Summary
Establishing engineered sweet potato is a time-intensive process due to the lengthy duration required for seedling regeneration and starch accumulation in the storage roots. A detailed account of our project’s experimental timeline is provided below. For specific procedural steps and experimental outcomes, please refer to the Protocols and Engineering Success sections.
February
- Visit to Science and Research Center of Shanghai Chen Shan Botanical Garden
- Brainstorming
March
- Embryogenic calli induction of sweet potato
- sgRNA target selection
- sgRNA design
- - sgRNA oligos synthesis
April
- Embryogenic calli proliferation of sweet potato
- Construction of the backbone vector
- Construction of the plant expression vector
- Agrobacterium tumefaciens transformation
- Agrobacterium-mediated transformation for sweet potato
- Screening and selection of calli mutant
Figure. a. E. coli with psgR-Cas9-IbSBEI-sgRNA;
Figure. b. PCR product of IbSBEI-sgRNA (primer F: 5’-TGTAAAACGACGGCCAGT-3’; primer R: 5’-CTCCCGATAGGTGATACCTG-3’);
Figure. c. E. coli with psgR-Cas9-IbSBEII-sgRNA;
Figure. d. PCR product of IbSBEII-sgRNA (primer F: 5’-TGTAAAACGACGGCCAGT-3’; primer R: 5’-TGGAGAGCTTTTGAGATTCA-3’).
Figure. Left: E. coli with pCAMBIA-1300--IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA; right: PCR product of IbSBEI-sgRNA/ IbSBEII-sgRNA (primer as former description respectively)
Figure. Left: Agrobacterium tumefaciens with pCAMBIA-1300--IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA; right: PCR products of bacterial colonies with IbSBEI-sgRNA/ IbSBEII-sgRNA
May
- Regeneration and sub-culture of transgenic sweet potato seedlings
- PCR detection for regenerated seedlings
- Transplantation of transgenic seedlings
Figure. a. Genetically edited sweet potato tissue culture seedlings; b. PCR product of Hyg gene (Hyg-F: Atgaaaaagcctgaactcac; Hyg-R：ctatttctttgccctcggac); c. PCR product of Cas9 gene (Cas9-F: GACAAGAAGTACAGCATCGG; Cas9-R: AGCTGAGACAGGTCGATC);
June
- Literature review
July
- Determination of internode and stem diameter
Figure. a. Comparison of potted seedlings between genetically edited sweet potatoes and the WT; b. Comparison of internode length; c. Comparison of stem diameter.
August
- Storage roots harvest
- Determination of the expression level of SBEI and SBEII in storage roots
- Extraction of total starch in storage roots
- Starch analysis of transgenic sweet potato storage roots
Figure. Analysis of SBEI and SBEII gene expression in genetically edited sweet potatoes.
