Our project aims to increase the amylose content in sweet potatoes and use them as a raw material for developing anti-glycemic foods for people with diabetes and others needing to control blood sugar levels. We successfully knocked out the SBEI and SBEII genes, which encode starch branching enzymes, in sweet potatoes. The gene-edited plants showed normal growth, with stem diameters nearly doubling and internode lengths reduced to 25% of the wild type (WT), resulting in a shorter and sturdier overall phenotype. Testing showed that knocking out the SBE genes significantly boosted amylose content, with the best strain achieving a 104% increase.

1.1 Gene editing chassis selection: Sweet Potato (Ipomoea batatas)

Sweet potatoes are an excellent raw material for developing anti-glycemic foods due to their high yield per acre, strong resistance to environmental stress, and lower susceptibility to pests and diseases [1]. Compared to corn or wheat, sweet potatoes are richer in natural vitamins (such as vitamins A and C) and minerals (such as potassium, calcium, and iron), offering superior nutritional value [2]. Moreover, increasing the amylose content in sweet potatoes has minimal impact on their flavor, making them more suitable for long-term daily consumption by individuals with diabetes and others needing to control blood sugar levels [3].

1.2 Knock-out SBEI and SBEII

Foods rich in resistant starch are a large group of anti-glycemic foods. How to increase the content of resistant starch in sweet potatoes? For this we talked to Prof. Li from Yangzhou University. We learned that the modification methods of starch synthesis pathway in crops are relatively mature. Amylose mainly belongs to RS2 and RS3 resistant starch, which has the property that resistant starch is not easily digested and degraded by amylase [4]. The substrate required for the biosynthesis of both amylose and amylopectin is ADP-glucose, and there is substrate competition between them [5]. Therefore, truncation of the amylopectin synthesis pathway enhances the metabolic flow of amylose biosynthesis. The key enzymes for amylopectin biosynthesis are starch branching enzymes [6]. There are two homologous genes (SBEI and SBEII) in sweet potato that can both encode starch branching enzymes, so we will knock out both SBEI and SBEII for increasing the yield of amylose.

Figure 2. Diagram of the biosynthetic pathways of amylose and amylopectin

1.3 Plasmid selection

To generate the SBEI and SBEII double mutant, the CRISPR/Cas9-mediated genome-editing system was employed to introduce mutations in the SBEI and SBEII genes in the WT background [7]. The vectors psgR-Cas9-At and pCambia1300 are commonly used for CRISPR/Cas9-mediated genome editing. The functional components containing IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA, were cloned into the pCambia1300 vector. This recombinant plasmid was then transformed into sweet potato to produce the SBEI and SBEII CRISPR double mutant.

Figure 3. a. plasmid map of psgR-Cas9-IbSBEI-sgRNA; b. plasmid map of psgR-Cas9-IbSBEII-sgRNA; c. plasmid map of psgR-pAtU6-sgRNA SBEI-pAtUBQ-Cas9-tUBQ-pAtU6-sgRNA SBE II; d. plasmid map of pCAMBIA-1300--IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA; e. Schematic diagram of the final vector pCAMBIA-1300--IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA construction

2.1 Vector construction

We designed two pairs of sgRNA sequences targeting the knockout of the SBEI and SBEII genes using online sgRNA design tools. To prepare the sgRNAs, we first denatured the secondary structures of the complementary oligonucleotide strands by heating them, then gradually cooled the strands to allow annealing and formation of double-stranded sgRNAs under T4 Polynucleotide Kinase (New England Biolabs, UK). The vector psgR-Cas9-At was linearized using BbsI (FastDigest, Thermo Fisher, Waltham, MA, USA). The double-stranded sgRNAs were then ligated to the linearized vector using Quick T4 DNA ligase (New England Biolabs, UK). The recombinant vectors psgR-Cas9-IbSBEI-sgRNA and psgR-Cas9-IbSBEII-sgRNA were subsequently transformed into E. coli (Figure 4a-4d).

To enhance gene editing efficiency, we integrated the SBEI-sgRNA and SBEII-sgRNA into a single plasmid. The pAtU6-sgRNA-SBEII module was amplified using primers containing 5'-KpnI and 3'-EcoRI sites:
AtU6-F-KpnI: 5’-GTGGTACCCATTCGGAGTTTTTGTATCTTGTTTC-3’
chim-R-EcoRI: 5’-ACGAATTCGCCATTTGTCTGCAGAATTGGC-3’

The vector psgR-Cas9-IbSBEII-sgRNA served as the template. The amplified fragment was inserted into the KpnI and EcoRI sites of the psgR-Cas9-At vector containing the SBEI oligos to create a construct with both customized sgRNAs and a Cas9 module. This construct (psgR-pAtU6-sgRNA SBEI-pAtUBQ-Cas9-tUBQ-pAtU6-sgRNA SBEII) was further digested with EcoRI and HindIII and ligated into the pCAMBIA1300 binary vector for plant transformation.

The final construct, pCAMBIA1300-IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA, was chemically transformed into E. coli. Colony PCR was performed to confirm that the recombinant bacteria contained both the SBEI-sgRNA and SBEII-sgRNA sequences (Figure 4e, 4f).

Figure 4. a. E. coli with psgR-Cas9-IbSBEI-sgRNA; b. PCR product of IbSBEI-sgRNA (primer F: 5’-TGTAAAACGACGGCCAGT-3’; primer R: 5’-CTCCCGATAGGTGATACCTG-3’); c. E. coli with psgR-Cas9-IbSBEII-sgRNA; d. PCR product of IbSBEII-sgRNA (primer F: 5’-TGTAAAACGACGGCCAGT-3’; primer R: 5’-TGGAGAGCTTTTGAGATTCA-3’); e. E. coli with pCAMBIA-1300--IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA; f. PCR product of IbSBEI-sgRNA/ IbSBEII-sgRNA (primer as former description respectively)

2.2 Agrobacterium-mediated infection of callus tissues

To verify that the correct plasmid, pCAMBIA1300-IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA, was transformed into Agrobacterium tumefaciens, we used PCR to identify positive clones (Figure 5a, 5b). Agrobacterium-mediated transformation is widely employed due to its efficiency in transforming a wide range of plant species and producing stable transgenic lines [8].

Prior to transforming sweet potatoes, we spent over a month inducing callus tissues from the sweet potato plants (Figure 5c, 5d). After infecting the callus tissues with Agrobacterium, we conducted selection on media containing hygromycin to isolate the successfully transformed sweet potato tissues (Figure 5e).

Figure 5. a. Agrobacterium tumefaciens with pCAMBIA-1300--IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA; b. PCR products of bacterial colonies with IbSBEI-sgRNA/ IbSBEII-sgRNA; c. Callus liquid culture; d. Callus tissues infected by Agrobacterium, co-culture; e. Callus tissues infected by Agrobacterium were selected using hygromycin.

2.3 Cultivation and genotyping of Cas-SBE

After multiple rounds of selection, regeneration, and sub-culturing of transgenic sweet potato calli, we performed genotyping of the genetically edited plants. We extracted genomic DNA from the tissue culture seedlings and used it as a template to amplify the hygromycin resistance gene (1026 bp) and the Cas9 gene (4101 bp). We used the hyp gene and the Cas9 gene itself as positive controls and wild type (WT) plants as negative controls. Figures 6b and 6c show that Cas-SBE-1, Cas-SBE-2, and Cas-SBE-3 are positive for transgenic insertion.

Further, we extracted total RNA from the positive transgenic seedlings and performed reverse transcription to convert it into cDNA. This cDNA was then used as a template for PCR. During the PCR amplification, fluorescent dyes on the probes bind to the template DNA and emit fluorescence. The intensity of the fluorescence signals is proportional to the amount of DNA amplified. The PCR instrument monitors these fluorescence signals in real time to quantify the transcription levels of SBEI and SBEII [9].

In Cas-SBE-1, the expression levels of SBEI and SBEII were reduced by 75%. In Cas-SBE-2, the transcription levels of SBEI decreased by 78% and SBEII decreased by 86% (Figure 6d). Therefore, the knockout of the SBE genes has been successful.

Figure 6. a. Genetically edited sweet potato tissue culture seedlings; b. PCR product of Hyg gene (Hyg-F: Atgaaaaagcctgaactcac; Hyg-R：ctatttctttgccctcggac); c. PCR product of Cas9 gene (Cas9-F: GACAAGAAGTACAGCATCGG; Cas9-R: AGCTGAGACAGGTCGATC); d. Analysis of SBEI and SBEII gene expression in genetically edited sweet potatoes.

2.4 Phenotypic analysis of Cas-SBE

To ensure that the knockout of the SBEI and SBEII genes does not adversely affect the normal growth of sweet potatoes and thus avoid a significant reduction in yield, we measured and analyzed several developmental traits of the sweet potato plants in comparison with the WT. Internode length is defined as the distance between two adjacent leaves along the stem or branch, specifically the portion of the stem between two nodes. In the transgenic plants, the internode length was reduced by 4.5-4.7 cm compared to the WT, while the stem diameter increased by 1.4-1.8 mm, indicating that the growth rate of Cas-SBE plants is relatively slower and they are more robust (Figures 7a-7c) [10]. From a commercial development perspective, these factors should be considered in cost calculations.

Figure 7. a. Comparison of potted seedlings between genetically edited sweet potatoes and the WT; b. Comparison of internode length; c. Comparison of stem diameter.

3.1 Total starch content analysis

We tested the total starch content in WT and genetically edited sweet potato lines (CAS-SBE-1, CAS-SBE-2, CAS-SBE-3) by Total Starch Content (Enzymatic Method) Assay Kit. The results indicate a slight increase in starch content in the CAS-SBE lines compared to the WT; however, the overall difference is not substantial. All three CAS-SBE lines remains relatively similar, with values hovering around 450-500 mg/g dry weight (DW), while the WT shows a slightly lower content (each of the CAS-SBE lines represents an independent biological replicate) (Figure 8). These findings suggest that knocking out the SBE genes does not lead to a marked change in total starch accumulation in sweet potato plants.

Figure 8. Total starch analysis

3.2 Amylose content analysis

In cases where there is no significant difference in total starch content, we have measured the percentage of amylose in both Cas-SBE and WT. Most plants naturally store starch as a mixture of amylose and amylopectin, with amylopectin making up most of the starch granules. Starch granules composed entirely or almost entirely of amylose do not exist in nature because excessively high levels of amylose can adversely affect the overall health and productivity of plants [11]. However, it is feasible to increase the amylose content to a reasonable extent. In our gene-edited Cas-SBE plants, the proportion of amylose increased from 21% to approximately 40%, representing an overall increase of 80%-104% (Figure 9). These results indicated that the effectiveness of our SBE gene knockout.

Figure 9. Percent of amylose content

3.3 Resistant starch content analysis

Amylose mainly belongs to RS2 and RS3 resistant starch, which has the property that resistant starch is not easily digested and degraded by amylase [4]. Therefore, based on the increase in amylose content, we would also expect an increase in the resistant starch content in the Cas-SBE plants. We used a resistant starch assay kit to measure the resistant starch content in the plants. Compared to the WT plants, the resistant starch content in the Cas-SBE plants increased by 121%-133% (Figure 10). Foods with high resistant starch content can provide anti-glycemic effects [12].

We have demonstrated that knocking out the SBEI and SBEII genes in sweet potatoes significantly increases the amylose content without causing severe impacts on plant growth and development.

Moving forward, we plan to further optimize these genetically modified sweet potatoes with the aim of achieving an amylose content of approximately 60%. First, we will focus on identifying plants with both SBEI and SBEII genes completely knocked out in the hexaploid variety by designing more precise and effective sgRNAs. Second, we will explore the overexpression of genes associated with amylose synthesis, such as granule-bound starch synthase (GBSS), to enhance amylose accumulation. It’s crucial to maintain an appropriate level of amylose, as excessive amounts (above 70%) can hinder sweet potato development and may cause digestive issues for consumers. This advancement will facilitate the use of high-amylose sweet potatoes in the diets of individuals with diabetes or others who need to manage blood sugar, making it possible to produce snacks for these people.

1. WANG Xin, LI Qiang, CAO QingHe, MA DaiFu. Current Status and Future Prospective of Sweet potato Production and Seed Industry in China[J]. Scientia Agricultura Sinica, 2021, 54(3): 483-492.
2. Zheng Y, Wang Q, Li B, Lin L, Tundis R, Loizzo MR, Zheng B, Xiao J. Characterization and Prebiotic Effect of the Resistant Starch from Purple Sweet Potato. Molecules. 2016 Jul 19;21(7):932.
3. Zhong Y, Tai L, Blennow A, Ding L, Herburger K, Qu J, Xin A, Guo D, Hebelstrup KH, Liu X. High-amylose starch: Structure, functionality and applications. Crit Rev Food Sci Nutr. 2023;63(27):8568-8590.
4. Birt DF, Boylston T, Hendrich S, Jane JL, Hollis J, Li L, McClelland J, Moore S, Phillips GJ, Rowling M, Schalinske K, Scott MP, Whitley EM. Resistant starch: promise for improving human health. Adv Nutr. 2013 Nov 6;4(6):587-601.
5. Changsheng Li, Yongcai Huang, Ruidong Huang, Yongrui Wu, Wenqin Wang. The genetic architecture of amylose biosynthesis in maize kernel. Plant biotechnology journal. 2018;16(2):688-695.
6. Wang H, Wu Y, Zhang Y, Yang J, Fan W, Zhang H, Zhao S, Yuan L, Zhang P. CRISPR/Cas9-Based Mutagenesis of Starch Biosynthetic Genes in Sweet Potato (Ipomoea Batatas) for the Improvement of Starch Quality. Int J Mol Sci. 2019 Sep 23;20(19):4702.
7. Wenshan Liu, Xiaohong Zhu, Mingguang Lei, Qingyou Xia, Jose Ramon Botella, Jian-Kang Zhu, Yanfei Mao. A detailed procedure for CRISPR/Cas9-mediated gene editing in Arabidopsis thaliana. Science Bulletin. 2015, 60(15):1332-1347.
8. Zambryski, P., Joos, H., Genetello, C., Leemans, J., Montagu, M. V., & Schell, J. (1983). "Ti plasmid vector for the introduction of DNA into plant cells without alteration of their normal regeneration capacity." EMBO Journal, 2(12), 2143–2150.
9. Livak, K.J., & Schmittgen, T.D. (2001). "Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method." Methods, 25(4), 402-408.
10. Davies, P. J. (2010). "Plant Hormones: Biosynthesis, Signal Transduction, Action!" Springer.
11. Richard F. Tester, John Karkalas, Xin Qi. Starch—composition, fine structure and architecture. Journal of Cereal Science. 2024, 39(2):151-165.
12. Wang S, De Paepe K, Van de Wiele T, Fu X, Wang S, Zhang B, Huang Q. Starch-entrapped microspheres enhance gut microbiome-mediated anti-obesity effects of resistant starch in high-fat diet induced obese C57BL/6J mice. Food Res Int. 2023 Oct;172:113215.