7.9-10.2024

We were trained in laboratory safety and basic laboratory practices. Then we learned the use of laboratory equipment, such as centrifuges, instruments for PCR, and pipettes.

7.11-7.12.2024

Experiment 1: Extraction of total RNA from Leonurus artemisia

(1) Goal and target compounds:

To obtain RNA from Leonurus artemisia

(2) Materials:

• Isopropanol
• RNase-free water
• 70% ethanol
• Trizol
• Leonurus artemisia
• Chloroform

(3) Steps:

1. Weigh 50-100mg of young leaves of Leonurus artemisia in a centrifuge tube and grind them to powder with a grinder. (30Hz, 1min)
2. Add 1ml Trizol, mix well with vortex shaker, leave on ice for 3min, add 0.5ml chloroform, centrifuge at 4℃, 12000rpm for 1min.
3. Take the upper layer of aqueous phase/superfluorescence (about 0.5 ml) in a new centrifuge tube, add 1 ml of pre-cooled isopropanol, mix upside down and put it into -20℃ to precipitate for 1-2hr.
4. Centrifuge at 4℃, 12000rpm for 10min, at this time you can see a small amount of RNA at the bottom of the centrifuge tube, discard the supernatant, add 1ml of 70% ethanol, centrifuge at 4℃, 12000rpm for 1min, discard the supernatant.
5. Repeat step (4)
6. Centrifuge at 4°C and 12000 rpm for 1 min, aspirate as much residual ethanol as possible with a lance tip, and dry the tube on an ultra-clean bench for 5-10 min until the ethanol is completely evaporated.
7. Add 50 μl of RNase-free water and tap the bottom of the tube to dissolve the RNA.
8. Measure RNA concentration with the NanoDrop.

Experiment 2: Reverse transcription

(1) Goal and target compounds:

To remove genomic DNA and reverse transcribe RNA to DNA

(2) Steps:

a) PCR reaction system (10 μl):

• RNA template: 1 μg
• gDNA Eraser: 1 μL
• 5×gDNA Eraser Buffer: 1 μL
• RNase-free water: up to 10 μL
• Program of PCR amplification: 42℃, 2min

b) PCR reaction system (10 μl):

• PrimeScript RT Enzyme Mix 1: 1 μL
• Primer Mix: 4 μL
• 5×PrimeScript Buffer2: 4 μL
• RNase-free water: 1 μL
• Program of PCR amplification: 1) 37℃, 1hr, 2) 85℃, 5 sec

Results:

Succeeded.

7.13-15.2024

Experiment 1: PCR amplification of cDNA from the last experiment

(1) Goal and target compounds:

To obtain gene fragments of interest

(2) Steps:

PCR reaction system (25 μl):

• cDNA template: 1 μL
• Forward primer (10 μM): 1.5 μL
• Reverse primer (10 μM): 1.5 μL
• PCR buffer: 10 μL
• MgSO4 (25mM): 1.5 μL
• dNTPs (2mM): 2.5 μL
• KOD plus: 1 μL
• ddH2O: 13.5 μL

Program of PCR amplification:

1. Initial denaturation: 94˚C, 2min
2. Cycles: X28 cycles
1. Denaturation: 98˚C, 15 sec
2. Annealing: 58˚C, 36 sec
3. Extension: 68˚C, 2 min
3. Final extension: 68˚C, 10 min

Experiment 2: Nucleic acid gel validation

(1) Goal and target compounds:

To verify DNA

(2) Materials:

• Agarose 9g
• TAE Buffer 60ml
• DNA 8μl
• Bromophenol blue dye 2μl

(3) Steps:

1. Wash and dry the electrophoresis gel bed of plexiglass, seal the opening at both ends with tape, put it on the horizontal working table and insert the sample comb.
2. Weigh agarose and dissolve it in TAE buffer, put it into a microwave oven or boiling water bath and heat it until it is completely dissolved, take it out and shake it well.
3. Pour the agarose solution cooled to 60℃ gently onto the horizontal plate of the electrophoresis tank.
4. After the agarose gel solidifies, add electrophoresis buffer into the electrophoresis tank, and then pull out the comb.
5. Mix the DNA sample with bromophenol blue dye, then add the mixture into the sample tank with a pipette, add 10 µl (8μl yeast DNA and 2μl bromophenol blue dye) per tank, and record the order and the amount of sample added.
6. Install the electrode wire, connect the negative pole at one end of the spotting hole and the positive pole at the other end, turn on the power supply, adjust the voltage to 3-5V/cm, electrophoresis for 1-3hr, and stop the electrophoresis when the bromophenol blue is moved to 1-2cm away from the front edge of the gel.
7. Remove the gel, observe the DNA bands under the 254nm ultraviolet lamp, and record the electrophoresis pattern in the computer.

Notes & Results:

Succeeded.

7.16.2024

Experiment 1: PCR amplification of the genes of interest

(1) Goal and target compounds:

To obtain gene fragments of interest for level-0 plasmid construction: SmCPR, SmCPS, SmGGPPS, SmKSL, CYP76AH1, CYP76AH3, CYP76AH22, and CYP76AK6.

(2) Materials:

• DNA template: Genomic DNA of Salvia miltiorrhiza
• Forward primer: GCATCGTCTCATCGGTCTCAT(ATG) + CDS-5'
• Reverse primer: ATGCCGTCTCAGGTCTCAGGAT + CDS-3’

(3) PCR reaction system (50 μl):

• DNA template: 0.5 μL
• Forward primer: 1 μL
• Reverse primer: 1 μL
• PCR buffer: 10 μL
• dNTP mix: 4 μL
• DNA polymerase: 1 μL
• ddH2O: 32.5 μL

(4) Program of PCR amplification:

1. Initial denaturation: 95˚C, 2min
2. Cycles: X35 cycles
1. Denaturation: 95˚C, 20 sec
2. Annealing: 55˚C, 20 sec
3. Extension: 72˚C, 2 min
3. Final extension: 72˚C, 10 min

(5) Steps:

1. Concentrated (50X) TAE buffer should be diluted with distilled water to prepare 1X TAE buffer.
2. Mix agarose powder with 1X TAE in a 250 mL flask from the microwave and swirl the flask.
3. Cool the agarose to 60˚C.
4. Place the comb in the appropriate notch.
5. Before casting the gel, add diluted stain to the cooled molten agarose and swirl to mix.
6. Pour the cooled agarose solution into the prepared gel-casting tray (The gel should thoroughly solidify within 20 min).
7. Remove the end caps and comb.
8. Place the gel into the electrophoresis chamber and cover the gel with 1X electrophoresis buffer.
9. Place safety cover and check that the gel is properly oriented.
10. Slide the gel off the casting tray onto the viewing surface of the transilluminator and turn the unit on.
11. Adjust the brightness to the desired level to maximize band visualization; DNA should appear as bright green bands on a dark background.
12. Record the results by photographing the gel.
13. Remove and dispose of the gel and clean the transilluminator surfaces with distilled water.
14. Glue receiving:
15. Cut
16. Solution
17. Absorption
18. Elution

Notes & Results:

1. Purpose: Enables investigators to obtain large quantities of DNA for later experiments.
2. Objectives: These genes are later used to synthesize intermediates.
3. Results: SmCPR, SmCPS, SmGGPPS, SmKSL, CYP76AH1, CYP76AH3, CYP76AH22, and CYP76AK6 succeeded.

7.17.2024

Experiment 1: Construction of the level-0 plasmids

(1) Goal and target compounds:

To obtain the level-0 plasmids:

• pYTK001-PTDH3 (or PCCW12, PPGK1, PTEF1, PTEF2);
• pYTK001-SmGGPPS (or SmCPS1, SmKSL, SmCPR, CYP76AH1, CYP76AH3, CYP76AH22, CYP76AK6);
• pYTK001-TENO1 (or TSSA1, TADH1, TTDH1, TENO2)

(2) Materials:

• Gene fragments: The PCR products obtained yesterday: SmCPR, SmCPS, SmGGPPS, SmKSL, CYP76AH1, CYP76AH3, CYP76AH22, CYP76AK6;
• Promoters: PTDH3, PCCW12, PPGK1, PTEF1, PTEF2;
• Terminators: TENO1, TSSA1, TADH1, TTDH1, TENO2;
• Plasmid: pYTK001.

(3) Steps:

Add the following different substances to 8-well PCR tubes, each for one gene, with a total volume of 10µL:

• Gene fragments: 0.5 µL
• Restriction enzyme BsmBI: 1 µL
• T4 ligase buffer: 1 µL
• T7 ligase: 0.5 µL
• Complete plasmid pYTK001: 0.5 µL
• ddH2O: 6.5 µL

CRITICAL: T7 ligase enzyme is used in combination with T4 ligase buffer, it is not a typo.

Reaction program (in PCR Amplifier):

25 cycles:

1. 42℃: 2 min
2. 16℃: 5 min
3. 60℃: 10 min
4. 80℃: 10 min

Experiment 2: E. coli Transformation with the level-0 plasmids

(1) Goal and target compounds:

To obtain the E. coli cells transformed with level-0 plasmids.

(2) Materials:

• Products of Experiment 1
• Competent cells of E. coli DH10B

(3) Steps:

1. Add all the connected products of Experiment 1 into every 100 μL competent cells, gently mix the tubes by pipetting up and down, and thaw them on ice for 30 min.
2. Heat shock at 42°C water bath for 45 sec.
3. Quickly transfer the tubes to ice and let them stand for 2 min.
4. Add 700 µL of LB liquid medium to the competent cells, mix them at 37°C, and shake them at 180 rpm/min for 1 hr.
5. Centrifuge them at 6000 rpm for 1 min to collect the bacteria, remove 600 μL of the supernatant.
6. Use spreading rods to plate the cell suspension on the surface of LB + Chloramphenicol plates.
7. Culture them in an incubator at 37°C for 12-16 hr.

Notes & Results:

• By adjusting the temperature changes using the heat shock method, pores appeared in the inner membrane of E. coli, allowing the plasmid to enter the E. coli.
• On the transformation plate, a mixture of white and green colonies will grow.
• We expected white colonies containing level-0 plasmids.

7.18.2024

Experiment 1: UV test of the positive single colony

(1) Goal and target compounds:

To select the transformed E. coli cells that have successfully taken up level-0 plasmids.

(2) Materials:

Transformed E. coli cells with the level-0 plasmids from the last experiment.

(3) Steps:

1. Pick four single bacterial colonies (E. coli) from each petri dish that does not fluoresce under UV light, then label them from 1-4.
2. Add 100 μL of LB liquid medium with Chloramphenicol to the 96-well plate.
3. Transfer all the colonies into the 96-well plate.
4. Incubate them at 37°C with 220 rpm/min for 3 hr.

Experiment 2: Colony-PCR test of the level-0 plasmids expressed in E. coli cells

(1) Goal and target compounds:

To select the transformed E. coli cells with successfully constructed level-0 plasmids from experiment 1.

(2) Materials:

Transformed E. coli cells with the level-0 plasmids from the last experiment.

(3) Steps:

1. Transfer the prepared solution to the new 96-well PCR tubes.
2. Add the following different substances to the tubes, each for one colony suspension solution, with a total volume of 20 µL:

PCR reaction system (20 μL):

• 2×Taq Plus Master Mix: 10 μL
• F-primer: 0.8 μL
• R-primer: 0.8 μL
• Colony suspension solution: 1 μL
• ddH₂O: 7.4 μL

Program of PCR amplification:

1. Initial denaturation: 95˚C, 3 min
2. Cycles: 30 cycles
1. Denaturation: 95˚C, 15 sec
2. Annealing: 52˚C, 20 sec
3. Extension: 72˚C, 2.5 min
3. Final extension: 72˚C, 10 min

1. Run 1% gel electrophoresis to verify the size of amplified fragments.

Experiment 3: Expansion culture of inoculum

(1) Steps:

1. According to the gel run results, select the correct cell suspension from the 96-well plate.
2. Take 8 tubes and each of them with 20 μL of selected cell suspension.
3. Prepare 50 mL LB medium with 50 μL Chloramphenicol.
4. Incubate the tubes overnight at 37°C with 5 mL LB + Chloramphenicol.

Notes & Results:

Succeeded. We obtained the correct cell suspension of level-0 plasmids.

Results shown below:

7.19.2024

Experiment 1: Extraction of constructed level-0 plasmids

(1) Goal and target compounds:

To obtain successfully constructed level-0 plasmids for the construction of the level-1 plasmids.

(2) Materials:

Positive transformants of E. coli with the level-0 plasmids selected in the last experiment.

(3) Steps:

1. Centrifuge the overnight E. coli culture at high speed (12,000 rpm) for 1 min to pellet the cells. Remove the supernatant.
2. Place 8 adsorption columns CP3 into separate tubes. Add 500 μL Buffer BL to each column. Pour the liquid from the collecting tube. Put the adsorption column back into the collecting tube.
3. Add 250 μL Buffer P1 to the centrifuge tube. Use a pipette to ensure the precipitate is suspended. Vortex or pipette up and down to completely resuspend the pellet.
4. Add 250 μL Buffer P2 to the centrifuge tube. Mix them gently by inverting the tube 6-8 times.
5. Add 350 μL Buffer P3 to the lysed cells. Invert the tube immediately and gently 6-8 times to mix, ensuring it is mixed evenly.
6. Centrifuge at 12,000 rpm for 10 min.
7. Use a pipette to transfer the supernatant to the adsorption columns CP3 (avoid removing precipitate) and centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec. Pour the liquid from collecting tube. Place the adsorption tube CP3 to the collecting tube again.
8. Add 600 μL Washing Buffer PW to the column (ensure anhydrous ethanol has been added first). Centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds.
9. Repeat step 8.
10. Place the adsorption column CP3 into the collection tube. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove any residual washing buffer from the adsorption column.
11. Place the adsorption column CP3 into a clean centrifuge tube. Add 50-100 μL Elution Buffer EB to the center of the adsorption membrane. Let it stay at room temperature for 2 minutes, then centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the plasmid solution into the centrifuge tube.

Notes & Results:

• For step 3, if the precipitate of bacteria is not completely mixed, the extract quantity and purity will diminish.
• For step 4, avoid violent shaking or the DNA genome may be broken.
• The liquid will become pellucid and viscous after mixing. If not, the amount of bacteria may need to be adjusted to reduce.
• The time for mixing is limited to 5 minutes to prevent the plasmid from damaging.
• For step 10, it is supposed to open the cap of the adsorption column CP3 and dry it in the air at room temperature to remove ethanol because residual ethanol in the washing buffer can affect subsequent enzymatic reactions.
• For step 11, the volume of Elution Buffer EB should not be less than 50 μL to maintain the efficiency of recovery. The pH of the elution buffer also significantly impacts the elution efficiency and should be controlled within 7.0-8.5.
• The DNA product should be stored at -20°C to prevent DNA degradation.
• To increase the recovery rate of plasmid, the obtained solution can be added back to the adsorption column, allowed to sit at room temperature for 2 minutes, and then centrifuged again at 12,000 rpm for 2 minutes to collect the plasmid solution into the centrifuge tube.

We finally obtained the level-0 plasmids.

7.22-23.2024

Experiment 1: Construction of the level-1 plasmids

(1) Goal and target compounds:

To obtain the level-1 plasmids by inserting a specific genetic element (promoter, terminator) into a specific site of a plasmid (PYTK095) containing a fragment of the target gene (SmGGPPS, SmCPS1, SmKSL, SmCPR, CYP76AH1, CYP76AH3, CYP76AH22, CYP76AK6):

• pYTK095-PTDH3-SmGGPPS-TENO1,
• pYTK095-PCCW12-SmCPS1-TSSA1,
• pYTK095-PPGK1-SmKSL-TADH1,
• pYTK095-PTEF2-SmCPR-TTDH1,
• pYTK095-PTEF1-CYP76AH1-TENO2,
• pYTK095-PTEF2-CYP76AH3-TTDH1,
• pYTK095-PTEF1-CYP76AH22-TENO2,
• pYTK095-PTEF2-CYP76AK6-TTDH1.

(2) Materials:

• Level-0 plasmids
• Backbone plasmid: pYTK095

(3) Steps:

Add specific five genetic elements to four sets of samples of genes of different purposes, with a total volume of 10µL:

Reaction system (10 µL):

• Promoter: 0.5 µL
• Terminator: 0.5 µL
• CDS: 0.5 µL
• Backbone plasmid: 0.5 µL
• Restriction enzyme BsmBI: 1 µL
• T4 ligase buffer: 2 µL
• T7 ligase: 0.5 µL
• Complete plasmid pYTK001: 0.5 µL
• ddH₂O: 4 µL

Reaction program (in PCR Amplifier):

1. 42℃: 2 min
2. 16℃: 5 min
3. 60℃: 10 min
4. 80℃: 10 min

Experiment 2: E. coli transformation with the level-1 plasmids

(1) Goal and target compounds:

To obtain the E. coli cells transformed with level-1 plasmids.

(2) Materials:

• Products of Experiment 1
• Competent cells of E. coli DH10B

(3) Steps:

See Experiment 2 in 7.17.2024 for detailed steps.

Notes & Results:

Because the incorrect antibiotic was added in 7.22.2024, we repeated today's experiment on 7.23.2024.

7.24.2024

Experiment 1: Colony-PCR test of the level-1 plasmids

(1) Goal and target compounds:

To select the transformed E. coli cells with successfully constructed level-1 plasmids.

(2) Materials:

• Transformed E. coli cells with the level-1 plasmids from the last experiment

(3) Steps:

1. Select the single bacterial colony (pYTK095) that does not fluoresce under UV light from the petri dishes and label each colony in order.
2. Transfer the prepared solution to the new 8-well PCR tubes.
3. Add the following different substances to tubes, each for one colony suspension solution, with a total volume of 20 µL:

PCR reaction system:

• 2× Taq Plus Master Mix: 10 μL
• F-primer: 0.5 μL
• R-primer: 0.5 μL
• Colony suspension solution: 0.5 μL
• ddH₂O: 8.5 μL

Program of PCR amplification:

1. Initial denaturation: 95˚C, 3 min
2. Cycles: 30 cycles
• Denaturation: 95˚C, 15 sec
• Annealing: 52˚C, 20 sec
• Extension: 72˚C, 2.5 min
3. Final extension: 72˚C, 10 min

Run 1% gel electrophoresis to verify the size of amplified fragments.

Experiment 2: Expansion culture of inoculum

(1) Steps:

1. According to the gel run results, select the correct cell suspension from the 8-well PCR tubes.
2. Take 8 tubes and fill each of them with 20 μL of selected cell suspension.
3. Prepare 50 mL LB medium with 50 μL ampicillin.
4. Incubate the tubes overnight at 37˚C with 5 mL LB + ampicillin.

Notes & Results:

• We selected the single colony that does not fluoresce under UV light from the petri dishes. White colonies contain a plasmid that has lost the GFP gene on the pYTK095 plasmids due to the golden gate assembly.


Previous Next
• Succeeded. Results shown below:


Previous Next

7.25.2024

Experiment 1: Extraction of level-1 plasmids

(1) Goal and target compounds:

To obtain successfully constructed level-1 plasmids from E. coli DH10B.

(2) Materials:

• Positive transformants of E. coli with the level-1 plasmids selected in the last experiment.

(3) Steps:

See Experiment 1 in 7.19.2024 for detailed steps.
Measure the concentration of the extracted level-1 plasmids with NanoDrop.

Experiment 2: Construction of Level-2 plasmids

(1) Goal and target compounds:

To obtain the level-2 plasmids.

• TY9: pYTK096- PTDH3-SmGGPPS-TENO1: PCCW12-SmCPS1-TSSA1: PPGK1-SmKSL-TADH1: PTEF2-SmCPR-TTDH1: PTEF1-CYP76AH1-TENO2: PTEF2-CYP76AH3-TTDH1
• TY10: pYTK096- PTDH3-SmGGPPS-TENO1: PCCW12-SmCPS1-TSSA1: PPGK1-SmKSL-TADH1: PTEF2-SmCPR-TTDH1: PTEF1-CYP76AH22-TENO2: PTEF2-CYP76AK6-TTDH1

(2) Materials:

• Level-1 plasmids
• Backbone plasmid: pYTK096

(3) Steps:

Add the following different substances to different tubes with a total volume of 10 µL:

Reaction system (10 µL):

For TY9:

• pYTK095-PTDH3-SmGGPPS-TENO1: 0.5 µL
• pYTK095-PCCW12-SmCPS1-TSSA1: 0.5 µL
• pYTK095-PPGK1-SmKSL-TADH1: 0.5 µL
• pYTK095-PTEF2-SmCPR-TTDH1: 0.5 µL
• pYTK095-PTEF1-CYP76AH1-TENO2: 0.5 µL
• pYTK095-PTEF2-CYP76AH3-TTDH1: 0.5 µL
• Backbone plasmid (pYTK096): 0.5 µL
• BsmBI: 1 µL
• T4 buffer: 2 µL
• T7: 0.5 µL
• ddH2O: 3 µL

For TY10:

• pYTK095-PTDH3-SmGGPPS-TENO1: 0.5 µL
• pYTK095-PCCW12-SmCPS1-TSSA1: 0.5 µL
• pYTK095-PPGK1-SmKSL-TADH1: 0.5 µL
• pYTK095-PTEF2-SmCPR-TTDH1: 0.5 µL
• pYTK095-PTEF1-CYP76AH22-TENO2: 0.5 µL
• pYTK095-PTEF2-CYP76AK6-TTDH1: 0.5 µL
• Backbone plasmid (pYTK096): 0.5 µL
• BsmBI: 1 µL
• T4 buffer: 2 µL
• T7: 0.5 µL
• ddH2O: 3 µL

Reaction program (in PCR Amplifier):

• 42℃: 2 min
• 16℃: 5 min
• 60℃: 10 min
• 80℃: 10 min

Experiment 3: E. coli transformation with the level-2 plasmids

(1) Goal and target compounds:

To obtain E.coli cells transformed with level-2 plasmids.

(2) Materials:

• Products of experiment 3: Plasmid TY9 and plasmid TY10
• Competent cells of E. coli DH10B

(3) Steps:

Transfer the plasmid TY9 and plasmid TY10 respectively into E. coli DH10B.
See Experiment 2 in 7.17.2024 for detailed steps.

Notes & Results:

Succeeded.

7.26.2024

Experiment 1: Verification of the constructions of level-2 plasmids

(1) Goal and target compounds:

To select the transformed E. coli cells with successfully constructed level-2 plasmids.

(2) Materials:

• Transformed E. coli cells with the level-0 plasmids from the last experiment
• Kana antibiotic
• Competent E. coli cells

(3) Steps:

1. Add Kana antibiotic at a ratio of 1:1000 and 700 μl LB medium to competent E. coli cells. Shake at 37℃ for 1 hour.
2. Centrifuge the mixture at 6000 rpm for 1 minute to collect the bacteria, then remove 600 μl of the supernatant.
3. Use spreading rods to plate the cell suspension on the surface of LB+Chloramphenicol plates.
4. Culture the plates in an incubator at 37℃ for 12-16 hours.

7.27.2024

Experiment 1: Colony-PCR test of the level-2 plasmids

(1) Goal and target compounds:

To select the transformed E. coli cells with successfully constructed level-2 plasmids.

(2) Materials:

• Transformed E. coli cells with the level-2 plasmids from the last experiment

(3) Steps:

1. Select the single bacterial colony (pYTK095) that does not fluoresce under UV light from the petri dishes and label each colony in order.
2. Transfer the prepared solution to the new 8-well PCR tubes.
3. Add the following different substances to tubes, each for one colony suspension solution, with a total volume of 20µL:
• 2× Taq Plus Master Mix: 10 μL
• F-primer: 0.5 μL
• R-primer: 0.5 μL
• Colony suspension solution: 0.5 μL
• ddH₂O: 8.5 μL
4. Program of PCR amplification:
• Initial denaturation: 95˚C, 3min
• Cycles: 30 cycles
• Denaturation: 95 ˚C, 15 sec
• Annealing: 52 ˚C, 20 sec
• Extension: 72 ˚C, 2.5 min
• Final extension: 72 ˚C, 10 min
5. Run 1% gel electrophoresis to verify the size of amplified fragments.

Notes & Results:

We managed to construct the level-2 plasmids. However, the gene elements are too long, so only the first and last gene elements can be copied. We planned to repeat the experiments of level-2 plasmid construction and verification.

7.28-30.2024

Experiment: Construction of Level-2 plasmids and Verification of the constructions of level-2 plasmids

Notes & Results:

Succeeded. Results shown below:

For specific steps, refer to the experiments conducted on 7.25-7.27.

8.1.2024

<

Experiment 1: Medium Preparation

Steps:

1. Add the following different substances to flasks for preparing YPDA culture medium:
   • Yeast extract: 10g
   • Reptone: 20g
   • D-Glucose: 20g
   • Adenine: 0.1g
2. Add the following different substances to flasks for preparing SD culture medium:
   • BD (yeast nitrogen base, without amino acids): 1.34g
   • Agar: 3.5g
   • ddH2O: 170ml
   • 1M NaOH: 70ml
3. Adjust the pH value to 5.8 and then autoclave at 121°C for 15 min.

8.2-4.2024

Experiment 1: Transformations of yeast (Saccharomyces cerevisiae) with level-2 plasmids

(1) Goal and target compounds:

To integrate genes of interest on level-2 plasmids into the genome of yeast and obtain engineered yeast cells.

(2) Materials:

• Level-2 plasmids:
• TY9 (240 ng/ml)
• TY10 (225 ng/ml)
• Enzyme (NotI)
• Solution 3
• Buffer
• ddH2O

(3) Steps:

1. Add the following substances to tubes, each for one colony suspension solution, with a total volume of 20µL:
   • Plasmid: 8 μL
   • Buffer: 2 μL
   • Restriction enzyme NotI: 1 μL
   • ddH2O: 9 μL

   Enzyme digestion reaction in PCR instrument at 37℃ for 30 min.

2. Add all 20 μl PCR products to 100 μl yeast BY4742 competent cells.
3. Add 500 μl of solution 3, mix gently and react in a metal bath at 30℃ for 45 min.
4. Spread 100 μl of the above transformation mixture on an appropriate plate.
5. Incubate the plates at 30℃ for 3 days to allow for growth of transformants.

Experiment 2: Colony-PCR test of the level-2 plasmids

(1) Goal and target compounds:

To repetitively verify the heads and tails of four monoclonal genes (URA3) in level-2 plasmids.

(2) Materials:

DNA Templates: Transformants with the level-2 plasmids from the last experiment.

(3) Steps:

1. Select the single bacterial colony (pYTK095) that fluoresce under UV light from the petri dishes and label each colony in order.
2. Transfer the prepared solution to the new 8-well PCR tubes.
3. Add the following substances to tubes, each for one colony suspension solution, with a total volume of 20µL:
   • 2× Taq Plus Master Mix: 10 μL
   • F-primer: 0.5 μL
   • R-primer: 0.5 μL
   • Colony suspension solution: 0.5 μL
   • ddH₂O: 8.5 μL

Program of PCR amplification:

1. Initial denaturation: 95˚C, 3min
2. Cycles: 30 cycles
• Denaturation: 95˚C, 15 sec
• Annealing: 52˚C, 20 sec
• Extension: 72˚C, 2.5 min
3. Final extension: 72˚C, 10 min

Notes&Results:

Single colonies grew both on the TY9 plate and the TY10 plate. Results shown below:

8.5.2024

Experiment 1: Single colony cultivation of transformed Yeast

1. Goal and target compounds:

To expand the culture of a single clone of a brewer's yeast transformant.

2. Materials:

• 80ml SD
• 10ml 10×glucose
• 10ml 10×U
• Transformed Yeast colonies (TY9, TY10) within solid culture medium:
• TY9 (240 ng/ml): pYTK096- PTDH3-SmGGPPS-TENO1: PCCW12-SmCPS1-TSSA1: PPGK1-SmKSL-TADH1: PTEF2-SmCPR-TTDH1: PTEF1-CYP76AH1-TENO2: PTEF2-CYP76AH3-TTDH1
• TY10 (225 ng/ml): pYTK096- PTDH3-SmGGPPS-TENO1: PCCW12-SmCPS1-TSSA1: PPGK1-SmKSL-TADH1: PTEF2-SmCPR-TTDH1: PTEF1-CYP76AH22-TENO2: PTEF2-CYP76AK6-TTDH1

3. Steps:

1. Mix 80ml SD with 10ml 10×glucose and 10ml 10×U to form a liquid culture medium.
2. Put 10ml liquid culture medium in each of the ten test tubes.
3. Use a pipette to remove the yeast colonies from the solid culture medium, and place each pipette tip with the colony into the liquid culture medium.
4. Put the 10 test tubes into the shaker at 220rpm and 28℃.

Notes & Results:

Results would be revealed after one day of cultivation.

8.6.2024

Experiment 1: Preparation of YPDA culture medium for yeast

(1) Steps:

1. Add the following different substances to 6 flasks for preparing YPDA culture medium:
• ddH₂O: 6000ml
• Yeast extract: 60g
• Peptone: 120g
• D-Glucose: 120g
• Adenine: 0.6g
2. Place the 6 flasks into the autoclave at 121℃ for 15 minutes.

Notes & Results:

Succeeded

Experiment 2: Cultivation of yeast solution Saccharomyces cerevisiae (TY9, TY10)

(1) Goal and target compounds:

To expand the culture of a single clone of a brewer's yeast transformant.

(2) Steps:

1. Add the following different substances to 6 flasks for preparing YPDA culture medium:
• YPDA culture medium: 6000ml
• Yeast solution (TY9): 6ml
• Yeast solution (TY10): 6ml
• 2000ml three-legged conical flasks: 6
2. Place the 2000ml three-legged conical flasks on the shaker at 220rpm and 30℃ for 5 days.

Notes & Results:

Results would be revealed after 5 days of cultivation.

8.7.2024

Experiment 1: Yeast Saccharomyces cerevisiae gene purification

(1) Goal and target compounds:

To purify the level-2 plasmids from the Saccharomyces cerevisiae cells.

(2) Materials:

• Yeast cells: 1.5ml × 6
• YD digestion Buffer: 120μl × 6
• R-Zymolyase™: 5μl × 6
• YD Lysis Buffer: 120μl × 6
• DNA Wash Buffer: 300μl × 2 × 6
• Water: 60μl × 6

(3) Steps:

1. Before starting, add 24ml of 95-100% ethanol to the DNA Wash Buffer.
2. Centrifuge at 500g for 2 min. Remove the supernatant completely.
3. Add 120 μl of YD Digestion Buffer and 5 μl of R-Zymolyase (RNase A + Zymolyase).
4. Resuspend the pellet by vortexing and incubate at 37℃ for 40-60 min.
5. Add 120μl of YD Lysis Buffer. Mix well by gently vortexing.
6. Centrifuge in a tabletop centrifuge at >10,000 rpm for 2 min.
7. Load the supernatant onto the Zymo-Spin™ II Column and centrifuge at >10,000 rpm for 1 min.
8. Add 300 μl of DNA Wash Buffer and centrifuge for 1 min at ≥10,000 rpm to wash. Add another 300 μl of DNA Wash Buffer and repeat the wash. Centrifuge for 1 min.
9. Transfer the Zymo-Spin™ II Column to a new 1.5 ml centrifuge tube and add 60 μl of water directly onto the membrane. Wait for one minute then centrifuge for 10 seconds to elute the DNA.
10. Measure plasmid concentration with the NanoDrop.

Experiment 2: Colony-PCR test of the level-2 plasmids

(1) Goal and target compounds:

To select the transformed Saccharomyces cerevisiae BY4742 cells with successfully constructed level-2 plasmids.

(2) Materials:

• Templates and targeted fragments:
• TY9 genome (GGPPS): 60 μL
• TY9 genome (AH3): 60 μL
• TY10 genome (GGPPS): 60 μL
• TY10 genome (AK6): 60 μL
• Forward primer: GCATCGTCTCATCGGTCTCAT(ATG) + CDS-5'
• Reverse primer: ATGCCGTCTCAGGTCTCAGGAT + CDS-3’
• 2× Taq Plus Master Mix

(3) Steps:

1. Select the single bacterial colony and label each colony in order.
2. Add the following different substances to tubes, each for one colony suspension solution, with a total volume of 20µL:
• 2× Taq Plus Master Mix: 10 μL
• F-primer: 0.5 μL
• R-primer: 0.5 μL
• Colony suspension solution: 0.5 μL
• ddH₂O: 8.5 μL
3. Place the 12 test tubes with yeast genome in the PCR machine.

PCR reaction system:

• Pre-denaturation: 94°C, 5 min
• 30 cycles:
• Denaturation: 94°C, 30 sec
• Annealing: 69°C, 30 sec
• Extend: 72°C, 2.5 min
• Thoroughly extend: 72°C, 10 min
• Heat preservation: 16°C

1. Run 1% gel electrophoresis to verify the size of amplified fragments.

Notes & Results:

Results will be determined after verification.

8.8-11.2024

Experiment 2: Repeat of Colony-PCR test of the level-2 plasmids

(1) Goal and target compounds:

To verify the successful integration of GGPPS, AH3, and AK6 genes into the genome of Saccharomyces cerevisiae.

(2) Steps:

Repeat the steps from the last Colony-PCR test of level-2 plasmids on 8.7.2024:

1. Select the single bacterial colony and label each colony in order.
2. Transfer the prepared solution to new 8-well PCR tubes.
3. Add the following different substances to tubes, each for one colony suspension solution, with a total volume of 20µL:
• 2× Taq Plus Master Mix: 10 μL
• F-primer: 0.5 μL
• R-primer: 0.5 μL
• Colony suspension solution: 0.5 μL
• ddH₂O: 8.5 μL
4. Run the following PCR amplification program:
• Initial denaturation: 95˚C, 3 min
• 30 cycles:
• Denaturation: 95˚C, 15 sec
• Annealing: 52˚C, 20 sec
• Extension: 72˚C, 2.5 min
• Final extension: 72˚C, 10 min
5. Run 1% gel electrophoresis to verify the size of amplified fragments.

Notes & Results:

• This experiment determines the successful construction of GGPPS, AH3, and AK6 genes on the Saccharomyces cerevisiae genome.
• The length shown in the gel imaging, obtained using the Gel Imager System, matches the theoretical lengths of the GGPPS, AH3, and AK6 genes.
• Results shown below:
• We expanded the successfully obtained single clone plasmid.

8.12.2024

Experiment 1: Bacteria collection

(1) Materials:

• TY9 mixed solution 3L
• TY10 mixed solution 3L

(2) Steps:

1. Divide the 1L TY9 solution into 6 equal parts.
2. Put them into a centrifuge with 1,000 RPM for 10 min.
3. Empty the liquid from the bottles.
4. Repeat steps 1-3 for 3 times.
5. Divide the 1L TY10 solution into 6 equal parts.
6. Put them into a centrifuge with 1,000 RPM for 10 min.
7. Empty the liquid from the bottles.
8. Repeat steps 5-7 for 3 times.

Experiment 2: Bacteria Extraction

(1) Materials:

• TY9
• TY10
• Methanol 360ml
• Ultrasonic apparatus

(2) Steps:

1. Put 30 ml methanol in each TY9 bottle.
2. Mix the liquid inside each bottle well.
3. Combine the solutions from 3 bottles into one.
4. Place 2 bottles into an ultrasonic apparatus for an hour at 4°C.
5. Put 30 ml methanol in each TY10 bottle.
6. Mix the liquid inside each bottle well.
7. Combine the solutions from 3 bottles into one.
8. Place 2 bottles into an ultrasonic apparatus for an hour at 4°C.

Notes & Results:

• TY9 and TY10 compound solutions were successfully prepared.

8.13.2024

Experiment 1: Concentration

(1) Materials:

• TY9 solution
• TY10 solution
• Rotary Evaporator

(2) Steps:

1. Pour the TY9 liquid into the bottle in small amounts.
2. Use the rotary evaporator to concentrate the liquid just poured.
3. Repeat step 1 several times until all the liquid has been poured into the bottle.
4. Pour the TY10 liquid into the bottle in small amounts.
5. Use the rotary evaporator to concentrate the liquid just poured.
6. Repeat step 4 several times until all the liquid has been poured into the bottle.

Notes & Results:

• TY9 and TY10 solutions were successfully concentrated.

Experiment 2: Extraction

(1) Materials:

• TY9
• TY10
• Ethyl acetate 200ml
• Water 200ml
• Methanol 4ml
• Rotary Evaporator
• Separatory funnel

(2) Steps:

1. Add 100ml water and 100ml ethyl acetate to TY9. Mix well.
2. Place the mixture in the separatory funnel to eliminate carbohydrates and other substances.
3. Concentrate the solution using the rotary evaporator.
4. Add 2 ml methanol.
5. Add 100ml water and 100ml ethyl acetate to TY10. Mix well.
6. Place the mixture in the separatory funnel to eliminate carbohydrates and other substances.
7. Concentrate the solution using the rotary evaporator.
8. Add 2 ml methanol.

Notes & Results:

• The precursors of compounds from TY9 and TY10 were successfully extracted.

8.14.2024

Products Detection

(1) Materials:

• CA solution 10ml
• CV solution 10ml
• Methanol 10ml

(2) Steps:

1. Mix CV and methanol in a 1:1 ratio to make a 3 ml solution.
2. Dilute the concentration of the solution to half of the original concentration.
3. Repeat the dilution 7 times until the concentration reaches 0.015625 mg/ml. This serves as the standard group.
4. Place the pure product and the standard obtained from the previous day into the Q-E machine, and compare the image of the product with the image of the standard.

8.15-8.16.2024

Extraction and Products Detection

See experiments on 8.13-8.14 for specific steps.

Notes & Results:

Results shown below:

• TY9 Q-E quantitative detection graph
• TY10 Q-E quantitative detection graph