PetalGlow

Basic Part

Part Name	Gene Name	Organism	Gene Loci	Gene Description	Forward Primer (5'->3')	Reverse Primer (5'->3')	Length	Part Type	Short Description
BBa_K5218001	RcTAL	Rhodobacter Capsulatus	non	Tyrosine ammonia lyase (TAL) gene from Rhodobacter capsulatus	TACACCAAATCGACTCTAGAAAGCTTGGATCCatgacgctccaatcacagactg	TCCTCGCCCTTGCTCACCATGGTACCaccactagccggagggtcggc	1599	Coding	Tyrosine ammonia-lyase (TAL) that catalyzes the formation of p-coumaric acid from tyrosine.
🍩BBa_K5218005	RtTAL	Rhodosporidium Toruloides	non	Tyrosine ammonia lyase (TAL) gene from Rhodosporidium toruloides	TACACCAAATCGACTCTAGAAAGCTTGGATCCATGGCTCCTTCTTTGGATTCTATTTCT	TCCTCGCCCTTGCTCACCATGGTACCAGCCAACATCTTCAACAAAACATTATTAATTC	2148	Coding	Tyrosine ammonia-lyase (TAL) that catalyzes the formation of p-coumaric acid from tyrosine.
BBa_K5218025	NoRtTAL	Rhodosporidium Toruloides	non	Tyrosine ammonia lyase (TAL) gene from Rhodosporidium toruloides	TACACCAAATCGACTCTAGAAAGCTTGGATCCATGGCACCCTCGCTCGACTC	TCCTCGCCCTTGCTCACCATGGTACCAGCGAGCATCTTGAGGAGG	2148	Coding	Tyrosine ammonia-lyase (TAL) that catalyzes the formation of p-coumaric acid from tyrosine.
🍩BBa_K5218002	AtC3H	Arabidopsis Thaliana	AT2G40890	cytochrome P450, family 98, subfamily A, polypeptide 3	TACACCAAATCGACTCTAGAAAGCTTGGATCCCATGTCGTGGTTTCTAATAGCG	TCCTCGCCCTTGCTCACCATGGTACCcatatcgtaaggcacgcgtttg	1524	Coding	p-coumaric acid 3-hdroxylase that catalyzes the formation of caffeic acid from p-coumaric acid.
BBa_K5218007	PpC3H	Physcomitrella Patens	LOC112275074	cytochrome P450 98A3-like	TACACCAAATCGACTCTAGAAAGCTTGGATCCTGGGTCAACCGCTTCACATT	TCCTCGCCCTTGCTCACCATGGTACCcgaaggggatgatccgtttttg	1601	Coding	p-coumaric acid 3-hdroxylase that catalyzes the formation of caffeic acid from p-coumaric acid.
BBa_K5218009	CrC3H	Catharanthus Roseus	JAMLDZ010000192.1	hypothetical protein	TACACCAAATCGACTCTAGAAAGCTTGGATCCTTCTTCCCCACTACCGCCAA	TCCTCGCCCTTGCTCACCATGGTACCtatatccacaggcacgcgtttg	1569	Coding	p-coumaric acid 3-hdroxylase that catalyzes the formation of caffeic acid from p-coumaric acid.
BBa_K5218013	SlC3H	Solanum Lycopersicum	LOC101246092	cytochrome P450 98A2	TACACCAAATCGACTCTAGAAAGCTTGGATCCACAATGGCTATTCCCATTCCTT	TCCTCGCCCTTGCTCACCATGGTACCcatgtcgactgcaattcgtttatac	1545	Coding	p-coumaric acid 3-hdroxylase that catalyzes the formation of caffeic acid from p-coumaric acid.
BBa_K5218011	NtC3H	Nicotiana Tabacum	LOC107803600	cytochrome P450 98A2-like	TACACCAAATCGACTCTAGAAAGCTTGGATCCACAATGGCTATTTCTTTAGCTGC	TCCTCGCCCTTGCTCACCATGGTACCcatgtccactgcaattcgtttatac	1536	Coding	p-coumaric acid 3-hdroxylase that catalyzes the formation of caffeic acid from p-coumaric acid.
BBa_K5218015	RcC3H	Rosa Chinensis	LOC112191575	cytochrome P450 98A2	TACACCAAATCGACTCTAGAAAGCTTGGATCCTTCCGGCCTCTGCCAATTTC	TCCTCGCCCTTGCTCACCATGGTACCcatttcagcttccacacgtttg	1569	Coding	p-coumaric acid 3-hdroxylase that catalyzes the formation of caffeic acid from p-coumaric acid.
BBa_K5218017	GRF3	Arabidopsis Thaliana	AT5G38480	GENERAL REGULATORY FACTOR 3 general regulatory factor, a 14-3-3 gene	CACGGTATCGATAAGCTCGCGGATCCTCTGGCCTAAAACGAAACCG	ctcagatctaccatGGTACCGGATCCAATCTGACACGTGTGTAGCCA	1783	Promoter	Regulate the response of plants to HCHO stress.
BBa_K5218019	GS1	Arabidopsis Thaliana	AT5G57440	Other Names: GLYCEROL-3-PHOSPHATASE 2;GPP2;GS1 A member of haloacid dehalogenase-like hydrolase family, HAD-type phosphosugar phosphatase. Together with MDH1 indispensable for Arabidopsis to metabolize HCHO.	CACGGTATCGATAAGCTCGCGGATCCGATCCGGAGATGGGTTGCAG	ctcagatctaccatGGTACCGGATCCACCGATAACGACGAACCGAAT	997	Promoter	Regulate the response of plants to HCHO stress.
BBa_K5218021	MDH1	Arabidopsis Thaliana	AT1G04410	Other Names: C-NAD-MDH1;CYTOSOLIC-NAD-DEPENDENT MALATE DEHYDROGENASE 1;NDH1 predicted to encode a cytosolic malate dehydrogenase. Together with GS1 indispensable for Arabidopsis to metabolize HCHO.	ctcagatctaccatGGTACCGGATCCGGAGATTATCGCCGGAAAACG	CACGGTATCGATAAGCTCGCGGATCCTGGACGTGGTTCTTCTCGC	340	Promoter	Regulate the response of plants to HCHO stress.

Composite Part

Part Accession	Part Name	Type	Length(bp)	Description
BBa_K5218003	pS1300-AtC3H-GFP	plasmid	12,252	AtC3H gene fused with GFP reporter gene for functional characterization
BBa_K5218004	pS1300-RcTAL-GFP	plasmid	12,326	RcTAL gene fused with GFP reporter gene for functional characterization
BBa_K5218006	pS1300-RtTAL-GFP	plasmid	12,875	RtTAL gene fused with GFP reporter gene for functional characterization
BBa_K5218008	pS1300-PpC3H-GFP	plasmid	12,328	PpC3H gene fused with GFP reporter gene for functional characterization
BBa_K5218010	pS1300-CrC3H-GFP	plasmid	12,296	CrC3H gene fused with GFP reporter gene for functional characterization
BBa_K5218012	pS1300-NtC3H-GFP	plasmid	12,263	NtC3H gene fused with GFP reporter gene for functional characterization
BBa_K5218014	pS1300-SlC3H-GFP	plasmid	12,272	SlC3H gene fused with GFP reporter gene for functional characterization
BBa_K5218016	pS1300-RcC3H-GFP	plasmid	12,296	RcC3H gene fused with GFP reporter gene for functional characterization
BBa_K5218018	p1300-GRF3-GUS	plasmid	12,727	GRF3 promoter fused with GUS reporter gene for functional characterization
BBa_K5218020	p1300-GS1-GUS	plasmid	11,938	GS1 promoter fused with GUS reporter gene for functional characterization
BBa_K5218022	p1300-MDH1-GUS	plasmid	11,281	MDH1 promoter fused with GUS reporter gene for functional characterization
BBa_K5218026	pS1300-NoRtTAL-GFP	plasmid	12,875	NoRtTAL gene fused with GFP reporter gene for functional characterization
BBa_K5218023	p1300-pGRF3-RtTAL-GFP	plasmid	13,542	GRF3 promoter fused with RtTAL and GFP reporter gene for functional characterization
🍩BBa_K5218024	p1300-pGRF3-AtC3H-GFP	plasmid	12,919	GRF3 promoter fused with ATC3H and GFP reporter gene for functional characterization