Overview

In order to acheive the synthesis of the precursors of key bioactive compounds from Salvia plants such as S. miltiorrhiza, we utilized yeast as the chassis organism and employed the GoldenGate assembly method to construct two composite parts, TY9 and TY10. We also conducted tests on vector construction and fermentation processes. The results indicate that we have successfully synthesized tanshinones derivatives and carnosic acid, which are expected to be applied in the treatment of myocarditis.

Design

To realize the production of tanshinones precursor and carnosic acid, the active ingredients of Salvia plants, on the yeast platform, we planned to integrate various key enzyme genes, SmGGPPS, SmCPS, SmKSL, SmCPR, CYP76AH1, CYP76AH3, CYP76AH22, and CYP76AK6, respectively, into pYTK096 vector, and to select the corresponding genes for transcription and termination to control the expression of these enzymes in Saccharomyces cerevisiae. Promoters and terminators for transcription are used for controlling the expression of these enzyme genes. Detailed design please to our design page.

As shown in the following figure: we constructed the plasmid vectors of TY9 and TY10 by three steps

1. Level 0: Cloning the sequences containing the target genes by PCR reaction, and inserting them into vector pYTK001 by BsmBI respectively,
2. Level 1: Combining the modules of each Level 0, constructing them into vector pYTK095 after ligating them by BsaI zymography,
3. Level 2: Combination of individual Level 1 vectors, constructed into vector pYTK096 after ligation by BsmBI digestion.

(Detailed design can be found in our Design page)

Build

Level 0 Plasmid Construction

Firstly, we designed primer F: GCATCGTCTCATCGGTCTCAT(ATG) + CDS-5' and primer R: ATGCCGTCTCAGGTCTCAGGAT + CDS-3', which contain the BsmBI cleavage site, and cloned the sequences containing CDS of the target genes by PCR reaction. The target genes are SmGGPPS, SmCPS, SmKSL, SmCPR, CYP76AH1, CYP76AH3, CYP76AH22, CYP76AK6, which were obtained from the template DNA.

CDS sequences of Salvia was amplified by PCR and verified (as shown in Figure 3):

According to Figure 3, we can see that the target genes SmGGPPS, SmCPS, SmKSL, SmCPR, CYP76AH1, CYP76AH3, CYP76AH22, and CYP76AK6 have obvious DNA bands at the corresponding positions as expected, and the construct validation is successful.

Then they were inserted into the vector pYTK001 (Figure 4) respectively, which contains the CDS element of the key enzyme gene of the diterpene pathway, and this step is the construction of Level 0. The construction system is as follows:

• 1) pYTK001-PTDH3 (or PCCW12, PPGK1, PTEF1, PTEF2);
• 2) pYTK001-SmGGPPS (or SmCPS1, SmKSL, SmCPR, CYP76AH1, CYP76AH3, CYP76AH22, CYP76AK6);
• 3) pYTK001-TENO1 (or TSSA1, TADH1, TTDH1, TENO2).

The monoclonal strains that did not show fluorescence were transformed in E. coli DH10B. We selected under UV light for colony PCR amplification and validation as shown in Figures 5-6 below:

Level 1 Plasmid Construction

According to Figure 6 electrophoresis diagram, we can see that Level 0 plasmids all have obvious DNA bands at the corresponding positions, which is consistent with our theory, and the construction is verified successfully. Next, we combined each Level 0 junction module, promoter, CDS, terminator, and ending module, and constructed them into vector pYTK095 (Figure 7) through BsaI digestion and ligation, and this step was the construction of Level 1. The construction system is as follows:

• pYTK095-PTDH3-SmGGPPS-TENO1
• pYTK095-PCCW12-SmCPS1-TSSA1
• pYTK095-PPGK1-SmKSL-TADH1
• pYTK095-PTEF2-SmCPR-TTDH1
• pYTK095-PTEF1-CYP76AH1/AH22-TENO2
• pYTK095-PTEF2-CYP76AH3/AK6-TTDH1

After transformation in E. coli DH10B, we selected the single bacterial colony (pYTK095) that does not fluoresce under UV light from the petri dishes. It was used for colony PCR amplification and validation as shown in Figure 8-9 below:

Level 2 Plasmid Construction

According to Figure 9, we can see that Level 1 plasmids all have obvious DNA bands at the corresponding positions, which is consistent with our theory, and the construction verification is successful. Then, we combined the Level 1 vectors and constructed them into pYTK096 vector (Figure 10) by BsmBI digestion and ligation, and successfully constructed the Level 2 vector. The construction system is as follows:

• TY9: pYTK096- PTDH3-SmGGPPS-TENO1: PCCW12-SmCPS1-TSSA1: PPGK1-SmKSL-TADH1: PTEF2-SmCPR-TTDH1: PTEF1-CYP76AH1-TENO2: PTEF2-CYP76AH3-TTDH1
• TY10: pYTK096-PTDH3-SmGGPPS-TENO1:PCCW12-SmCPS1-TSSA1: PPGK1-SmKSL-TADH1:PTEF2-SmCPR-TTDH1:PTEF1-CYP76AH22-TENO2:PTEF2-CYP76AK6-TTDH1

Similarly, after transformation in E. coli DH10B identified positive monoclones by resistance, fluorescent labeling screening, and colony PCR, the results are shown in Figures 11-12 below:

Figure 11 Fluorescent labeling screening of pYTK095

According to Figure 11, we can see that the one that does not show green fluorescence is the recombinant plasmid we want, which corresponds to the colony PCR agar gel image, and the recombinant plasmid is successfully constructed. Next, we extracted the corresponding plasmid DNA after amplification and culture, and used it for transformation in yeast cells.

The constructed vector was linearized by NotI endonuclease and then transferred into BY4742 yeast receptor cells, which were screened by -ura-deficient medium, and the yeast genomic DNA was extracted for PCR identification to determine the positive single clones. The validation results were as follows:

1) URA-deficient medium screening results (URA-deficient SD):

Figure 13 Graph of the results of the screening of URA-deficient media (left TY9, right TY10)

2）Insert fragment PCR assay results:

The successful monoclonal plasmid was expanded in culture, shaken small overnight and preserved, and the strain was further fermented and cultured using liquid YPDA medium for 5 days and then centrifuged to collect the organisms.

Figure 15 Overnight culture and scale-up of yeast small shake fermentation

Figure16 Schematic diagram of the fermented bacterial liquid

Test: Product Detection

Saccharomyces cerevisiae cells were extracted with methanol by Ultrasonic Cell Disruption for 1 h. After centrifugation at low temperature, the supernatant extract was filtered with a filter membrane, and the filtered samples were transferred to liquid phase vials with lined tubes for Q-Exactive analysis, and the results were as follows:

TY9: as shown in Figure 17, the product of TY9 is mainly composed of two compounds 1,2 which appeared near 6 and 9 minutes, with molecular weights of 317 and 299 under positive mode, respectively. Through literature analysis and discussed with our instructor, we confirmed that the compound MW of 316 is 11-hydroxy-sugiol, and MW 298 has not been found to point to any specific substance at this point in time.

TY10: as can be seen in Figure 18, where Figure 18-A is the result of the TY10 mass spectrometry test, showing that it contains two main compounds 3,4, Figure 18-B is the chromatogram of the carnosic acid (CA) standard, and Figure 18-C is the chromatogram of the carnosol (CV) standard.

As can be seen in Figure 17-18(A-C), the 11-hydroxy-sugiol, CV and CA confirmed the correct synthesis of the products by the mass-to-charge ratios and intensities of the absorption peaks where they are located and the molecular masses compared to the standards, and the 11-hydroxy-sugiol is more predominant in the yeast cell fermentation broth extracts. In Figure 18(D-E), we used CV and CA standards and their corresponding peak areas to derive the corresponding equations:

Equation for CA: y=2E+0.6x+1356.6 (R²=0.9997)
Equation for CV: 1E+0.6x+1252.5 (R²=0.9993)

The yield of CA in the test was calculated to be 0.268 mg/ml, and similarly, the yield of CV in the test can be obtained to be 0.857 mg/ml. Further, the content of the extracted CA in 3 L of fermentation broth in the experiment was obtained to be 0.178 mg/L, and the content of CV was obtained to be 0.571 mg/L.

Learn

In summary, we successfully synthesized key bioactive compounds, including tanshinone derivatives and carnosic acid, using Saccharomyces cerevisiae as a platform. By utilizing the GoldenGate assembly method, we constructed two composite parts, TY9 and TY10, integrating multiple key enzyme genes to achieve the synthesis. Through thorough validation via plasmid construction, PCR amplification, and liquid chromatography-mass spectrometry (LC-MS), we confirmed the production of 11-hydroxy-sugiol, carnosic acid (CA), and carnosol (CV). The yields of CA and CV were calculated, showing promising results for future application in myocarditis treatment.

However, there are areas for improvement:

• Further Analysis of Unknown Compounds and Metabolic Pathway Investigation: The unidentified compound with a molecular weight of 298 is likely a precursor in the tanshinone biosynthesis pathway. Further structural analysis and metabolic pathway mapping are required to confirm its role and complete the synthesis of tanshinone derivatives on the yeast platform. This investigation will focus on identifying all intermediates and optimizing the entire metabolic pathway for efficient production of tanshinones.
• Validation of Anti-inflammatory Efficacy: While we have successfully synthesized tanshinone derivatives and carnosic acid, the next crucial step is to experimentally validate their anti-inflammatory properties. This includes conducting in vitro and in vivo assays to confirm the efficacy of these compounds in treating myocarditis and other inflammatory conditions, ensuring their potential for therapeutic use is realized.Optimizing our detection and characterization methods would help address this issue. Additionally, increasing the overall yield of CA and CV is necessary for large-scale application, and refining the fermentation process could help improve these outcomes.
• Boosting Production: Boost the production of these bioactive compounds by optimizing the fermentation parameters, increase enzyme expression levels, and explore alternative engineering strategies.

References

1. Novarina D, Koutsoumpa A, Milias-Argeitis A. A user-friendly and streamlined protocol for CRISPR/Cas9 genome editing in budding yeast[J]. STAR protocols, 2022, 3(2): 101358.
2. Guo et al., 2016, New Phytologist，210: 525–534.