Notebook

Week by Week write up

WEEKS

W/C 17^th June Lab Notebook

17^th June 2024

Experiments:

• PafA-Pet21a was transformed into BL21 E.Coli using transformation protocol.~13 ng of DNA.
• Our advisor generated five fragments via PCR that can then be golden gate clones together to develop a pet21a_BsaI plasmid backbone and a pet21a_sfGFP backbone.
  

  Desired Fragment Length (bp)	Primers used (see table below)	What is this fragment?
  3918	1, 4	Backup pET21a with the BsaI site in AmpR removed. BsaI site added at MCS. Fragment 1 of 2.
  1526	3, 2	Backup pET21a with the BsaI site in AmpR removed. BsaI site added at MCS. Fragment 2/2
  3908	1, 6	pet21a(+)-sfGFP
  1504	5, 2	pET21a(+)-sfGFP
  883	7, 8	pJUMP21-1A

  
  

  Primer Label	Primer Name	Sequence
  1	pET21a_BsaI_MCS_GFP_REV	GCCGGTGAGCGTGGcTCTCGCGGTATCATTGCAGCAC
  2	pET21a_BsaI_AmpR_REV	AATGATACCGCGAGAGCCACGCTCACCGGCTCC
  3	pET21a_BsaI_MCS_FWD	AGAAGGAGATATACAAATGCGAGACCGGTCTCTGCTTTACACCACCACCACCACCACTG
  4	pET21a_BsaI_MCS_REV	GACCGGTCTCgCATtTGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGG
  5	pET21a_BsaI_MCS_GFP_FWD	CGCTGGTCTCTGCTTTACACCACCACCACCACCACTG
  6	pET21a_BsaI_MCS_GFP_REV	ACATTTGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGG
  7	pET21a_BsaI_GFP_FWD	TTTAACTTTAAGAAGGAGATATACAAATGTGAGACCGGAGTTGACGGCTAG
  8	pET21a_BsaI_GFP_REV	GGTGGTGGTGGTGTAAAGCAGAGACCAGCGTGCAACTCAGT

  
  

  Fragments were mixed together to form pet21_sfGFP and the fragments were mixed to form pet21_BsaI. This was assembled using golden gate assembly. Following NEBs protocol, but instead of using the mixture of BsaI and ligase they provide, we instead add 1µl of BsaI and 1µl of Ligase.

Results:

• Transformed BL21 were plated on an LB Agar plate containing ampicillin. The gel of the five fragments is seen below and all bands are around the right size, confirming a successful PCR.
  

Extra Notes:

• All members of the team became aware of where all necessary equipment and materials for the project were located.
• The appropriate safety disclaimers were signed by each member of the team and demonstrations were given for how to safely use all equipment that would be needed throughout the project.
• All members of the team completed digital health and safety and waste management training.
• Team leaders completed autoclave training.

W/C 17^th June Lab Notebook

18^th June 2024

Experiments:

• If the transformation was successful, add a colony of the transformed BL21 to a mixture of LB broth and ampicillin and allow it to grow overnight.

Results:

• The transformation from the 17th of June was successful. Therefore a colony of BL21 from the petri dish was added to a mixture of 5ml of LB broth and 5μl of ampicillin. The sample was then left to grow overnight.
• It was also confirmed that a control plate showing a positive pJUMP28 transformation had been successful. This plate was then discarded.

Extra Notes:

• Transformation training was carried out for all members of the lab team.
• Restriction digest training was also completed by all lab members.

W/C 17^th June Lab Notebook

19^th June 2024

Experiments:

• Produce a 1ml glycerol stock of PafA-BL21.
• Inoculate 2x duran bottles containing 500ml LB and ampicillin using overnight samples of PafA from 18th June. Then allow this to grow to an optical density of 0.4-0.6. Then induce by adding 500μM of IPTG and leave to express PafA overnight by incubating at 18°C.
• Our advisors (Brooks Rady and Isaac White) helped us to develop a backbone to enable easier screening of colonies= pet21-sfGFP with BsaI sites surrounding the GFP. This plasmid was transformed into DH5α.

Results:

• Glycerol stock was produced
• PafA was induced and left to incubate overnight
• Transformation of an advisor’s backbone structures

Extra Notes:

• Agarose gel training was carried out
• PCR training was completed

W/C 17^th June Lab Notebook

20^th June 2024

Experiments:

• Overnights made using Brook’s Pet21a-sfGFP
• Buffers for protein purification were made

Results:

• PCR products (amplified PhoA) were run on a gel. First three lanes were the correct size. The corresponding PCR product was purified and pooled together on 25/6/24. The Nanodrop gave a result of 210ng/μL, 38μL.
  

Extra Notes:

• MiniPrep Training Completed
• PCR Cleanup Training Completed
• Team leaders trained on how to use sonicator and high speed centrifuge

W/C 17^th June Lab Notebook

21^st June 2024

Experiments:

• Miniprep of Brooks’ Pet21a-sfGFP ligation completed.

Results:

• No Results, nanodrop of miniprep pending.

Extra Notes:

• Thomas provided training for all other members of the lab team on how to code on the Wiki and how to add, commit and push changes onto it.

W/C 24^th June Lab Notebook

24^th June 2024

W/C 24^th June Lab Notebook

25^th June 2024

Experiments:

• Gel electrophoresis of pet21a-sfGFP w/ BsaI (from 24/06/2024)
• Gel electrophoresis of PhoA w/ BsaI
• Purification of PafA
• SDS-PAGE of purified PafA
• Determine PhoA DNA conc. & digest w/ BsaI-HFV2
• Gel electrophoresis of PhoA w/ BsaI
• Transformation of pet21a-sfGFP into DH5⍺
• Overnight incubation of pet21a-sfGFP DH5⍺

Results:

• pet21a-sfGFP w/ BsaI gel electrophoresis -
  
  *Lane 1 was ladder and then the proceeding was colonies 1-5
• PhoA w/ BsaI gel electrophoresis -
  
  
  1. 100bp DNA Ladder - Invitrogen
  2. BsaI digest on PhoA →- Right size!
  3. pET21a-sfGFP-1
  4. pET21a-sfGFP-2
  5. pET21a-sfGFP-3
  6. pET21a-sfGFP-4
  7. pET21a-sfGFP-5
  8. 100bp DNA Ladder - Invitrogen
• SDS-PAGE w/ PafA -
  
  
  • FT = Flow through
  • BB = Binding buffer
  • WB = Wash buffer
  • E = Elution
• PhoA w/ BsaI digest was run on a gel and showed a band of the correct size so PhoA is ready for ligation

W/C 24^th June Lab Notebook

26^th June 2024

Experiments:

• SDS-PAGE with product of PafA purification (in addition to other liquids from the nickel column to ensure no PafA had been lost)
• pet21a-sfGFP ligation
• Transformation of pet21a-sfGFP digest into DH5⍺
• Minipreps of pet21a-sfGFP and pet21a backbones then nanodropping to determine concentration
• 20ml of o/n pet21a-sfGFP Colony 1 transformation produced
• 10ml of o/n pet21a(+) produced

Results:

• PafA SDS-PAGE:
  
  Wells:
  1. BLUeye Pre-Stained Protein Ladder (10-245kDa) - GeneFlow - 4µl
  2. FT
  3. BB
  4. WB
  5. FT of PD10
  6. Sample Concentrator (blue lid, screwy centrifuge tube)
  7. FT in sample concentrator (EB1 & EB2)
  8. FT in sample concentrator (EB3, EB4, & EB5)
  9. Purified PafA
  10. BLUeye Pre-Stained Protein Ladder (10-245kDa) - GeneFlow - 4µl
• Transformation of pet21a-sfGFP digest (Both glowing and non-glowing colonies were observed):
  

  Miniprep No.	Pet21a-sfGFP Miniprep DNA conc (µg/ml)	Pet21a(+) Miniprep conc (µg/ml)
  1	-	74
  2	-	58
  3	-	50
  4	111	51
  5	38	47

Extra Notes:

Minipreps:
All solutions were resuspended in 30µl of mP6 in the final step APART from no. 4 Pet21a Backbone (w/o vsGFP)* which was resuspended in 50ng/µl.

W/C 24^th June Lab Notebook

27^th June 2024

Experiments:

• Miniprep O/Ns of pet21a-sfGFP (Colony 1) and pet21a(+)
• More PhoA amplified from g-block
• Golden Gate assembly of pet21a-sfGFP (Colony 1), PhoA, BsaI-HFv2 using T4 DNA ligase buffer
• Gel electrophoresis of Golden Gate results

Results:

pet21a-sfGFP Miniprep conc (µg/ml):

• 54
• 70
• 79
• 25

Pet21a(+) Miniprep conc (µg/ml):

• 60
• 66

Golden Gate assembly gel electrophoresis:

Wells:

1. 1kb DNA Ladder
2. Digested pET21a-sfGFP (Colony 1) - same that was sent for sequencing after transforming, amplifying and mini prepping again
   • We can see two clear bands next to each other. We think the upper one is undigested plasmid and the second one is the backbone fragment.
   • If we change the light exposition we think we can faintly see a band ~850bp, the size of sfGFP.
3. Digested pET21a(+)*

Extra Notes:

*Mistake made - it was meant to be pET21a-BsaI (the backup backbone).

W/C 1^st July Lab Notebook

1^st & 2^nd July 2024

Experiments:

• Colony PCR was performed on six transformant colonies containing PhoA in the pet21a vector using pet forward and reverse primers with a 1 minute 45 second extension time. We used 35 µl of PCRBIO Taq 2x Polymerase red mix, 2.8 µL of pet forward+reverse primer (10 µM), 32.2 µL of sterile water to make up a total volume of 70 µL.
• We added 10 µL of this solution to small Eppendorfs and added the transformant colonies containing PhoA in the pet21a vector. The colonies were then streaked on scratch plates and the pipette tip was dropped into an LB overnight made of 5ml agar and 5l ampicillin.
• A gel electrophoresis was done on the PhoA samples using 1 kb Plus DNA ladder.

Results:

Electrophoresis of PhoA samples. A 1 kb Plus DNA was used for both these gels.

Extra Notes:

• The growth colony electrophoresis results implied that it should have worked because only a few bands glowed and the rest were not glowing. However we are not sure how the pet21a could have turned back into a plasmid without having PhoA as the backbone. This could have been due to some ligation error as the labelling was not clear and we weren’t sure if the PhoA had BsaI sites. So we will do ligation again with newly amplified PhoA.
• The colony PCR protocol was revised with new concentrations to account for inaccuracies.

W/C 1^st July Lab Notebook

4^th July 2024

Experiments:

• Ligation of PhoA and Pet21a was done using BsaI Golden Gate assembly protocol.
• 3 Ligations of Pet21a and PhoA were made:
• • 2.5 µl of 70ng/µl pet21-sfGFP + 13.0 µl of distilled water
  • 4.0 µl of 54ng/µl pet21-sfGFP + 11.5 µl of distilled water
  • 2.5 µl of 79ng/µl pet21-sfGFP + 13.0 µl of distilled water
• All 3 ligations also had 2µl of T4 DNA ligase buffer, 1µl of BsaI-HFv2 and 1µl of ligase added to them.

W/C 8^th July Lab Notebook

8^th July 2024

Experiments:

• Attempted a colony PCR of DH5α with our ligated construct of PhoA-pet21a. Used a lesser volume of primers than in future experiments.

Results:

• No band at ~1500bp, possibly due to having a low concentration of primers.

Extra Notes:

• Another colony PCR will need to be done tomorrow and a Miniprep in order to run a diagnostic digest.

W/C 8^th July Lab Notebook

9^th July 2024

Experiments:

• Completed a colony PCR using the PhoA BsaI primers.
• Miniprepped colony PCR from 8^th July in order to perform a diagnostic digest with BsaI using colonies 10 and 11.
• Colony 10 used to run a digest.
• Made a 1:1 dilution of BsaI-HFv2 due to increased accuracy when pipetting higher volume.

Results:

• Results from colony PCR of Colonies 12,13,14,15,16 - Only 13 seems to have worked ~1300bp

• Digest results unclear due to low concentration of DNA again

Extra Notes:

• Now need to transform colony 10 into DH5α to triple check using colony PCR.

W/C 8^th July Lab Notebook

10^th July 2024

Experiments:

• Miniprepped colony 13
• Transformed colony 13 into BL21
• Colony 13 Miniprep was taken for sequencing. Volume and concentration taken beforehand.
• Colony PCR of 5 colonies from colony 10 that was digested on 9th July and produced unclear results. We also created scratch plates and LB overnights for each.
• A glycerol stock of PafA in BL21 was produced
• A bradford assay of PafA was made

Results:

• Miniprep of colony 13 gave a concentration of 40.00 µg/ml.
• Approximately 6ml of 80% glycerol was produced. This was then used to create a glycerol stock of PafA in BL21, which was ~1ml in total and consisted of the cells from a 5ml Overnight colony (supernatant) with 0.4ml of 80% glycerol, 0.6ml of LB agar broth, and 1µl of 100mg/ml Ampicillin.
• A spectrophotometer reading of the bradford assay was performed after 10 minutes. The spec readings for the standard max’d in at 0.6 (OD595), whereas the PafA was 2.6 ish. Therefore we are repeating with a 1 in 5 and a 1 in 10 dilution (10µl PafA +90µl, 20µl PafA +80µl).

Extra Notes:

• To make the spec a bit easier, we are using 0.2, 0.4, 0.6, 0.8 and 1mg/ml BSA concs rather than the full range- most protocols describe this anyway we were just being extra precautious.

W/C 8^th July Lab Notebook

11^th July 2024

Experiments:

• Made 3 Overnight Colonies of Colony 13, each with 5ml of LB and 5µl of 100µg/ml Ampicillin.
• Produce an agarose gel and then run colony PCR of colony 10
• Stepped up overnight PafA using 500ml of LB broth and 500µl of ampicillin, when this reached an OD of 0.419, induced with 250µl of IPTG.
• Conical flask for this had not been autoclaved so plated this onto an agar plate with ampicillin to ensure there was no contamination.
• Also produced an overnight colony of PafA using 5ml LB broth and 5 µl of 100µg/ml Ampicillin in case the conical flask used for the step up was contaminated and needed to be repeated.

Results:

Results from the gel

W/C 8^th July Lab Notebook

12^th July 2024

Experiments:

• Checked for contamination of agar plates.
• Transferred PafA into 10x50ml test tubes.
• Centrifuged to produce a pellet.
• Remove the supernatant.
• Store test tubes in cool room to begin characterisation work on 15th July.

Results:

• No contamination as nothing grew on the agar plates, therefore went ahead and centrifuged the induced PafA and removed the pellet. Then stored at 4°C to begin characterisation work on 15th July.

W/C 15^th July Lab Notebook

15^th July 2024

Experiments:

• Made Overnight Colonies of PhoA and PafA, each with 5ml of LB and 5µl of 100µg/ml Ampicillin.

W/C 15^th July Lab Notebook

16^th July 2024

Experiments:

• PafA and PhoA O/Ns both stepped up in 500ml LB broth + 500µl Ampicillin. When both reached an OD ~0.4 they were induced with 250µl of IPTG and left overnight at 18°C.

W/C 15^th July Lab Notebook

17^th July 2024

Experiments:

• Protein purification of PafA.

Extra Notes:

• Double the usual volume of PafA protein went through the nickel column.
• Not all the FT was collected for PafA.

W/C 15^th July Lab Notebook

18^th July 2024

Experiments:

• Nickel Column was stripped.
• SDS-PAGE carried out for PhoA, PafA, and elutions.
• O/N of colonies 10 & 13 done for tomorrow

Results:

Extra Notes:

• Gel for PhoA did not work - perhaps due to a problem with PhoA itself or due to a problem regarding the bacteria’s metabolism.

W/C 15^th July Lab Notebook

19^th July 2024

Experiments:

• Colony PCR of PhoA colonies 10 & 13.
• Gel electrophoresis on the Colony PCRs using 1kbp DNA ladder.
• Desaltification using P10 desalting column. Column equibrilated with 25ml storage buffer. Once flowed through, 2.5ml of purified PafA protein elution from previous day was added. Then 3.5ml storage buffer added (after complete flow-through of PafA). Then protein and storage buffer were alternated until no more protein was left.
• Miniprep of O/N PhoA Colonies 10 &13.

Results:

• PhoA Colony 10 DNA conc. - 192.835ng/µl
• PhoA Colony 13 DNA conc. - 467.111ng/µl

Extra Notes:

• Each of the 3.5ml elutions of protein collected from the desalting column beads by the storage buffer were labelled in individual tubes, numbered 1 to 5.
• Both colonies 10 & 13 showed peaks at wavelength ~260 on nanodrop (good sign of the DNA being present).

W/C 22^nd July Lab Notebook

22^nd July 2024

Experiments:

• Digest PhoA colonies 10 & 13
• Digest pet21a-sfGFP
• PCR of pet21a-sfGFP and PhoA colonies 10 & 13

Results:

• PCR on gel:
  

Extra Notes:

• Gel: Pet21sfGFP digest showed that the BsaI enzyme is working in the ligations. However, given the amount added in (1µl of 550ng/µl), sfGFP band is ~850bp, out of a total of 6500bp. Therefore roughly 7.5x less bright on a gel than the concentration…should be around a 70ng/µl band brightness. This most definitely isn't so the digest or enzyme wasn't working very efficiently- tho bands in ladder’s brightness barely seems to change. Did it for 1hr at 37°C.

W/C 22^nd July Lab Notebook

23^rd July 2024

Experiments:

• 4 O/Ns of Colony 10 PhoA (with Ampicillin) prepared.
• Needed individual colonies for 10 so a streak plate of Colony 10 was prepared and incubated in 37°C.
• Gel electrophoresis done of PhoA 10 + Nco, PhoA 13 + Nco, and PhoA 10 (miniprep DNA control) using a 1kbp DNA ladder.

Results:

• Gel electrophoresis:
  
  • Lane 1 = colony 10 digested w/ NcoI
  • Lane 2 = colony 13 digested w/ NcoI
  • Lane 3 = miniprepped colony 10 (control)

Extra Notes:

• Gel: Band in lane 1= ~30ng/µl linearised PhoA containing plasmid as NcoI only cuts PhoA. Assuming linearised, not as streaky as bright as the miniprep but seeing something vs Col 13 not. Col 10 may contain PhoA - will be checked via sequencing tomorrow.

W/C 22^nd July Lab Notebook

24^th July 2024

Experiments:

• 4 minipreps of PhoA colony 10 were carried out, two done by students (with expired kit), two by an advisor (with newer kit).
• 4 O/Ns of Colony 10 PhoA prepared (using yesterday’s streak plate), each at 7ml.

Results:

• PhoA 10 streak plate from the previous day was successful.
• Miniprep concentrations: 22.6ng/ml, 59.6ng/ml, 28.2ng/ml, 31.6ng/ml.

W/C 22^nd July Lab Notebook

25^th July 2024

Experiments:

• Mini preps of previous day’s 4 PhoA Colony 10 O/Ns.

Results:

• Miniprep DNA Concentrations - 44ng/µl, 19ng/µl, 33ng/µl, 61ng/µl.

W/C 22^nd July Lab Notebook

26^th July 2024

Experiments:

• Making enzyme concentrations at 200nM, 20nM, and 2nM in the following manner:
  • 6ml of FINAL conc 10nM enzyme = making a 200nM enzyme = 80µl in 720µl (1:10) then 800µl in 5.2ml (1:7.5)
  • 1ml of FINAL conc 1nM = 1:10 dilution of the one above (200nM ← 20nM)
  • 1ml of 100pM PafA = 1:10 dilution of above (20nM ← 2nM)
• Buffers put in water bath at 28°C for 30 minutes.
• PNPP solutions made according to protocols then concentrations were tested in the spectrophotometer (at 405nm) in the following manner:
  • 1 = 100µl enzyme at final conc of 10nM + 900µl 22.5mM PNPP - BLANK 1 = Blanked against 100µl reaction buffer + 900µl PNPP 20mM
  • 2 = 100ul enzyme at final conc of 1nM - BLANK 2 = Blanked against 100µl enzyme at final conc of 1nM + 900µl SB
  • 3 = 100ul enzyme at final conc of 100pM - BLANK 3 = Blanked against 100µl enzyme at final conc of 100pM + 900µl SB
• To each at time 0 seconds, 900µl of 20mM PNPP was added. This was put in the spec and recorded every minute

Results:

• Spectrophotometer results for PNPP:
  

  Time(s)	40	100	160	220	280	340	400	460	520	580
  100nM	0.010	0.019	0.027	0.036	0.045	0.055	0.064	0.074	0.084	0.094
  1nM	0.000	0.001	0.001	0.002	0.002	0.003	0.003	0.004	0.005	0.005
  100pM	-0.050	-0.001	-0.002	-0.002	-0.002	-0.002	-0.003	-0.003	-0.003	-0.003

  Time(s)	640	700	760	820	880	940	1000	1060	1120	1180
  100nM	0.104	0.113	0.123	0.134	0.143	0.153	0.163	0.173	0.182	0.192
  1nM	0.006	0.006	0.007	0.008	0.008	0.009	0.009	0.009	0.010	0.011
  100pM	-0.003	-0.003	-0.003	-0.003	-0.003	-0.003	-0.003	-0.003	-0.003	-0.003

  Time(s)	1240	1300	1360	1420	1480	1540	1600	1660	1720	1780
  100nM	0.202	0.212	0.222	0.232	0.243	0.252	0.262	0.271	0.282	0.294
  1nM	0.011	0.012	0.012	0.013	0.013	0.014	0.015	0.015	0.016	0.016
  100pM	-0.003	-0.003	-0.003	-0.003	-0.002	-0.002	-0.002	-0.002	-0.002	-0.001

  Time(s)	1840	1900	1960	2020	2080	2140	2200	2260	2320	2380
  100nM	0.305	0.315	0.328	0.337	0.345	0.354	0.364	0.373	0.383	0.393
  1nM	0.017	0.017	0.018	0.018	0.019	0.019	0.020	0.020	0.021	0.021
  100pM	-0.001	-0.001	-0.001	-0.001	0.000	0.000	0.000	0.000	0.000	0.000

  Time(s)	2440	2500	2560	2620	2680	2740
  100nM	0.404	0.412	0.422	0.433	0.442	0.451
  1nM	0.022	0.023	0.023	0.024	0.024	0.025
  100pM	0.003	0.003	0.003	0.003	0.003	0.003

  
  

Extra Notes:

• Autoclaved substrate buffer and reaction buffer.
• Leftovers from the enzyme dilution trial will be stored in the freezer in the reaction buffer as the trisHCL should stabilise the enzyme for short term storage.

W/C 29^th July Lab Notebook

29^th July 2024

Experiments:

• PNPP assay with differing concentrations of 200nM, 2nM, and 200pM.

Results:

• PNPP assay: very low absorbance on plate readings, reactions occur too slowly. Maybe due to too much freeze-thawing of the enzyme which deactivated it.

W/C 29^th July Lab Notebook

30^th July 2024

Experiments:

• Step up of 2x PhoA O/ns (10ml) from the previous day and 2x PafA O/ns (10ml).
• SDS of elutions from the PD10 column (from 19/07/24)

Extra Notes:

• PafA and PhoA were induced when they reached an OD of 0.4-0.6.
• Produced more 100mg/ml Ampicillin stocks
• Produced more PD10 columns - may not have filled with the correct volume of beads though

W/C 29^th July Lab Notebook

31^st July 2024

Experiments:

• Span all the 500ml cultures (2xPhoA, 2xPafA) down in the centrifuge and discarded the liquid, then proceeded to sonicate.
• A 5ml storage buffer was run through a PD10 column containing 5cm of Sephardic beads. The action was repeated 5 times making up for 25ml storage run through column.
• A 2.5 ml of elation was added to the column and run in a centrifuge. The elution was collected in the tube labelled FT PD10 E1.
• A 3.5ml of 20% glycerol, hepes and NaCl buffer. It was centrifuged and collected in the tube named PD10 1. Then it was transferred to blue eppendorf tubes and stored in the small freezer at -80°C.
• Both elation and glycerol adding was repeated more times with according labels on the tubes (E1,E2,E3) and all PD10 collected were stored in the freezer in eppendorf tubes.

W/C 29^th July Lab Notebook

1^st August 2024

Experiments:

• SDS gel of protein purification
• Reaction buffer put in 30℃ water bath for later assay
• Measured PafA concentration two samples labelled 1 and 2 kept in fridge using extinction coefficient: 82170.00 M^-1cm^-1
  1= 3.53mg/ml= 59.98µM and 2=0.868mg/ml= 14.5µM

Results:

• SDS gel:
  

  Lane	Contents of Lane
  1	Protein ladder 4µl
  2	FT 10µl +10µl Dye
  3	BB 10µl +10µl dye
  4	WB 10µl +10µl dye
  5	1st elution 10µl + 10µl dye
  6	2nd elution 10µl + 10µl dye
  7	FT PD10 E1 10µl + 10µl dye
  8	FT PD10 E2 10µl + 10µl dye
  9	E1 blue eppendorf (pd10) 10µl + 10µl dye
  10	E2 blue ependorf pd10 10µl + 10µl dye

  
  

Extra Notes:

• It is possible that PafA samples 1 and 2 were not mixed well.

W/C 29^th July Lab Notebook

2^nd August 2024

Experiments:

• PNPP assay carried out
• PCR of PhoA:
  

  Component	Volume (µl)
  PhoA Gblock ( should be at 10ng/µl according to IDT’s respension advice)	1.00
  PhoA BsaI Fwd iGEM09 (10µM)	1.25
  PhoA BsaI New Rev iGEM13 (10µM)	1.25
  Q5 2X Master Mix	12.5
  Sterile water	9.00

• Did another PCR of PhoA exactly the same mixture, but altered the PCR cycle by making the annealing temp start at 71 and each of the 30 cycles go down by 0.4 so that it covers a range of 71-59. This is as benchling and NEB predict greatly different Tms for the same primers. (~71 for NEB and ~60 for benchling).
• Pet21sfGFP nano dropped by an advisor to check for any GFP contamination - a common problem from past minipreps.
• To double check the concentration the plasmid was linearised in different amounts to confirm on a gel that the concentration of pet21sfGFP is correct.
• Digest of pet21sfGFP:
  Digesting 6µl of the pet21sfGFP in 50µl total volume:
  
  • 5µl rCutSmart
  • 6µl of Pet21sfGFP A
  • 1.5µl KpnI based on the fact that we might have 3000ng and it’s 5-10 units per 1000n
  • 38µl Sterile distilled water
• Gel electrophoresis of PhoA and pet21sfGFP

Results:

• Our nanodrop gives us an A260/280 of ~1.9. Online research tells us that below 1.8 indicates protein contamination so it seems unlikely that it is contaminated.
• Gel (45mins at 100V):
  
  

  Lane	Samples
  1	1kb GeneRuler ladder Invitrogen
  2	PhoA 71 1:10
  3	PhoA 71-59 1:10
  4	PhoA 71 1:100
  5	PhoA 71-59 1:100
  6	1kb GeneRuler ladder Invitrogen
  7	Undiluted linearised pet21sfGFP
  8	1:2 linearised pet21sfGFP
  9	1:10 linearised pet21sfGFP
  10
  11	Undiluted linearised pet21sfGFP 2

• Golden gate assembly (using miniprepped pet21sfGFP A)
  

  Reagent	Calculations using NEBioCalculator	Amount (µl)
  Pet21a-sfGPF A from mini prep which Issac did with a conc of 500ng/µl	Mass we want 168.6 ng (0.05pmol). Did a 1:3 dilution	1 of 1:3 Dilution
  PhoA from a conc of 200ng/µl	Mass we want 83.71ng. Did a 1:2.5 dilution	1 of 1:2.5 dilution
  T4 DNA ligase buffer (10x)	-	2µl
  BsaI-HFv2	-	1
  Ligase	-	1
  Sterile distilled water	To 20µl	14

  
  This was then put in the thermocycler for 30 cycles of 37°C for 2 minutes and then 16oC for 2 minutes, followed with 60°C for 5 minutes and then held at 4°C overnight

Extra Notes:

• Sequencing results came back with a large gap/deletion in the PhoA gene- there’s also 4 or 5 A bases on either side of the deletion. We think it's likely to be an assembly problem rather than a sequencing problem, so we're going to reclone with the new PhoARev primer.

W/C 5^th August Lab Notebook

5^th August 2024

Experiments:

• Colony PCRs of the PhoA transformation (colonies 11-20) from the previous Friday
• Streak plate (with Ampicillin) made using colony PCRs
• O/N produced from the streak plate

Results:

• Plate from the PhoA transformation done on Sunday by an advisor:
  
• Colony PCR result on gel:
  

Extra Notes:

• Ran colonies 11-20 in PCR machine on following:
  1. 5 minutes at 95°C
  2. 35 cycles of 94°C for 30
  3. 62°C going down by 0.1°C every cycle for 45 seconds
  4. 72°C for 40 cycles
  5. Following cycles final extension at 72°C for 5 minutes

W/C 5^th August Lab Notebook

6^th August 2024

Experiments:

• Miniprep of O/Ns 11, 12, & 20
• PhoA colonies 11-20 used to make Ampicillin streak plates of colonies 11, 13, 16, & 17
• Freeze-thaw cycles 1-10 carried out on PafA, 10 minute intervals of alternately freezing at -80°C and thawing on ice.
• Transformation of PhoA colony 11 into BL21
• Protein digest on minipreps of colonies 12 & 20 (and a repeat of colony 11) using following mixture for each:
  • 11.5µl of miniprep
  • 12.5µl of rCutSmart buffer
  • 0.5µl of BsaI-HFv2
  • 0.5µl of NdeI

Results:

• Minipreps' nanodrop results:
  • Colony 11 - 43µg/ml:
    
  • Colony 12 - 55µg/ml:
    
  • Colony 20 - 52µg/ml:
    
• Protein digest results on gel:
  
  

  Lanes:

  1. 1kb Ladder
  2. Colony 12 miniprep digested with NdeI and BsaI
  3. Colony 20 miniprep digested with NdeI and BsaI
  4. Empty
  5. Colony 11 PCR run again (used on 05/08 with no dye)

Extra Notes:

• PhoA colony 11 sent off for sequencing

W/C 5^th August Lab Notebook

7^th August 2024

Experiments:

• Did O/Ns of transformed PhoA colonies 10 & 11.
• Protein Conc Via Biodrop with PafA E1 (g/100ml) at 13.73 (blanked against 20% glycerol storage buffer)

Results:

• Streak plates of PhoA colonies 11, 13, 16, & 17 from the previous day:
  
  
  
  
• Transformation plate of PhoA Colony 11 into BL21:
  
• Biodrop of PafA (from freeze-thaw cycles 1-10):
  • 1 = 2.268mg/ml = 37.89µM
  • 2 = 2.739mg/ml = 45.76µM
  • 3 = 2.875 mg/ml = 48.03µM
  • 4 = 3.520mg/ml = 58.81µM
  • 5 = 2.751mg/ml = 45.96µM
  • 6 = 3.785mg/ml = 63.24µM
  • 7 = 2.996mg/ml = 50.06µM
  • 8 = 3.682mg/ml = 61.52µM
  • 9 = 0.723mg/ml = 12.08µM
  • 10 = 1.761mg/ml = 29.42µM
  • Stored in freezer = 2.432mg/ml = 40.63µM
  • *Stored in fridge = 10nM
• PNPP assay of freeze-thaw cycles - each well had 90µl PNPP added but concentrations of wells varied between 11.1mM, 1.1mM, and 0.11mM. Each reaction was started by adding 10µl of 1nM PafA (of varying freeze-thaw cycle numbers)**

Extra Notes:

• *Biodrop of fridge-stored solution of PafA was stored and diluted in reaction buffer prior to this so may not be the best comparison.
• **We hadn’t made up enough PNPP solutions so did more dilutions. The 11.1mM original PNPP went into B1-B11. 11.1mM was remade and went into B12- C12.

W/C 5^th August Lab Notebook

8^th August 2024

Experiments:

• Did PCR colonies for the streak plate made of Colony 11*

Extra Notes:

• *Was the only colony with signs of PhoA growing

W/C 5^th August Lab Notebook

9^th August 2024

Experiments:

• PCR of an advisor’s gBlock amplification (using Platinum SuperFi II DNA Polymerase from thermofisher) then cleanup with Omega Monarch Kit. Was eluted in 11µl then incubated for 5 minutes before spinning.
• Carried out a Colony PCR with Pet21a+ transformation plate and with the spread plates from Colonies 13, 16 and 17. Four samples from each spread plate were taken and 8 were taken from the Pet21a+ transformation plate. This was also used to make overnights and scratch plates to isolate a band at 1000bp.
• Gel electrophoresis of both this day’s Colony PCR and of the PCR (pre and post cleanup) carried out by an advisor.
• Colonies 20 & 21 used to make O/Ns.

Results:

• Concentration of PCR cleanup was 277ng/µl
• Gel electrophoresis:
  

  Lane	Samples
  1	1kb ladder invitrogen generuler
  2	Brook’s PCR of Gblock PhoA (0.5µl + 10µl water + 2µl dye)
  3	Clean up of the PCR of the gblock PhoA (1µl + 9µl water + 2µl dye= 20-25ng/µl)
  4
  5	13a - colony PCR of restreaks from 13 which had two bands on a previous gel.
  6	13b
  7	13c
  8	13d
  9
  10	16a - colony PCR of restreaks from 16 which had two bands on a previous gel.
  11	16b
  12	16c
  13	16d
  14
  15	17a - colony PCR of restreaks from 17 which had two bands on a previous gel.
  16	17b
  17	17c
  18	17d
  19	1kb invitrogen generule

• Gel electrophoresis:
  

  Lane	Colony PCRs from Brook’s restreak of transformation with new PhoA ligation
  1	1kb invitrogen generule
  2	20
  3	21
  4	22
  5	23
  6	24
  7	25
  8	26
  9	27
  10	Skipped due to bubbles
  10	1kb invitrogen generule
  11	28

Extra Notes:

• After PCR cleanup, to ensure the correct volume for future elutions, in a separate tube, a further 9µl was eluted and left for 5 minutes prior to spinning and got a concentration of 22ng/µl therefore we should only elute in 11µl or it will lower our total DNA concentration.
• Scratch plates (of pet21a+ and Colonies 13, 16, and 17) were mistakenly left over the weekend at room temperature.

W/C 12^th August Lab Notebook

13^th August 2024

Experiments:

• O/N of PafA (10ml, containing 10µl Ampicillin) was mixed with 500ml LB broth (and 500µl Ampicillin) and placed in the shaker at 100rpm and 37°C. Was induced at 236 minutes with an absorbance of 0.518 (wavelength used on spectrophotometer was 600nm).
• 30.1, 30.2, 50.1, 50.2, and 70.1 gBlocks underwent PCR* and subsequent PCR cleanup.
• A portion of each gBlock (10ng) diluted to 1:100 (100pg) and 1:1000 (10pg).
• Golden gate assembly for each gBlock (apart from 70.2) was then carried out, each gBlock at each different insert:vector ratio of 5:1, 3:1, 2:1, and 0:1 (only vector).

Results:

• Gel electrophoresis of gBlocks (10ng) and their 1:100 dilutions:
  
  
  • Lane 1 - 1kb GeneRuler
  • Lane 2 - 30.1
  • Lane 3 - 30.1 (1:100)
  • Lane 4 - 30.2
  • Lane 5 - 30.2 (1:100)
  • Lane 6 - 50.1
  • Lane 7 - 50.1 (1:100)
  • Lane 8 - 50.2
  • Lane 9 - 50.2 (1:100)
  • Lane 10 - 70.1
  • Lane 11 - 70.1 (1:100)
• Gel electrophoresis of gBlock 1:100 and 1:1000 dilutions**:
  
• Concentrations of original 10ng gBlocks post-cleanup:
  

  30.1	30.2	50.1	50.2	70.1
  170ng/µl	26ng/µl	42ng/µl	140ng/µl	158ng/µl

• Concentrations of 1:100 and 1:1000 dilutions post-cleanup:
  

  Initial gBlock concentration	30.1	30.2	50.1	50.2	70.1
  100pg (1:100 dilution)	4	9	2	3	6
  10pg (1:1000 dilution)	3	2	3	7	3

Extra Notes:

• GBlocks of 30.1, 30.2, 50.1, 50.2, and 70.1 arrived (70.2 was still in transit and arrived the following day). Each had an initial concentration of 10ng/µl.
• *Each gBlock used the following primers for this and all future PCRs:
  • 30.1 - iGEM_16 and iGEM_17
  • 30.2 - iGEM_18 and iGEM_19
  • 50.1 - iGEM_20 and iGEM_21
  • 50.2 - iGEM_22 and iGEM_23
  • 70.1 - iGEM_24 and iGEM_25
• **No visible bands shown; 1:100 and 1:1000 dilutions were excessive dilutions.

W/C 12^th August Lab Notebook

14^th August 2024

Experiments:

• The induced PafA culture was centrifuged at 4500rpm for 15 minutes, supernatants were discarded and pellets were frozen (according to Protein Purification Protocol).
• The 1:1000 dilutions of gBlocks 30.2, 50.1, and 70.2 underwent PCR amplification, using their accompanying primer pairs - each primer was diluted by 10x. PCR cleanup was performed then each sample was nanodropped and stored at -20°C.
• Pet21a-PhoA colonies 20a-h and 21a-f underwent colony PCR.
• Each golden gate assembly (5:1, 3:1, 2:1, and 0:1) of gBlocks 30.1, 30.2, 50.1, 50.2, and 70.1 underwent transformation. Each was plated with both the normal concentration and a 10x dilution.
• pH PNPP assay carried out.
• Kinetics PNPP assay repeated.
• Two solutions of PafA (A and B) nanodropped against a blank solution of glycerol, HEPES, and sodium chloride.

Results:

• Colony PCR for Pet21a-PhoA colonies 20a-h & 21a-f along with 1:1000 dilutions of 30.1, 50.1, and 70.1*:
  
  
• Concentrations of 1:1000 dilutions of 30.2, 50.1 and 70.2 post-cleanup:
  • 30.2 - 76µg/ml
  • 50.1 - 37µg/ml
  • 70.2 - 132µg/ml
• PafA solutions A and B concentrations:
  • A - 2.18µg/ml
    
  • B - 2.55µg/ml
    

Extra Notes:

• Fresh LB agar + Ampicillin plates were poured
• *Colony PCR was mistakenly carried out with 100bp ladder (instead of usual 1kb ladder), but results are still distinguishable

W/C 12^th August Lab Notebook

15^th August 2024

Experiments:

• Colony PCR of the 3:1 golden gate assembly of 70.1 (as its transformation from the previous day was successful). Results run on gel.
• Pet21sfGFP was digested using NdeI (in rCutSmart buffer), then run on gel with normal concentration, 1:2 dilution, and 1:10 dilution.
• 70.2 golden gate assemblies 5:1, 3:1, 2:1, and 0:1 underwent transformation and were plated with both normal concentrations and 10x dilutions.
• Overnights for 70.1 were made from (after successful gel results) using colonies 13, 14, 16, 17, and 18.
• Overnights made for PhoA colonies 21a-f.

Results:

• Colony PCR of 70.1 (3:1) results on gel:
  
  

W/C 19^th August Lab Notebook

20^th August 2024

Experiments:

• Golden gate assembly was carried out for 30.1, 30.2, 50.1, and 50.2 then subsequently transformed into DH5α.*
• Colony PCRs 70.2 colonies 1-18 carried out (using Pet 98 & 99 primers). Colonies 8, 13, 14, 16, 17, and 18 were made into O/Ns.
• Miniprepped PhoA (from 16/08/2024) was transformed into BL21.

Results:

• Colony PCRs for 70.2 colonies 1-18:
  

Extra Notes:

• *All golden gate assemblies were carried out in insert:vector ratio of 3:1, using BsaI-HFv2. Each assembly had roughly 50ng of gBlock added to the solution.

W/C 19^th August Lab Notebook

21^st August 2024

Experiments:

• 70.1 (colonies 8, 13, 14, 16, 17, and 18) and 70.2 (colonies 1, 2, 3, 4, 5, 7, 11, and 14) were miniprepped.
• Colony PCRs, scratch plates, and overnights were made from the transformations of 30.1 (10 colonies), 30.2 (10 colonies), 50.1 (3 colonies), and 50.2 (10 colonies).

Results:

• 70.1 miniprep concentrations (ng/µl):
  • 8 - 7
  • 13 - 160
  • 14 - 47
  • 16 - 39
  • 17 - 44
  • 18 - 42
• 70.2 miniprep concentrations (ng/µl):
  • 1 - 44
  • 2 - 42
  • 3 - 94
  • 4 - 84
  • 5 - 35
  • 7 - 40
  • 11 - 28
  • 14 - 40
• Colony PCR results for 30.1, 30.2, 50.1 and 50.2:
  
  

Extra Notes:

• Due to poor gel electrophoresis results of colony PCRs for 30.1, 30.2, 50.1, and 50.2 they will be redone (including scratch plates and O/Ns). 50.1 will be redone using the scratch plate rather than the transformation plate (due to low number of viable colonies on the transformation plate).

W/C 19^th August Lab Notebook

22^nd August 2024

Experiments:

• Colony PCRs of 30.1, 30.2, 50.1, and 50.2 from the previous day were redone.
• Colony PCR was also redone using the O/Ns of 30.1, 30.2, 50.1, and 50.2 (from 21/08/2024).*
• PhoA was stepped up into 500ml of LB with 500ul of Ampicillin. It was induced using 250µl of 1M IPTG at an OD of 0.416 and left shaking at 180rpm at 18°C overnight.
• 30.1 (colonies 3-6) and 50.2 (colonies 4-7) were miniprepped.

Results:

• Colony PCR of 30.1 and 30.2 on gel:
  
  
• Colony PCR of 30.2, 50.1, and 50.2 on gel:
  
  
• 30.1 and 50.2 miniprep concentrations**:
  

  Colony	Concentration (ng/µl)
  30.1 Col 3	57
  30.1 Col 4	32
  30.1 Col 5	32
  30.1 Col 6	48
  50.2 Col 4	56
  50.2 Col 5	51
  50.2 Col 6	32
  50.2 Col 7	45

Extra Notes:

• *Same Master Mix as for usual PCR was used but 2µl of O/N was added (instead of a pipette tip dipped into a colony).
• **Colonies 3, 4, and 6 from 30.1 and colonies 4, 5, and 7 from 50.2 were sent off for sequencing due to high concentrations and clear peaks at 260nm (the wavelength of DNA).

W/C 19^th August Lab Notebook

23^rd August 2024

Experiments:

• PNPP assay carried out.

W/C 26^th August Lab Notebook

26^th August 2024

Experiments:

• PafA WT, PhoA, 30.1, 50.2, 70.1, and 70.2 were stepped up and induced with IPTG.* Cultures were spun down, supernatant discarded, and pellets frozen.

Extra Notes:

• *Using O/Ns made by an advisor on the previous day (Sunday).

W/C 26^th August Lab Notebook

27^th August 2024

Experiments:

• PCR carried out on 30.2 and 50.1.
• PafA and PhoA proteins were purified.

Results:

• 30.2 and 50.1 PCR results on gel:
  
  

  Lanes:

  1. 1kb DNA ladder
  2. 30.2
  3. 50.1

W/C 26^th August Lab Notebook

28^th August 2024

Experiments:

• 30.1 and 50.2 protiens were purified.

W/C 26^th August Lab Notebook

29^th August 2024

Experiments:

• PNPP assay trialled for WT PafA and PhoA.
• 70.1 and 70.2 proteins were purified.

W/C 2^nd September Lab Notebook

2^nd September 2024

Experiments:

• First half of practice run of glass beads in phosphate-recovery device with Dylan Lewis carried out.

W/C 2^nd September Lab Notebook

3^rd September 2024

Experiments:

• Second half of practice run of glass beads in phosphate-recovery device with Dylan Lewis carried out.
• Size exclusion carried out on proteins 30.1, 50.2, and 70.2.

W/C 2^nd September Lab Notebook

4^th September 2024

Experiments:

• Circular dichroism carried out with Xander Arsecott-Barber for PhoA, 70.1, 70.2, and 50.2.
• Size exclusion carried out on proteins PafA WT, PhoA, and 70.1.

W/C 2^nd September Lab Notebook

5^th September 2024

Experiments:

• PNPP kinetics assay carried out with WT PafA and 50.2. *

Results:

• Mg/ml of pafA was converted to moles which was 0.00531.

Extra Notes:

• *PafA was diluted to 1.1nM.

W/C 2^nd September Lab Notebook

6^th September 2024

Experiments:

• Phosphate-recovery device tested using WT PafA.

W/C 9^th September Lab Notebook

9^th September 2024

Experiments:

• Kinetics assays for PafA WT and 70.2 were trialled.
• Temperature assays were trialled using PafA WT.

W/C 9^th September Lab Notebook

10^th September 2024

Experiments:

• Kinetics assays carried out for PafA WT, PhoA, 30.1, 50.2 and 70.2.
• Temperature assays carried out for PafA WT, 30.1, and 70.2.

W/C 9^th September Lab Notebook

11^th September 2024

Experiments:

• pH assays carried out for PafA WT, PhoA, 30.1, 50.2, and 70.2.
• Temperature assay was carried out for 50.2.

W/C 9^th September Lab Notebook

13^th September 2024

Experiments:

• Product inhibition assays carried out for PafA WT, PhoA, 30.1, 50.2, and 70.2.