| short description | long description | 5' 3' source(genomic sequence) | design considerations | part |
|---|---|---|---|---|
| miR-144-3p mature | MicroRNAs (miRNAs) are short, non-coding RNAs (20-24 nucleotides) that play a crucial role in the post-transcriptional regulation of gene expression in multicellular organisms by influencing the stability and translation of mRNAs. These miRNAs are transcribed by RNA polymerase II as part of primary transcripts (pri-miRNAs), which can be either protein-coding or non-coding and feature a cap and poly-A tail. The Drosha ribonuclease III enzyme cleaves the primary transcript to form a precursor miRNA (pre-miRNA) with a stem-loop structure, approximately 70 nucleotides long. This pre-miRNA is then further processed by the Dicer ribonuclease in the cytoplasm to produce the mature miRNA and its complementary strand, known as the miRNA star (miRNA*). The mature miRNA is then incorporated into a RNA-induced silencing complex (RISC), which identifies target mRNAs through imperfect base pairing with the miRNA, typically leading to either translational repression or destabilization of the target mRNA. The specific miRNA miR-144-3p was chosen for its targetting on the mRNA 3'UTR-TLR2. |
5’ UAC AGU AUA GAU GAU GUA CU 3’ | According to Akino Mercy CS, Suriya Muthukumaran N, Velusamy P, Bothammal P, Sumaiya K, Saranya P, Langford D, Shanmughapriya S, Natarajaseenivasan K. MicroRNAs Regulated by the LPS/TLR2 Immune Axis as Bona Fide Biomarkers for Diagnosis of Acute Leptospirosis. mSphere. 2020 Jul 15;5(4):e00409-20. doi: 10.1128/mSphere.00409-20. PMID: 32669469; PMCID: PMC7364213. It is shown that this miRNA targets the 3'UTR of TLR2, possible biomarker for leptospirosis at the organ failure stage |
BBa_K5162000 |
| miR-144-3p inhibitors | interacts with miRNA-144-3p, it causes the steric hinderance to the miRNA, consequencently stop it's interaction with the 3'utr of the target gene sequence | 5’ AGU ACA UCA UCU AUA CUG U 3’ | miRNA Inhibitors are single-stranded oligonucleotides comprised of 2’-O-methyl residues that confer increased binding affinity to RNA targets and resistance to endonuclease degradation. |
BBa_K5162001 |
| miR-630 mature | MicroRNAs (miRNAs) are short, non-coding RNAs (20-24 nucleotides) that play a crucial role in the post-transcriptional regulation of gene expression in multicellular organisms by influencing the stability and translation of mRNAs. These miRNAs are transcribed by RNA polymerase II as part of primary transcripts (pri-miRNAs), which can be either protein-coding or non-coding and feature a cap and poly-A tail. The Drosha ribonuclease III enzyme cleaves the primary transcript to form a precursor miRNA (pre-miRNA) with a stem-loop structure, approximately 70 nucleotides long. This pre-miRNA is then further processed by the Dicer ribonuclease in the cytoplasm to produce the mature miRNA and its complementary strand, known as the miRNA star (miRNA*). The mature miRNA is then incorporated into a RNA-induced silencing complex (RISC), which identifies target mRNAs through imperfect base pairing with the miRNA, typically leading to either translational repression or destabilization of the target mRNA. The specific miRNA miR630 was chosen for its targetting on c3, one of the complement system proteins. |
5’ AGU AUU CUG UAC CAG GGA AGG U 3’ | high target score in mirDB, relevance to leptospirosis affected organ spots, potential biomarkers of leptospira at organ failure stage | BBa_K5162002 |
| miR-630 inhibitor | interacts with miRNA-630, it causes the steric hinderance to the miRNA, consequencently stop it's interaction with the 3'utr of the target gene sequence | 5’ ACC UUC CCU GGU ACA GAA UAC 3’ | miRNA Inhibitors are single-stranded oligonucleotides comprised of 2’-O-methyl residues that confer increased binding affinity to RNA targets and resistance to endonuclease degradation. |
BBa_K5162003 |
| miR-3646 mature | MicroRNAs (miRNAs) are short, non-coding RNAs (20-24 nucleotides) that play a crucial role in the post-transcriptional regulation of gene expression in multicellular organisms by influencing the stability and translation of mRNAs. These miRNAs are transcribed by RNA polymerase II as part of primary transcripts (pri-miRNAs), which can be either protein-coding or non-coding and feature a cap and poly-A tail. The Drosha ribonuclease III enzyme cleaves the primary transcript to form a precursor miRNA (pre-miRNA) with a stem-loop structure, approximately 70 nucleotides long. This pre-miRNA is then further processed by the Dicer ribonuclease in the cytoplasm to produce the mature miRNA and its complementary strand, known as the miRNA star (miRNA*). The mature miRNA is then incorporated into a RNA-induced silencing complex (RISC), which identifies target mRNAs through imperfect base pairing with the miRNA, typically leading to either translational repression or destabilization of the target mRNA. The specific miRNA miR-3646 was chosen for its targetting on CFH and tlr2, one of the complement system proteins. |
5’ AAA AUG AAA UGA GCC CAG CCC A 3’ | high target score in mirDB, relevance to leptospirosis affected organ spots, potential biomarkers of leptospira at organ failure stage | BBa_K5162004 |
| miR-3646 inhibitor | interacts with miRNA-3646, it causes the steric hinderance to the miRNA, consequencently stop it's interaction with the 3'utr of the target gene sequence | 5’ UGG GCU GGG CUC AUU UCA UUU 3’ | miRNA Inhibitors are single-stranded oligonucleotides comprised of 2’-O-methyl residues that confer increased binding affinity to RNA targets and resistance to endonuclease degradation. |
BBa_K5162005 |
| miR4427 mature | MicroRNAs (miRNAs) are short, non-coding RNAs (20-24 nucleotides) that play a crucial role in the post-transcriptional regulation of gene expression in multicellular organisms by influencing the stability and translation of mRNAs. These miRNAs are transcribed by RNA polymerase II as part of primary transcripts (pri-miRNAs), which can be either protein-coding or non-coding and feature a cap and poly-A tail. The Drosha ribonuclease III enzyme cleaves the primary transcript to form a precursor miRNA (pre-miRNA) with a stem-loop structure, approximately 70 nucleotides long. This pre-miRNA is then further processed by the Dicer ribonuclease in the cytoplasm to produce the mature miRNA and its complementary strand, known as the miRNA star (miRNA*). The mature miRNA is then incorporated into a RNA-induced silencing complex (RISC), which identifies target mRNAs through imperfect base pairing with the miRNA, typically leading to either translational repression or destabilization of the target mRNA. The specific miRNA miR-4427 was chosen for its targetting on CFH, one of the complement system proteins. |
5’ UCU GAA UAG AGU CUG AAG AGU 3’ | high target score in mirDB, relevance to leptospirosis affected organ spots, potential biomarkers of leptospira at organ failure stage | BBa_K5162006 |
| miR4427 inhibitor | interacts with miRNA-4427, it causes the steric hinderance to the miRNA, consequencently stop it's interaction with the 3'utr of the target gene sequence | 5’ ACU CUU CAG ACU CUA UUC AG 3’ | miRNA Inhibitors are single-stranded oligonucleotides comprised of 2’-O-methyl residues that confer increased binding affinity to RNA targets and resistance to endonuclease degradation. |
BBa_K5162007 |
| C3 | Non coding complement component C3 is crucial for activating the complement system, necessary for both the classical and alternative activation pathways. The gene encodes a preproprotein that is processed proteolytically to produce alpha and beta subunits, which assemble into the mature protein. This mature protein undergoes further processing to yield various peptide products. One such product, the C3a peptide (or C3a anaphylatoxin), plays a role in modulating inflammation and exhibits antimicrobial properties. C3 also plays a significant role in the immune response against pathogens such as Leptospira, the bacteria responsible for leptospirosis. The activation of C3 enhances opsonization, marking Leptospira for destruction by immune cells. Additionally, C3a helps recruit immune cells to the site of infection, facilitating a robust inflammatory response that aids in controlling the spread of the bacteria. It produces a reactions that induces the membrane attack complex, which can puncture the leptospira cell. The DNA seq (part of exon) transcribe into 3' untranslated region which is responsible for mRNA stability and correct localization into the target cell. |
TCCTACAACCACATGCAGTTGTGGGACCGCAGTTTGGTCCTGGGGACCATTCATACCCACACACCCAGCTTGTGCCTGTGGTTAACAT CTCAGAAAACTCTGGTAAATGATCACTCCAGGATATTGACAAGAATACACGTTACTGATCTTACTCACATGTTAAAAAAAAAAAAAAAA |
high target score corresponding to miRNAs, relvance to disease complement system, leads to the formation of the membrane attack complex which punctures the leptopsira cell | BBa_K5162010 |
| Best Basic Part: pUC19 + TLR2 | The protein encoded by this gene belongs to the Toll-like receptor (TLR) family, which is essential for recognizing pathogens and activating innate immunity. TLRs are highly conserved across species, from Drosophila to humans, and exhibit both structural and functional similarities. This protein is located on the cell surface and can form heterodimers with other TLR family members to detect pathogen-associated molecular patterns (PAMPs) derived from microorganisms. When TLRs are activated by PAMPs, they trigger signaling pathways that modulate the inflammatory response of the host. In the context of Leptospira infections, this TLR protein plays a crucial role in the immune response. It recognizes specific components of Leptospira, leading to the activation of immune pathways that help eliminate the bacteria. Additionally, the signaling cascades initiated by TLR activation promote the recruitment of immune cells to the site of infection, enhancing the inflammatory response necessary to control the spread of the bacteria. Furthermore, this gene is believed to promote apoptosis in response to bacterial lipoproteins and has been linked to the development of several autoimmune diseases. The DNA seq (part of exon) transcribe into 3' untranslated region which is responsible for mRNA stability and correct localization into the target cell. |
TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCCTAGACGGTCACAGCTTGTCTGTAAGCGGATGCCG GGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTG TACTGAGAGTGCACCAAATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGC TGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCATCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGA TTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCAACGCGATGACGATGGATAGCGATTCATC GATGAGCTGACCCGATCGCCGCCGCCGGAGGGTTGCGTTTGAGACAGGCGACAGATGAATTCGCGGCCGCTTCTAGAGGAATGCA ATAACTACGTTTTCTAAGGAGCAACTTGACTCATTTCACACACTGAAGACTTTGGAAGCTGGTGGCAATAACTTCATTTGCTCCTGTG AATTCCTCTCCTTCACTCAGGAGCAGCAAGCACTGGCCAAAGTCTTGATTGATTGGCCAGCAAATTACCTGTGTGACTCTCCATCC CATGTGCGTGGCCAGCAGGTTCAGGATGTCCGCCTCTCGGTGTCGGAATGTCACAGGACAGCACTGGTGTCTGGCATGTGCTGTG CTCTGTTCCTGCTGATCCTGCTCACGGGGGTCCTGTGCCACCGTTTCCATGGCCTGTGGTATATGAAAATGATGTGGGCCTGGCTC CAGGCCAAAAGGAAGCCCAGGAAAGCTCCCAGCAGGAACATCTGCTATGATGCATTTGTTTCTTACAGTGAGCGGGATGCCTACTG GGTGGAGAACCTTATGGTCCAGGAGCTGGAGAACTTCAATCCCCCCTTCAAGTTGTGTCTTCATAAGCGGGACTTCATTCCTGGCAA GTGGATCATTGACAATATCATTGACTCCATTGAAAAGAGCCACAAAACTGTCTTTGTGCTTTCTGAAAACTTTGTGAAGAGTGAGTGGTG CAAGTATGAACTGGACTTCTCCCATTTCCGTCTTTTTGATGAGAACAATGATGCTGCCATTCTCATTCTTCTGGAGCCCATTGAGAAAAAAGC CATTCCCCAGCGCTTCTGCAAGCTGCGGAAGATAATGAACACCAAGACCTACCTGGAGTGGCCCATGGACGAGGCTCAGCGGGAAGGATTTT GGGTAAATCTGAGAGCTGCGATAAAGTCCTAGGTTCCCATATTTAAGACCAGTCTTTGTCTAGTTGGGATCTTTATGTCACTAGTTATAGTTAAG TTCATTCAGACATAATTATATAAAAACTACGTGGATGTACCGTCATTTGAGGACTTGCTTACTAAAACTACAAAACTTCAAATTTTGTCTGGG GTGCTGTTTTATAAACATATGCCAGATTTTACTAGTAGCGGCCGCTGCAGATCAGTTCTGGACCAGCGAGCTGTGCTGCGACTCGTGGCG TAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTG GGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATT AATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCG TTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGA GCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCAC AAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCT CCTGTTCCGACCCTGTCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCT CAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGT CTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTA CAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAA GAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGAT CTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGG ATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCA GTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTA CCATCTGGCCCCAGTGCTGCAATGATACCGCGAGATCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCC GAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGT TTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAG GCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTAT CACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATT CTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCA TCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGA TCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAA ATGTTGAATACTCATACTCTACCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAA ATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGG CGTATCACGAGGCCCTTTCATC |
high target score corresponding to miRNAs, relvance to disease complement system, leads to the formation of the membrane attack complex which punctures the leptopsira cell | BBa_K5162011 |
| CFH | This gene belongs to the Regulator of Complement Activation (RCA) gene cluster and encodes a protein consisting of twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and plays a crucial role in regulating complement activation, ensuring that this innate defense mechanism is primarily directed at microbial infections. In the case of Leptospira infections, this protein helps modulate the complement response to prevent excessive inflammation while still facilitating effective pathogen clearance. By regulating complement activation, it ensures that the immune response is appropriately balanced, allowing the body to target Leptospira effectively while minimizing potential damage to host tissues. This regulation is vital for controlling the infection and preventing complications associated with an overactive immune response. The DNA seq (part of exon) transcribe into 3' untranslated region which is responsible for mRNA stability and correct localization into the target cell. |
AATCAATCATAAAGTGCACACCTTTATTCAGAACTTTAGTATTAAATCAGTTCTCAATTTCATTTTTTATGTATTGTTTTACTCCTTTTTATTCATACG TAAAATTTTGGATTAATTTGTGAAAATGTAATTATAAGCTGAGACCGGTGGCTCTCTTCTTAAAAGCACCATATTAAATCCTGGAAAACTAAAAA |
high target score corresponding to miRNAs, relvance to disease complement system, leads to the formation of the membrane attack complex which punctures the leptopsira cell | BBa_K5162012 |
| mir-601 mature | MicroRNAs (miRNAs) are short, non-coding RNAs (20-24 nucleotides) that play a crucial role in the post-transcriptional regulation of gene expression in multicellular organisms by influencing the stability and translation of mRNAs. These miRNAs are transcribed by RNA polymerase II as part of primary transcripts (pri-miRNAs), which can be either protein-coding or non-coding and feature a cap and poly-A tail. The Drosha ribonuclease III enzyme cleaves the primary transcript to form a precursor miRNA (pre-miRNA) with a stem-loop structure, approximately 70 nucleotides long. This pre-miRNA is then further processed by the Dicer ribonuclease in the cytoplasm to produce the mature miRNA and its complementary strand, known as the miRNA star (miRNA*). The mature miRNA is then incorporated into a RNA-induced silencing complex (RISC), which identifies target mRNAs through imperfect base pairing with the miRNA, typically leading to either translational repression or destabilization of the target mRNA. The specific miRNA miR-601 was chosen for its targetting on the mRNA 3'UTR-C1q. But was later not implemented into our project due to time limitations and other feasibility considerations. |
5' UGGUCUAGGAUUGUUGGAGGAG 3' | high target score in mirDB, relevance to leptospirosis affected organ spots, potential biomarkers of leptospira at organ failure stage | BBa_K5162008 |
| miR-21-5p mature | MicroRNAs (miRNAs) are short, non-coding RNAs (20-24 nucleotides) that play a crucial role in the post-transcriptional regulation of gene expression in multicellular organisms by influencing the stability and translation of mRNAs. These miRNAs are transcribed by RNA polymerase II as part of primary transcripts (pri-miRNAs), which can be either protein-coding or non-coding and feature a cap and poly-A tail. The Drosha ribonuclease III enzyme cleaves the primary transcript to form a precursor miRNA (pre-miRNA) with a stem-loop structure, approximately 70 nucleotides long. This pre-miRNA is then further processed by the Dicer ribonuclease in the cytoplasm to produce the mature miRNA and its complementary strand, known as the miRNA star (miRNA*). The mature miRNA is then incorporated into a RNA-induced silencing complex (RISC), which identifies target mRNAs through imperfect base pairing with the miRNA, typically leading to either translational repression or destabilization of the target mRNA. The specific miRNA miR-21-5p was chosen for its targetting on the mRNA 3'UTR-TLR2. But was later not implemented into our project due to time limitations and other feasibility considerations. |
5' UAGCUUAUCAGACUGAUGUUGA 3' | high target score in mirDB, relevance to leptospirosis affected organ spots, potential biomarkers of leptospira at organ failure stage | BBa_K5162009 |
| Pmir-Xho1-cFH-F | foward primer of Pmir-CFH | 5' CGAGCTCGCTAGCCTCGAGAATCAATCATAAAGTGCACA 3' | a primer was needed to put insert into pmirglo vector | BBa_K5162013 |
| Pmir-Xba1-cFH-R | reverse primer of Pmir-CFH | 5' GCCTGCAGGTCGACTCTAGATAGTTTTCCAGGATTTAATATGG 3' | a primer was needed to put insert into pmirglo vector | BBa_K5162014 |
| Pmir-Xho1-C3-F | foward primer of Pmir-C3 | 5' CGAGCTCGCTAGCCTCGAGTCCTACAACCACATGC 3' | a primer was needed to put insert into pmirglo vector | BBa_K5162015 |
| Pmir-Xba1-C3-R | reverse primer of Pmir-C3 | 5' GCCTCAGGTCGACTCTAGATAACATGTGAGTAAGATCAGTAACGTG 3' | a primer was needed to put insert into pmirglo vector | BBa_K5162016 |
| Xba1-TLR2-F | foward primer of Pmir-TLR2 | 5' GGG GTC TAG AGA ATG CAA TAA C 3' | a primer was needed to put insert into pmirglo vector | BBa_K5162017 |
| Sal1-TLR2-R | reverse primer of Pmir-C3 | 5' GTC GAC AAA TCT GGC ATA 3' | a primer was needed to put insert into pmirglo vector | BBa_K5162018 |