magazines, which serve as vital vessels of knowledge. We envision a synergy between large language models and e-books, leveraging the rapid and efficient retrieval capabilities of these models to extract vast amounts of information from literature. Moreover, the widespread lack of coral knowledge among youth, as observed during our educational projects, has provided us with valuable insights. Building upon this foundation and integrating elements related to corals, we have crafted the narrative of CoralGenie.

The description of software in the iGEM judge handbook profoundly resonates with me: "Software in iGEM should make synthetic biology based on standard parts easier, faster, better, or more accessible to our community." The final iteration of our large language model not only embodies the fundamental capabilities of ChatGPT, enabling it to respond to coral-related inquiries, but also incorporates a question-and-answer format derived from literature retrieval. If this small software, into which I have poured my aspirations, can assist future iGEM participants, it would be a fulfillment of my hopes.

The circuit model aspect of our project effectively addresses the challenges we face in the wet lab—due to time constraints, we find it difficult to implement this circuit in the ocean to halt the process of coral bleaching. As someone deeply involved in the wet lab, I do not wish for the circuit model to merely serve as an adjunct to it. Ultimately, our circuit model not only elucidates certain gaps in the engineering cycle, such as the integration of amplifiers and the simulation of the constitutive expression of aeBlue, but it also explores the expression characteristics of chromoproteins under the synergistic influence of temperature and light intensity, culminating in the creation of heat maps.

Contribution in Human Practices ​

Contribution in Integrated Human Practices ​

In the planning and execution of our iHP activities, we developed some effective methods and gained valuable experience, which we would like to share with everyone here.

1. HP Values & HP Logic ​

We strongly recommend that every team establish their own HP values and HP logic. From our experience this year, we found that this approach significantly aided us in activity design, documentation, and Wiki presentation.

At the start, we set HP goals and guided our activities around these goals. As we progressed, real-world experiences shaped our project, prompting us to iterate on these goals and eventually develop them into our HP values. These values, in turn, guided our implementation, the most critical step in translating our project into real-world impact. This logical chain is smooth and highly beneficial in preventing HP activities that are disconnected from the project and merely self-serving. It also helps align the activities with the 3R principles during execution and documentation, especially on the Wiki.

For our iHP Wiki presentation, we adapted the well-established AREA framework used by many iGEM teams to better suit our documentation preferences and project communication logic. This adaptation allowed us to organize iHP content in a highly logical way, greatly improving our efficiency in documentation. We welcome other iGEMers who resonate with our approach to use our HP logic and encourage everyone to modify various frameworks to fit their own project’s needs for more coherent presentations.

The 3R principles (Reflective, Responsible, Responsive) and the AREA framework (Anticipate, Reflect, Engage, Act) share many commonalities in both philosophy and practice. They can be integrated to form a more comprehensive and systematic guidance system for research and innovation. This integration facilitates research activities that not only achieve scientific goals but also better consider social, ethical, environmental, and other factors, ultimately fostering responsible innovation.

In our practice, we have found that the AREA framework is more suited to larger projects, providing a more macro perspective to oversee and guide the entire project. However, we clearly understand that human practice is a process that runs throughout the entire project, rather than being confined to a specific task. To better guide our communication with stakeholders and ensure the project remains **dynamic—constantly responding appropriately to external feedback—**we are attempting to combine the 3R principles with the AREA framework. We personally practiced this new AREA concept over the summer, continuously iterating on our HP cycle, which greatly benefited our work. Therefore, we sincerely recommend that all iGEM teams use this framework in their HP work. We also acknowledge that there are still some shortcomings, such as difficulties in applying certain principles and ideas in specific contexts. In such cases, we recommend conducting a specific analysis based on the situation. Furthermore, we strongly recommend reflecting on the perspectives mentioned in this framework before each HP activity. If certain perspectives prove difficult to implement, they can be skipped, but this process undoubtedly enhances the maturity and completeness of HP activities. We believe that the insights contained within this framework regarding our HP work will inspire others.

2. Gap in Synthetic Biosafety ​

During our various HP outreach activities, we tried to identify national standards for biosafety in synthetic biology, specifically within the marine environment. However, due to the limited application of synthetic biology in this context, we found that there are no specific guidelines or regulations in our country. This lack of clear guidance presented challenges in our investigation. Here, we’d like to share how we addressed this issue with all iGEMers:

First, after thorough investigation, we identified the gaps in the regulations and advocated for improvements in this area. Second, we turned to international regulations, adjusting our project design in line with international biosafety guidelines. Lastly, even when biosafety validation was unclear and no relevant regulations existed, domestically or internationally, we made extensive comparisons and created a comprehensive biosafety plan to ensure the feasibility of future implementation.

3. Stakeholders Identification ​

The Conservation track is relatively niche in iGEM, and finding relevant stakeholders can be more indirect. However, through our efforts this year, we expanded the application of our project to commercial coral farming and engaged deeply with stakeholders in this area. This exploration uncovered the potential of our project in the market, bringing a new and innovative perspective to coral conservation, which excited us greatly. Therefore, we want to share some of our stakeholder identification experiences with all iGEMers.

We categorized and summarized our stakeholders into five groups: community, academia, education, government, and business. Due to the nature of the Conservation track, teams typically focus heavily on academia and government but often overlook the possibility of engaging with community and business stakeholders. We recommend that all iGEMers consider these five categories when identifying stakeholders to broaden their engagement and uncover the full potential of their projects.

From our experiences in reaching out to stakeholders this year, we have two key takeaways. First, make full use of all available resources. Based in Guangzhou, we visited every marine research institution in the city. Despite having a limited number of professors available at our university, we did extensive research on each one to understand where they could provide valuable insights and approached them with clear expectations. This strategic targeting yielded fruitful results. Second, even if you misidentify stakeholders, meaningful communication will still lead to new perspectives or unexpected insights. This was vividly demonstrated in our conversations with the owner of a coral craft store and our discussions with researchers Zhao Meixia and Yang Qingsong at the South China Sea Institute of Oceanology. These unexpected gains are not mere strokes of luck but the inevitable result of thorough preparation, effective communication, and persistent effort.

4. Leveraging Two-Way Dialogue in Education ​

We all know that two-way education and mutual growth are crucial in outreach activities. Typically, the educator receives feedback that helps refine teaching methods. To organically integrate iHP with education, we selected a special group—competition students—and engaged them through activities and two-way dialogue. This approach not only educated them but also brought valuable suggestions and ideas for our project. From this year's results, we believe this approach was highly effective. We share this concept with everyone, hoping that we can all recognize the potential of education participants to contribute ideas to the project. By considering the characteristics of different audiences and designing activities accordingly, we can make outreach education an indispensable source of insights for iHP.

Reflection ​

As first-time participants without an iGEM-experienced advisor to guide our HP efforts, we faced many challenges, struggles, and moments of regret or frustration due to incomplete planning, unexpected changes, and overlooked details. However, through persistent study of iGEM’s HP requirements, we eventually found a proper path forward. We managed to align our HP activities with the project’s progress, ultimately achieving results we are genuinely proud of.

Thinking about how to conduct HP activities, learning how to conduct HP activities, and finding ways to improve how we learn from HP activities—iHP constantly pushes you to reflect on the project, the planning process, and even yourself. This is an ongoing journey in project research. Through constant reflection, you gradually improve your project design, your HP planning, and, unconsciously, yourself. I believe this is the most valuable gift that HP, through the 3R principles and its interaction with the world, brings to both the project and the researcher.

As the leader of our HP team, when I look back on our team’s growth and my personal development, I am filled with deep emotion. From being lost and grasping for direction at the beginning, to now approaching HP activities with confidence and clarity, it’s been an incredible journey. Through this contribution, I sincerely hope to share this experience of growth and inspiration with more iGEMers.

Contributions in education ​

Combined with innovation and variation, our educational activities this year not only successfully empower a large amount of different people, but also iterated using the feedback from previous educational activities to ultimately reach the goal of enabling more people to shape, contribute to, and/or participate in synthetic biology.

Our unique and innovative design of educational activities reflects on how we fully use the feedback and dialogue we gained from each activity, how we thoughtfully implemented different activities with suitable educational theories and advice from professors in the field of education and sociology and how we showed all the activities in an organized way so that future iGEM teams can build upon easily.

Thoughtful Implementations ​

Concept and methodology: ​

We figured out the key concept we want to convey throughout all the educational activities by learning from the previous education examples, thinking over our educational activities design and communicating with education specialists. We finalized the concept empwering, aiming to empower students to apply what they have learnt and publicize to others. In this way, not only can they deepen their understanding of the knowledge through teaching, but they can also act as a radiant point, influencing more people.

To implement the concept of empowering, we used part of the ways of classical Montessori Education, like child-centered learning, prepared environment, hands-on learning and so on. We adjusted and visualized these concepts with designed curriculums for students of different ages, specialized toolkits, picture book sequel series class and so on. For more information, you can infer to the Methodology part in the Education page.

In addition, we also applied advanced technological ways to improve the outcome of our classes. For example, we used GPT to help us generate stories and images for our reference and printed a 3D coral model which would change color as the temperature change.Besides, We also found professors in relevant fields and communicated several times before and after educational activities to improve the final outcome of each activity. All of the above can also be found on the Methodology part of the Education page if you want to learn more.

Innovative educational methods: ​

Setting the abstract overall guidelines for each of the educational activities, we also created different innovative educational methods.

  1. We encourage young students to finish creative activities like picture book sequels, story making and so on to apply the new knowledge and visualize their creativity for further usages.
  2. We try encouraging students to share what they have learnt with their parents, empowering the students and educating their parents at the same time.
  3. We cooperated with different organizations, including social enterprises and laboratories. By the platform and foundation they provide, we can better spread knowledge of synthetic biology to a group of people who are interested in and familiar with this field.
  4. We designed different styles of curriculumns for students of different ages and cognitive level in biology and preinvestigated with teachers and students.
  5. We designed the dark hall activity and fluorescent dance. By turning off all the lights in a big lecture hall and performing a dance in clothes that will light itself, we successfully engaged about 100 people in the classroom and vividly showed the functionality of fluorescent proteins.
  6. We designed a lot of unique and engaging games under the theme of biosafety, which is close to everyone's everyday's life.
  7. We recruited a special education volunteer team in the freshman group. By teaching them and teaching with them, we proved the feasibility of our empowering concept and also deepened volunteer's understanding of synthetic biology and iGEM competition.

All of the innovative approaches can be found in the details of each activity on the Education Page.

Thoughtful division of students: ​

Last but not least, we have carefully selected our educational targets at different age levels.

For primary and secondary school students, one of our educational activity is conducted in Guizhou, an inland and relatively poor province in China and the other is conducted in Shenzhen, a costal city with high GDP and advanced technology. By choosing these two representatives, not only can we gain experience in this age group, but we also know more about differences within the group through feedback.

For high school students, we thoughtfully divided them into students studying science competitions, students studying high school knowledge normally, students in the international schools and international students. We vary the way of teaching to different groups according to their cognitive level of biology and expectations and gain complete different feedback.

For university students, we focused on a small group of volunteers and educated in cooperation with them after teaching them.

For public education, we chose two coastal cities to conduct the activities. One is in Ningbo, the norther part of China, the other is in Shenzhen, the southern part of China.In this way, our data and feedback are more conclusive and reliable.

These can all be referred to in a detailed manner in the details of activity in Education Page.

Two-way dialogue ​

In each educational activity, we put high emphasis on feedback collection. Concluding from the educational activities we have done and conversations we had with the specialists in education and sociology, we have more insights into students of different ages.

Primary and secondary school students ​

We found that for primary and secondary school students who don't have much knowledge foundation in biology, while it's hard to introduce them synthetic biology in a short time, they can understand the abstract concepts well through a long-term summer camp which guide them step by step from macro to micro. The long-term format of summer camp educational activities not only deepens their understanding of the subject but also increases the likelihood of inspiring their future dedication and passion for biology, particularly synthetic biology.

In addition, we can visialize the novel imagination and creativity gained from children in primary and secondary school students by conducting lessons similar to picture book sequels. With appropriate guidance, students can not only enhance the knowledge by applying them in the picture book, but we can fully use their valuable curiosity and sensitivity to the world to inspire students in other groups.

You can learn more about this in the Aid Education in Guizhou project in the Education page.

High school students ​

By explaning our project in-depth to students who study science competitions, we can harvest some constructive ideas and questions on our circuit design and experiment implementation.

For students who study normal high school classes, we organized sharing session on iGEM competition and college life. They showed great interest and active interaction in class. Some of them set their goals for the high school endeavour after the session and gained some insights into the future.

Talking with the leading team of international school first, we successfully ignited their eagerness to join iGEM competition next year. In the courses we designed, the students all participated actively and enthusiastically and they could come out a practical initial version of the program successfully after the courses.

International students are more open and adventurous compared with the student in China. They engaged more actively and answered more bravely during the lectures. They prefer interactive games and are willing to participate on stage. More interactive educational methods can be used in this group.

University students ​

We designed posters that showed the concept of synthetic biology and our project design for other university students. The posters will be printed out and spread after the freezing period of wiki.

We also focused on a small group of freshman volunteers. By teaching them knowledge about synthetic biology, presentation skills and so on, they improved a lot on the understanding of synthetic biology and their presentation skills. They also felt the happiness of teaching and learning and gained a lot from the educational activities.

Public ​

We first designed the games for public education of Nantou Ancient City in a progressive style. After receiving the relatively bad feedback, we immediatly changed the games to parralleled and simplified structure at the education activity in Ningbo. This time, we gained lots of positive feedback and more active engagement from the public.

All educational activities, methods used, feedback received, innovative methods are clearly organized in the Education Page so that others can build upon our educational activities more easily. In the Education Page, each activity has a highlights introduction, so that you can quickly browse to catch the main points of the activity. At the same time, specific pre-event preparations, implementation process, post-event feedback of each activity are organized in the form of folded pages under the abstract description of the activity. If you want to learn more about the implementation of a specific education activity, you can see the detailed information in the foldout pages.