Proof of Concept

Contents

Overview

Our proof of concept (POC) aims to demonstrate that storing data in DNA can be transformed into a feasible and viable product. In this section, we detail design of our POC, including tangible criteria for success, with the eventual goal of being able to encode, synthesize, store and decode DNA sequences of 150 nucleotides long. We describe our decision-making process and outline the checkpoints where we will seek feedback from stakeholders and reassess our objectives, along with a timeline for each step.

Milestone 1: Cloning

Our first milestone was cloning ThTdT into the pET-28b(+) plasmid. We chose pET-28b(+) since a previous study by Chua et al. (2020) succeeded in cloning terminal transferase using this plasmid 1. After several setbacks—including delayed shipments, lost reagents, incorrect E. coli strains for transformation, and cloning errors—we successfully transformed the plasmid into BL21 E. coli for high protein expression.

poc-fig-1.png

Figure 1: pET-28b(+) plasmid map with ThTdT insert.

poc-fig-2.png

Figure 2: LB-Kanamycin (50 µg/ml) plate, plated with 30 bp overhang Gibson assembly product.

poc-fig-3.png

Figure 3: SDS-PAGE of ThTdT isolated after magnetic beads purification. 120 V, 1.5 h, Coomassie Blue staining. MW: Molecular Ladder, L: Cell lysate, E1: elution fraction 1, E2: elution fraction 2.

Milestone 2: Protein Expression and Purification

The second milestone was the expression and purification of our mutant protein ThTdT. Instead of using an HPLC, Ni-NTA magnetic beads were employed to purify the protein of interest 1. After a step-wise optimization in elution strength, we successfully expressed and purified our ThTdT within an optimized storage buffer to help extend its shelf life. In addition, by-product imidazole from the elution buffer was removed using a centrifugal filter. Protein concentration was determined using a BCA protein assay.

Milestone 3: Establishing a Liquid Phase Synthesis system

Our third milestone was the establishment of a valid liquid phases synthesis system that would allow the successful detection of DNA addition. Using WT TdT as a control, we validated that WT TdT can add nucleotides by DNA PAGE using a 5’-fluorescence labeled primer.

poc-fig-4.png

Figure 4: Nucleotide addition to primer using WT TdT with varying dNTP concentration. Primer P1 /5Biosg/ ATT CGrA TCA /iCy5/CTA GCA TAC TAT CAT TCG GGG. [Primer] = 100 nM. Reaction Time = 30 min. Temperature = 37ºC. Denaturing Urea PAGE, 20%, 400 V, 30 min.

Milestone 4: ThTdT Functional Characterization

Our fourth milestone ThTdT was successfully produced and tested for its ability to append nucleotides at the 3’ end, using the conditions established in Milestone 3.

poc-fig-5.png

Figure 5: 3’-extension by wild type terminal deoxynucleotidyl transferase (WT TdT) and thermostable terminal deoxynucleotidyl transferase (ThTdT) using primer P2 /56FAM/AGCCTGTTGTGAGCCTCCTAAC at 37ºC for 15 min. [Primer P2] = 100nM, [CoCl2] = 250 µM, [dNTP] = 1 µM. 20% D-PAGE, 30 min, 400V. Imaged using Cy3 setting.

Milestone 5: SPS

P1 biotinylated primer was successfully immobilized on a biotinylated glass surface following Streptavidin incorporation. Imaging under Cy5 parameters shows distinct loci of immobilized clusters.

poc-fig-6.png

Figure 6: Fluorescence imaging of microscope glass slide with Cy5 fluorescently labeled primer P1 immobilized at selected locations, prior to ThTdT extension. P1 /5Biosg/ATTCGrATCA/iCy5/CTAGCATACTATCATTCGGGG

Milestone 6: ThTdT-Mediated SPS

Thermostable TdT successfully incorporated DTTP nucleotides to the immobilized primers. Following the incorporation, the DNA was cleaved from the glass and analysed through SDS-PAGE. The glass before and after cleavage following thermostable TdT extension was imaged to validate the cleavage step.

poc-fig-7.png

Figure 7: Fluorescence imaging of microscope glass slide with Cy5 fluorescently labeled primer P1 immobilized at selected locations, prior to (A) and after (B) cleavage following ThTdT extension. P1 /5Biosg/ATTCGrATCA/iCy5/CTAGCATACTATCATTCGGGG.

poc-fig-8.png

Figure 8: 3’-extension by ThTdT on using primer P1 /5Biosg/ATTCGrATCA/iCy5/CTAGCATACTATCATTCGGGG immobilized on microscope glass slide at 37ºC for 30 min. Lanes 1, 2, and 3 contains 10 fmol, 1 fmol, and 100 amol P1. Lane 4 contains reaction crude from SPS, reacted in [CoCl2] = 250 µM, [dTTP] = 10 µM. 20% D-PAGE, 30 min, 400V. Imaged using Cy5 setting.

References

  1. Chua, J. P. S., Go, M. K., Osothprarop, T., Mcdonald, S., Karabadzhak, A. G., Yew, W. S., Peisajovich, S., & Nirantar, S. (2020). Evolving a Thermostable Terminal Deoxynucleotidyl Transferase. ACS synthetic biology, 9(7), 1725–1735. https://doi.org/10.1021/acssynbio.0c00078 ↩ ↩2