Results

Contents

Wet Lab Objectives

We aim to express and extract thermostable TdT (ThTdT) to add nucleotides to the 3’ end of a DNA strand in a template-independent fashion. The expression prototype was optimized through in vitro liquid-phase synthesis, followed by solid-phase nucleotide addition of immobilized primers on a glass slide.

1. Cloning

Goal

The first step towards our cloning objective is to express ThTdT in the E. coli BL21 DE3 strain for protein expression.

Design

ThTdT sequence from Chua et al. (2020) was synthesized as a G-block by IDT 1. A pET-28b(+) plasmid was sourced from Novagen and linearized via inverse PCR to remove the N- and C-terminus His6 affinity tags. Using Gibson assembly, the ThTdT G-block was inserted into the pET-28b(+) plasmid. Following transformation into chemically competent DH5a E. coli, the plasmids were then extracted and expressed in the E. coli BL21 strain.

results-fig-1.png

Figure 1: pET-28b(+) plasmid map with ThTdT insert.

Result

ThTdT was successfully cloned into the E Coli. BL21 strain. The sequence was confirmed using colony PCR and sequencing from Plasmidosaurus.

results-fig-2.png

Figure 2: LB-Kanamycin (50 µg/ml) plate, plated with 30 bp overhang Gibson assembly product.

results-fig-3.png

Figure 3: Colony PCR confirmation of Gibson assembly and from LB-Kanamycin plate transformants using primers P3 and P4. 1 kb DNA size ladder. 10% Agarose gel, 45 min, 120 V, SYBR Safe. Product size of ~1500 bp. Ladder: 1 kb DNA size ladder, C1: Colony 1, C2: Colony 2, C3: Colony 3, C4: Colony 4, R1: ThTdT gBlock. P3:TTCCTTTCGGGCTTTGTTAGCAGCCGGATCCTAAGCATTTCTTTCCCATGGTTCA, P4:ATTTTGTTTAACTTTAAGAAGGAGATATACATGGGCAGCAGCCATCATC.

Conclusion

Based on the results, we confirmed that our 1st wet lab objective was achieved and ThTdT was successfully cloned into E. coli BL21.

2. Protein Purification

Goal

After confirming that our plasmid with the ThTdT insert was successfully transformed into BL21 DE3, our next goal was to express and purify ThTdT for in vitro ssDNA elongation.

Design

ThTdT expression was induced in transformed E. coli BL21(DE3) using IPTG. The cells were mechanically lysed, and ThTdT was extracted using Ni-NTA magnetic beads, targeting the N-terminus His-tag. However, without dialysis, we could not observe nucleotide addition with the extracted ThTdT. To resolve this, we used a centrifugal filter to exchange the elution buffer with a storage buffer identical to the one used by NEB, supplemented with 0.1 mM 2,2’-bipyridyl to remove possible residual Ni2+.

Result

ThTdT purification was successful as indicated by SDS-PAGE. This indicated that ThTdT’s efficiency in nucleotide addition can be subsequently analyzed through lipid phase synthesis experiments.

results-fig-4.png

Figure 4: SDS-PAGE of ThTdT isolated after magnetic beads purification. 120 V, 1.5 h, Coomassie Blue staining. MW: Molecular Ladder, L: Cell lysate, E1: elution fraction 1, E2: elution fraction 2.

Conclusion

Based on our SDS-PAGE results, we confirmed that ThTdT purification was successful. The purified ThTdT was then used in subsequent experiments for liquid-phase synthesis, solid-phase synthesis, and microfluidics experiments.

3. Liquid Phase Synthesis (1)

Goal

Following a successful purification of ThTdT, our next goal was to verify the addition of dNTPs using ThTdT.

Design

The first step of our experimental design was to establish a standard assay with commercially available WT TdT. Using 1X TdT reaction buffer (NEB), 0.5 U/µL WT TdT (NEB), and 100 nM 5’-fluorescently labeled primer, we tested dNTP additions with different concentrations of nucleotide triphosphates (0.3 µM, 3 µM, 20 µM) at 37ºC.

Result

The retardation in gel bands shown in the figure below demonstrated mass addition relative to the primer, showing that nucleotides were added to the primer as demonstrated in DNA PAGE.

results-fig-5.png

Figure 5: WT Liquid phase synthesis reactions visualized on 20% Urea Page, imaged using Cy5 flurophore detection.

Conclusion

The gel results above confirmed a successful nucleotide addition, establishing a baseline assay condition for the next liquid phase synthesis objective.

4. Liquid Phase Synthesis (2)

Goal

Following a successful establishment of a baseline assay condition, our next goal was to identify suitable reaction conditions to support dNTP additions in preparation for solid phase synthesis experiments.

Design

With a successful base condition, we aimed to test the biological activity of ThTdT. Since NEB quantified their WT TdT product in units of U/µL, the conversion to mass concentration was not apparent; a direct comparison between the NEB’s WT TdT and in-house ThTdT was difficult to establish. To explore the catalytic reactivity of ThTdT, two concentrations were tested. The effects of dNTP and $CoCl_2$ concentrations on ThTdT’s enzymatic activity were also investigated.

Result

We were able to characterize ThTdT’s ssDNA 3’-extension abilities after optimization experiments.

results-fig-6.png

Figure 6: 3’-extension by wild type terminal deoxynucleotidyl transferase (WT TdT) and thermostable terminal deoxynucleotidyl transferase (ThTdT) using primer P2 /56FAM/AGCCTGTTGTGAGCCTCCTAAC at 37ºC for 15 min. [Primer P2] = 100nM, [CoCl2] = 250 µM, [dNTP] = 1 µM. 20% D-PAGE, 30 min, 400V. Imaged using Cy3 setting.

Conclusion

Based on the gel images shown above, we confirmed ThTdT’s ability to add all 4 types of dNTPs at the 3’ end. We also identified Co2+ as an enhancer for ThTdT’s enzymatic ability.

5. ThTdT Thermostability Testing using Liquid Phase Synthesis

Goal

Chua et al. (2020) stated that ThTdT conferred greater thermostability, enabling improved enzymatic functionality at higher temperatures 1. Therefore, our team’s next goal was to test whether our in-house ThTdT had the same characteristics.

Design

Our experimental design was set to test ThTdT’s stability across a temperature gradient: 37°C, 40°C, 44°C, 47°C, 51°C, and 55°C.

Result

The experimental results indicated similar dNTP addition patterns across the temperature gradient. However, primer utilization was observed to be incomplete.

results-fig-7.png

Figure 7: Nucleotide addition to primer using WT TdT with varying dNTP concentration. Primer P1 /5Biosg/ ATT CGrA TCA /iCy5/CTA GCA TAC TAT CAT TCG GGG. [Primer] = 100 nM. Reaction Time = 30 min. Temperature = 37ºC. Denaturing Urea PAGE, 20%, 400 V, 30 min.

A similar DNA addition pattern was observed across the temperature gradient. However, primer utilization was incomplete.

Conclusion

Our experimental results demonstrated that ThTdT retained its dNTP addition ability at higher reaction temperatures. However, more follow-up experiments must be completed to identify a condition that completely utilizes the primer.

6. Solid Phase Synthesis (1)

Goal

Our goal with this wet lab objective was to first immobilize a DNA primer to a glass substrate

Design

The first step was to validate our chosen immobilization strategy: leveraging the impressive biotin-avidin interaction. A glass microscope slide was biotinylated using biotin-PEG-SVA and incubated with Streptavidin then our biotinylated primer P1. From an analysis of various conditions and reagent concentrations, it was discovered that 1% biotin-PEG-SVA and 300nM biotinylated DNA primer offered the greatest results.

Result

Imaging of the glass slide following DNA primer immobilization was carried out under Cy5 parameters. Three trials were conducted, resulting in three spots of intense signal corresponding to clusters of immobilized primer.

results-fig-8.png

Figure 8: Fluorescence imaging of microscope glass slide with Cy5 fluorescently labeled primer P1 immobilized at selected locations, prior to ThTdT extension. P1 /5Biosg/ATTCGrATCA/iCy5/CTAGCATACTATCATTCGGGG

Conclusion

This result showed that biotinylated primer was successfully immobilized on the glass substrate, paving the way for TdT-mediated extension.

7. Solid Phase Synthesis (2)

Goal

Our next experimental goal with SPS was to perform TdT-mediated DNA extension and visualize the results through gel electrophoresis.

Design

With a successful immobilization, we aimed to perform a TdT-mediated extension reaction on the DNA primer using DTTP as the nucleotide substrate. The reaction was performed on each immobilized primer cluster for 30 minutes. Reaction conditions involved 0.25uL ThermoTdT enzyme, 10uM DTTP and 250uM CoCl2 at 37oC. Following the reaction, the glass slide was rinsed with water to quench the reaction and imaged under Cy5 parameters to ensure the presence of P1 primer clusters. The primers were then cleaved with loading buffer in 0.1 M NaOH, with each cluster cleaved by the same 1uL solution to maximize the concentration of primer in solution and aid visualization. The glass slide was imaged following incubation with the NaOH solution to ensure effective cleavage, the image is shown below. The loading buffer solution was analyzed by SDS-PAGE and compared to varying concentrations of P1 primer standard to benchmark efficiency.

Result

The images of the glass slide before and after primer cleavage following thermoTdT extension are shown below. A clear loss of signal is observed. Following cleavage from the solid phase, the extension product was analyzed through SDS-PAGE, the results of which are shown below. Various bands of larger molecular weight DNA fragments are observed.

results-fig-9.png

Figure 9: Fluorescence imaging of microscope glass slide with Cy5 fluorescently labeled primer P1 immobilized at selected locations, prior to (A) and after (B) cleavage following ThTdT extension. P1 /5Biosg/ATTCGrATCA/iCy5/CTAGCATACTATCATTCGGGG.

results-fig-10.png

Figure 10: 3’-extension by ThTdT on using primer P1 /5Biosg/ATTCGrATCA/iCy5/CTAGCATACTATCATTCGGGG immobilized on microscope glass slide at 37ºC for 30 min. Lanes 1, 2, and 3 contains 10 fmol, 1 fmol, and 100 amol P1. Lane 4 contains reaction crude from SPS, reacted in [CoCl2] = 250 µM, [dTTP] = 10 µM. 20% D-PAGE, 30 min, 400V. Imaged using Cy5 setting.

Conclusion

Thermostable TdT-mediated primer extension on a solid glass surface was successfully demonstrated. ThTdT incorporated DTTP nucleotides, to result in a product of higher molecular weight than the primer standards. Thus, enzymatic template-free semi-specific DNA synthesis on a solid substrate has been successfully demonstrated.

Dry Lab Objectives

Software

In-silico, we were able to demonstrate that we can encode and decode text files, and we also added the ability to compress and block files. Unfortunately, we did not test the software on real data, but more about our design and theory can be read here.

Hardware

The hardware team designed and constructed multiple iterations of a 3D-printed and affordable bioreactor; each iteration was further refined with more control features based on user feedback.

results-fig-10.png

Figure 11: Image of fully-assembled bioreactor Mk. 3

We also designed various LPS and SPS microfluidic chips to scale-up the benchtop reactions to demonstrate nuCloud’s potential to be scaled up into a biomanufacturing platform. Each design was tested via fluid simulations and physical testing after fabrication. Subsequent experiments were performed to validate its functionality and demonstrate subteam integration with wet lab.

results-fig-11.jpg

Figrue 12: Image of fabricated LPS and SPS microfluidic chips

To further support how nuCloud’s DNA synthesis reactions can be automated, we designed and constructed microfluidic pumps that could automate reagent delivery via motor-controlled syringes.

results-fig-12.jpg

Figure 13: Image of fully-assembled microfluidic pump (right) with a syringe installed for automated reagent delivery into the microfluidic chips (left).

References

  1. Chua, J. P. S., Go, M. K., Osothprarop, T., Mcdonald, S., Karabadzhak, A. G., Yew, W. S., Peisajovich, S., & Nirantar, S. (2020). Evolving a Thermostable Terminal Deoxynucleotidyl Transferase. ACS synthetic biology, 9(7), 1725–1735. https://doi.org/10.1021/acssynbio.0c00078 ↩ ↩2