Header Banner Image Lab Notebooks
Lab Notebooks

Wet Lab


During our iGEM year, we organized our project by forming multiple subgroups, each dealing with different parts of our project.

Sherlock Lab


08.04. - 14.04

Since the RPA kit was not yet available, the pre-amplification was completed using a PCR reaction. Moving forward, Synthetic DNA 1 will be referred to as SynDNA.

 

  1. Primers were suspended in water according to the manual to create stocks (100 μM).


Figure 1: Manual detailing the parameters of the oligonucleotides used


SynF: AATTCTAATACGACTCACTATAGGGATCCTCTAGAAATATGGATTACTTGGTAGAACAG

SynR: GATAAACACAGGAAACAGCTATGACCATGATTACG

T7-3GIVT primer: GAAATTAATACGACTCACTATAAGGG



  1. 10-fold dilutions of the primers were prepared to create 10 μM samples.

  2. SynDNA was diluted according to the manual. The concentration of SynDNA was calculated from the data in the said manual.


Figure 2: Manual detailing the parameters of the oligonucleotides used


SynDNA: GGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAAATATGGATTACTTGGTAGAACAGCAATCTACTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAG

SyncrRNA: CTCGACCTGCAGGCATGCAAGCTTGGCGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC



(53386 g * 100 μmol) / 1000 000 μmol = 5.34 g

(5.34 g * 1 ml) / 1000 ml = 5.34 mg (of Synthetic DNA 1 in 1 ml of stock) = 

5.34 μg /μl (concentration of the stock)


  1. 8,4 μl was taken from the stock and added to 491.6 μl of water creating a diluted stock sample with 89.7 ng/μl concentration.

  2. This stock solution was further diluted 10-fold to create a workable sample with 8.97 ng/μl concentration.

  3. Six samples were prepared (including negative control), as follows:


Table 1: PCR Reaction Master Mix components (for a single reaction):

Component

Volume [µl]

Q5 mix

10

Template DNA (water in negative control)

2

SynF primer (10 µM)

1

SynR primer (10 µM)

1

H₂O

6

Total

20


Reaction conditions (steps in italics indicate the cyclically repeated ones):

  • pre-denaturation – 98°C, 30 sec

  • denaturation – 98°C, 10 sec

  • annealing – temperature gradient (58°C, 60°C, 62°C, 64°C, 66°C) 30 sec

  • elongation – 72°C, 10 sec

  • final elongation – 72°C, 2 min

  • number of cycles – 35

Electrophoresis

  1. Pre-prepared TAE-Agarose gel (1%) was melted.

  2. Once fully melted and cooled, 35 ml of the solution was transferred to a falcon tube, and 1.75 μl of Syngen GreenDNA Gel Stain (20,000x) was added.

  3. 5 μl of the PCR product was mixed with 1 μl of a loading buffer. The resulting 5 μl samples were then loaded onto the gel alongside a DNA ladder (Thermo Scientific GeneRuler 100 bp, 0.1 μg/μl).

  4. Electrophoresis was carried out at 90 V for 50 minutes in a TAE buffer.



Figure 3: Gel electrophoresis of the obtained SynDNA amplification products.


Conclusions: The expected product length was 127 bp. All tested temperatures yielded satisfactory results, except for the reaction conducted at an annealing temperature of 66°C. The product obtained at 62°C was selected for further testing.

  1. The annealing reaction was conducted according to the Kellner et al. [1]

Table 2: Annealing Reaction Mix components (for a single reaction):

Component

Volume [µl]

crRNA template, 100 µM

1

T7-3G oligonucleotide, 100 µM

2

Standard Taq buffer, 10x

1

H₂O

7

Total

11

  1. A 5-minute denaturation was conducted, after which the reaction was slowly cooled in a thermocycler to 4°C, at a rate of 0.1°C/s.


IVT reaction

IVT (in vitro transcription) reaction was performed. The reaction mix content was as follows:

Table 3: IVT Reaction Mix components (for a single reaction):

Component

Volume [µl]

H₂O

15

Annealing reaction mix

10

5x Buffer (from TranscriptAid T7 High Yield Transcription Kit, Thermo Scientific)

4

rNTP mix 

8

Enzyme mix

2

Total

39


The reaction was incubated for 4 hours at 37°C. 

Note: DNA sequences of SynDNA and SynCrRNA were introduced by Kellner et al. [1]


  1. 2 U of DNase I, RNase-free was added per 1 μg of template DNA directly to a transcription reaction mixture.

  2. The reaction was incubated at 37°C for 15 minutes.

  3. Dilute the sample to 200 μl with RNase-free water.

  4. DNase was inactivated by phenol/chloroform extraction.

  5. 100 μl of phenol, 100 μl of chloroform and 20 μl of sodium acetate were added to the sample, then the sample was mixed thoroughly.

  6. The mixture was centrifuged for 10 minutes (max speed, 4°C).

  7. The upper phase was taken to continue the experiment.

  8. 100 μl of chloroform were added and the sample was thoroughly mixed.

  9. Centrifugation for 5 minutes (max speed, 4°C)

  10. The upper phase was taken to continue the experiment.

  11. 1:1 volume of isopropanol was added to the sample, the sample was mixed.

  12. The sample was incubated at –20°C for 5 minutes.

  13. The sample was centrifuged for 10 minutes (max speed, 4°C).

  14. The pellet was washed with 70% EtOH twice (centrifuged in between for 5 min, max speed, 4°C) and then left to dry.

  15. 20 μl of DEPC-treated water was added to the pellet without pipetting and the sample was left to incubate on ice for 5 minutes.

  16. The pellet was then resuspended and the concentration of RNA was measured. The RNA purification protocol post IVT can be accessed here.

csyncrRNA = 4530.9 ng/ul


15.04. - 21.04

Buffer preparation 

  1. A solution of TBE Buffer (100ml) was prepared:

  • 10.8 g of Tris base

  • 5.5 g of boric acid

  • 4 ml EDTA (0.5M)

  • water (enough to fill the mixture to obtain 100ml of solution).


  1. A 50 ml solution of 10M urea buffer was prepared by dissolving 30 g of urea on a heat plate. The urea was first dissolved in a small volume (~10 ml) of deionized water, and then the solution was brought up to a final volume of 50 ml.

Both buffers were filtered using a 0.45 nm filter.


RNA electrophoresis

  1. 20 ml of 5% polyacrylamide gel was prepared, according to the following instructions:


Table 4: Polyacrylamide gel components:

Component

Volume [ml]

40 % acrylamide (Acrylamide/Bis-Acrylamide 19:1)

2.5

10M Urea Buffer

14

10 x TBE

2

10% APS

0.2

H₂O

1.3


  1. The solution was lightly mixed, and 10 μl of TEMED was added; the solution was once again lightly mixed.

  2. The gel was poured carefully and left to polymerize for 30 minutes.


Sample preparation and electrophoresis 


  1. A dilution of the original syncrRNA solution was performed:

  • 1 μl – RNA (c = 4530.9 ng/μl)

  • 9 μl – DEPC H2O

2. The sample and marker mixes were prepared:

SAMPLE

  • 1.1 μl – syncrRNA diluted solution (c = 453.09 ng/μl)

  • 4.9 μl – DEPC H2O

  • 6 μl – RNA LB Buffer

LADDER

  • 3 μl – RiboRuler High Range RNA Ladder (from TranscriptAid T7 High Yield Transcription Kit, Thermo Scientific, lot. 00150262)

  • 3 μl – DEPC H2O

  • 6 μl – RNA LB Buffer

3. RNA samples were heated at 70°C for 10 minutes, then immediately chilled on ice.

4. 12 μl of each of the samples were loaded onto the gel, alongside wells filled with LB Buffer, to maintain a straight line of sample migration.

5. Electrophoresis was conducted for 45 minutes under 100 V.


Staining the gel 


  1. After the electrophoresis was completed, the gel was soaked for 15 minutes in 1x TBE buffer solution to remove the remaining urea.

  2. The gel was stained in ethidium bromide solution (c = 0.5 μg/ml) for 15 minutes. The staining solution was prepared, by adding 3.5 μl of ethidium bromide (c = 10 mg/ml) to 70 ml of 1x TBE buffer. 


Figure 4: Gel electrophoresis of the obtained IVT reaction product 


Conclusions: A clear and distinct RNA band was observed, confirming that the IVT reaction was successful. Although the RNA ladder did not develop correctly, this does not impact the interpretation of the results.

  1. A 50 ml solution of HEPES pH = 6.8 buffer was prepared, by dissolving 11.92 g of powdered HEPES substrate (Sigma Aldrich) in a sufficient amount of DEPC H2O. The pH was adjusted to 6.8 using a pH meter. The buffer was then sterile-filtered using a 0.22 μm filter under a laminar hood.

  2. A 1M solution of MgCl2 was prepared by diluting a 3M stock with DEPC-treated water to a final volume of 500 μl.

 

Cas13a dillutions


Stocks of Cas13a of concentrations:

  • Cas13a treated with SUMO protease (later called Cas13aT) = 0.87 mg/ml

  • Cas13a without SUMO protease treatment (later called Cas13aNT) = 0.73 mg/ml

 

  1. Dilutions were prepared with the SB buffer with freshly added DTT (2 μl 1M DTT and 998 μl SB) to obtain 63.3 μl/ml concentrations of the protein specified in Kellner et al.

  • Cas13aT: 3.64 μl protein + 46.36 μl SB DTT

  • Cas13aNT: 4.34 μl protein + 45.66 μl SB DTT 

Reagent preparation

  1. A dilution of the syncrRNA was prepared, by combining the following, to obtain a concentration of 10 ng/μl:

  • 1.1 μl of 453.1 ng/μl solution of syncrRNA

  • 48.9 μl of ultra-pure H2O

  1. Two aliquots of dry RNaseAlert were resuspended in 25 μl 10X RNaseAlert® Lab Test Buffer, to a concentration of 2 μM.

Assembling the assay


The reactions were performed under 6 different conditions:

  1. Cas13aT (complete)

  2. Cas13aNT (complete)

  3. Using water instead of protein (negative control)

  4. RNase A instead of protein (positive control)

  5. Cas13aT without target and syncrRNA

  6. Cas13aNT without target and syncrRNA

 

Table 5: The composition of SHERLOCK reaction mixes:



Component (volume in μl)

Sample number 

1

2

3

4

5

6

UltraPure Water

56.35

56.35 

66.35 

68.85 

63.85 

63.85 

HEPES, pH 6.8, 1M

2 

2

2

2

2

2

MgCl2

0.9

0.9

0.9

0.9

0.9

0.9

rNTP mix, 25mM each

4

4

4

4

4

4

Cas13a

10

10

-

-

10

10

Murine RNase inhibitor 40 U/μl

5

5

5

-

5

5

T7 RNA polymerase

2.5

2.5

2.5

-

-

-

crRNA (10 ng/μl)

5

5

5

-

-

-

RNase Alert

6.25

6.25

6.25

6.25

6.25

6.25



  1. After assembling the reactions, the tubes were briefly vortexed and spinned down.

  2. 4.6 μl of the PCR target DNA product was added to tubes numbered 1, 2, 3, 4

  3. 10 μl of RNaseA from the RNase Alert kit was added to the tube number 4.

  4. The tubes were briefly vortexed and spun down.

  5. 20 μl of the reaction mix from each of the tubes was transferred into a white 384-well plate. Each reaction was carried out with 4 technical replicates.

  6. The plate was spun down and promptly put into a preheated fluorescence plate reader. The conditions were: 37°C, 490 nm excitation, 520 nm emission. Only the first, final read-out was captured. 


Figure 5: Bar plot illustrating the final fluorescence intensity of the samples; numbers of the sample correspond to the classification implemented in the table above



Conclusions: There was no significant difference in activity between LwCas13a treated with SUMO protease and untreated LwCas13a. This suggests that the 6xHis-TwinStrep-SUMO tag does not interfere with crRNA and target RNA binding, and does not affect the protein’s activity in the assay. Therefore, the tagged protein can be effectively used in the assay, which helps reduce both purification costs and labour.

20.05. - 26.05

An RPA reaction was performed using algal DNA (the K3 sample) as the template, along with a positive control. The reaction mixes were prepared as follows:

Positive control:

  • 8 μl – positive control primer mix

  • 29.5 μl – Primer Free Rehydration buffer

  • 9 μl – water

Mix for P. parvum:

  • 2.4 μl – primer mix (10 μM each; GalF & GalR)

  • 29.5 μl – Primer Free Rehydration buffer

  • 11.05 μl – water


  1. 40 μl of reaction mixes were then transferred to Twist Amp enzyme mix pellets and pipetted thoroughly until the pellets dissolved completely.

  2. 10 μl aliquots of the reaction mix were then distributed to PCR tubes and 1 μl of template DNA was added to each of the tubes. A negative control with water instead of the template solution was created.

  3. 0.6 μl of MgAc was added to each of the tubes.

  4. The tubes were placed into a thermocycler at 37°C. To find the most efficient reaction run time, the following samples were prepared:


Table 7: Run times for RPA rections


P. parvum

Positive control

Negative control

Reaction run time [min]

10

20

30

30

30

30


  1. After 4 minutes, the samples were taken out of the thermocycler, vortexed, spinned down briefly and put back into the thermocycler, to increase the effectiveness of the RPA enzymes and help with the amplification of more complicated DNA regions. 

  2. After the incubation time was finished for each of the samples, the tubes were placed in –20°C to stop the reaction.

To verify if the correct product was obtained during amplification, agarose gel electrophoresis was conducted. According to the available literature, RPA amplification products typically need to be purified before running on an agarose gel. To test this theory, a small amount of the unpurified product was directly loaded onto the gel without any purification.


  1. The gel was prepared according to the instructions from 8/04/2024

  2. The electrophoresis was conducted under 90 V for 40 minutes in TAE buffer.


Figure 8: Gel electrophoresis of the non-purified RPA amplification products; 10, 20, 30 – P. parvum products, (+) – positive control, (-) – negative control


Conclusions: As anticipated, the electrophoresis results were inconclusive, confirming that purification is a necessary step before analyzing RPA amplification products.

  1. Both test samples and positive control samples were pooled together, thus creating 15 μl and 10 μl of reaction mixes to be purified.

  2. Samples were then purified using Syngen PCR/Gel ME Mini Kit (50), according to the protocol: “DNA gel extraction protocol using the Syngen Gel/PCR ME Mini Kit”


Purified product electrophoresis

  1. The gel was prepared according to the instructions from 8/04/2024

  2. The electrophoresis was conducted under 90 V for 40 minutes in TAE buffer.


Figure 9:  Gel electrophoresis of the purified RPA amplification products


Conclusions: A product of the correct length (140 bp) was obtained for the positive control. However, no product was detected for the test sample.

Two crRNA templates were designed, each targeting a specific region of the Prymnesium parvum genome. The sequence for this region was obtained by sequencing the PCR product and amplifying it using the Galuzzi_FOR and Galuzzi_REV primers.

Two DNA templates for crRNA were purchased. They will be referred to as PrymcrRNA1 and PrymcrRNA2 from now on. These PrymCrRNAs are depostied in the iGEM Registry under IDs: BBa_K5087022 (PrymCrRNA1) and BBa_K5087023 (PrymCrRNA2).

  1. Both templates were diluted according to the instructions provided by the manufacturer, to obtain a concentration of 100 μM. 


Figure 6: Manual detailing the parameters of the PrymcrRNA1 and PrymcrRNA2


  1. The annealing reaction for both samples was carried out as described on 10/04/2024.

  1. IVT reaction was performed for both of the samples. The reaction mix content was as follows:

Table 6: IVT Reaction Mix components (for a single reaction):

Component

Volume [µl]

H₂O

13

Annealing reaction mix

10

5x Buffer (from TranscriptAid T7 High Yield Transcription Kit, Thermo Scientific)

4

rNTP mix 

10

Enzyme mix

2

Total

39


The reaction ran for 4 hours at 37°C. The samples were kept at -21°C until the next day.

The purification process was carried out as described on 12/04/2024. 


Note: We encountered difficulties during the phenol/chloroform extraction process described in subsection 3 of the protocol. For PrymcrRNA1, the upper layer was challenging to retrieve, leading to a smaller volume of the aqueous phase being collected. As a result, the concentration of the obtained PrymcrRNA1 was lower than expected.

 

PrymcrRNA1.1 = 431.3 ng/ul (A260/A280=2.18 ; A260/A230 = 2.52)

PrymcrRNA1.2 = 191.5 ng/ul (A260/A280=2.14 ; A260/A230 = 2.51)

PrymcrRNA2 = 7292.7 ng/ul (A260/A280=2.08 ; A260/A230 = 2.41)

 

For PrymcrRNA1, the sample was split into two Eppendorf tubes during purification. Due to the difficulties mentioned earlier, the purification method varied between the two samples, resulting in different concentrations.

The gel was prepared as described on 15/04/2024.

  1. Samples were prepared accordingly:


PrymcrRNA1.1

  • 1 μl – RNA

  • 9 μl – DEPC H2O

  • 10 μl – RNA LB Buffer


PrymcrRNA1.2

  • 3 μl – RNA

  • 7 μl – DEPC H2O

  • 10 μl – RNA LB Buffer


PrymcrRNA2 – first, a dilution was prepared, by combining 1 μl of the original sample with 14 μl of H2O, resulting in a concentration = 431 ng/μl

  • 1 μl – RNA

  • 9 μl – DEPC H2O

  • 10 μl – RNA LB Buffer


  1. RNA samples were heated at 70°C for 10 minutes, and then immediately chilled on ice.

  2. 20 μl of each of the samples was loaded onto the gel proceeded by 6 μl of RiboRuler High Range RNA Ladder (from TranscriptAid T7 High Yield Transcription Kit, Thermo Scientific).

  3. The electrophoresis ran under 100 V for 45 minutes in 1x TBE buffer.


Staining the gel

After the electrophoresis was completed, the gel was soaked for 15 minutes in 1x TBE buffer solution to remove the remaining urea.

The gel was stained in ethidium bromide solution (c = 0.5 μg/ml) for 15 minutes. The staining solution was prepared, by adding 3.5 μl of ethidium bromide (c = 10 mg/ml) to 70 ml of 1x TBE buffer. 


Figure 7:  Gel electrophoresis of the obtained IVT reaction product; 1 – RNA ladder, 2,3 – PrymcrRNA1, 4 – PrymcrRNA2


Conclusions: The product obtained appears to be the correct length when compared to previous electrophoresis results. The additional bands observed may be due to contamination or product degradation. Despite this, the samples were considered pure enough to proceed with further experiments.

03.06. - 09.06

After initially failing to obtain the correct post-amplification bands on the gel, we requested the AlgaLab team to isolate DNA from a fresh culture. They confirmed the presence of the Prymnesium genome in the sample using PCR according to the method outlined by Galluzzi et al. [1].


  1. 8 RPA reactions were put together, using the following templates:

  • (-) control: water (no genome)

  • NOW5 genome (the culture's origin is described in the AlgaLab's documentation)

  • DNA P genome (the culture's origin is described in the AlgaLab's documentation)

  • NOW5 genome duplicate

  • DNA P genome duplicate

  • DNA P genome post PCR as in Galluzzi et.al

  • NOW5 genome post PCR as in Galluzzi et.al

 

  1. RPA reactions were assembled according to the protocol provided by Kellner et. al. [2] First, two master mixes were assembled on ice:

  • Forward primer (GalF, 10 µM) – 2.4 µl

  • Reverse primer (Galuzzi REV, 10 µM) – 2.4 µl

  • TwistAmp Rehydration Buffer (from the TwistAmp Basic kit) – 29.5 µl

  • H2O – 8.65 µl

  1. 40 µl of master mix were added to a single enzyme pellet aliquot and the pellet was carefully resuspended

  2. 2.5 µl of 280 mM TwistAmp magnesium acetate was added to each of the tubes.

  3. 10 µl aliquots of the reaction mix were distributed into 7 PCR tubes. 1 µl of template DNA was added to 6 of them. A water-only negative control was included.

  4. Reactions run for 30 minutes in a thermocycler preheated to 37°C. After the reaction was finished, samples were stored in –20°C. 


The samples were then divided:

  • 1, 2, and 3 were purified as a whole

  • 6,7 were divided into two, one half was purified.

  • 4,5 and the other halves of 6,7 were stored. 

The purification protocol was as described in “DNA gel extraction protocol using the Syngen Gel/PCR ME Mini Kit”


Electrophoresis

  1. The gel was prepared according to the instructions from 8/04/2024

  2. The electrophoresis was conducted under 90 V for 40 minutes in the TAE buffer.


Figure 10: Gel electrophoresis of the purified RPA amplification products


When the photo was overexposed, the correct bands appeared in wells containing samples 6 and 7. A faint shadow of the product was also visible in well 2, though it was unclear.

In the future, running electrophoresis after amplification should not be necessary, as the SHERLOCK method can detect much smaller amounts of DNA than what can be identified using standard agarose gel electrophoresis.

5/06/2024

We decided to proceed with the SHERLOCK reaction despite not observing any bands on the gel. According to Kellner et al. [1], gel visualization isn’t typically required after the RPA reaction. While we checked the gel for confirmation, we ultimately concluded it wasn't a necessary step to move forward.

In this SHERLOCK test, we employed two types of amplification: first PCR, followed by RPA. Our ultimate goal is to rely solely on RPA, but for this experiment, we aimed to maximize amplification to ensure we had sufficient DNA to validate our PrymcrRNAs design.

  1. The following reaction combinations have been prepared in duplicates:

DNA P genome post PCR concentration: 280 ng/µl


Table 8: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1

DNA P post PCR (GalF & GalR)

PrymcrRNA1

2

DNA P post PCR (GalF & GalR)

PrymcrRNA2

3

DNA P post PCR (GalF & GalR)

syncrRNA

4

SynDNA1 post PCR

PrymcrRNA1

5

SynDNA1 post PCR

PrymcrRNA2

6

SynDNA1 post PCR

syncrRNA

7

Positive control (RNase)

-


The 7th reaction was a positive control with RnaseA

  1. The volumes of each reagent used for the reaction are listed below:

Table 9: SHERLOCK samples content

Component

Volume for regular reactions [µl]

Volume for positive control [µl]

UltraPure Water

28.18

36.43

HEPES, pH 6.8, 1M

1 

1

MgCl2

0.45 

0.45

rNTP mix, 25mM each

2

-

Cas13a

5 

-

Murine RNase inhibitor 40 U/μl

2.5 

-

T7 RNA polymerase

1.25 

-

crRNA (10 ng/μl) (interchangable)

2.5 

-

RNase Alert

3.13 

3.13


  1. 2,3 μl of the template (interchangeable, as described above) were added to each reaction mix.

  2. 20 μl of the reaction mix from each tube was transferred into a white 384-well plate. Each reaction was carried out with 2 technical replicates.

  3. The plate was spun down and promptly put into a pre-heated fluorescence plate reader. The conditions were: 37°C, 490 nm excitation, 520 nm emission.

Note: To determine if the result of the assay is positive or negative, we compare the fluorescence intensity of the negative control to the fluorescence intensity of the tested sample. If the fluorescence intensity of the tested sample exceeds that of the negative control, we conclude that the assay result is positive.



Conclusions: Both of the PrymcrRNAs designs proved to be successful in algal DNA detection. Further testing is required to gather more proof and learn more about both of the PrymcrRNAs ability to bind to Cas13a protein and to recognise the target region in the template DNA. 



7/06/2024


This assay aimed to check for the detection of Prymnesium genomic DNA without prior PCR amplification.



DNA template: DNA P: 280ng/µl (as obtained on 3.06. sample number 4) and synDNA: 8.97 ng/µl used for the reaction. 

Note: The exact proportion of the 280 ng/µl genomic DNA that belongs to Prymnesium parvum is uncertain due to the impurity of the culture. It is likely that the Prymnesium parvum DNA constitutes only a small fraction of the total DNA concentration in the sample.


Table 10: SHERLOCK reactions components



Template DNA used for RPA

crRNA

1

DNA P genome (GalF & GalR)

PrymcrRNA1

2

DNA P genome (GalF & GalR)

PrymcrRNA2

3

DNA P genome (GalF & GalR)


PrymcrRNA1 + PrymcrRNA2

4

SynDNA 

PrymcrRNA1 + PrymcrRNA2

5

SynDNA

syncrRNA

6

Positive control (RNase)

-


The volumes of reagents used for each of the reactions were as the one specified on 5/06/2024. 


All other procedures regarding the assay were carried out in the exact same manner.

Sherlock 2 07.06.2024 without PCR

Conclusions: 

Prymnesium parvum genomic DNA was detected, but the overall fluorescence intensity of the samples was lower than in the previous assay. This reduced intensity may be due to the DNA concentration being too low or potential issues with the RPA primers.

10.06. - 16.06

12/06/2024

Since the SHERLOCK assay did not perform efficiently with the genomic DNA, PCR amplification was employed to further test the PrymcrRNA molecules, determine the limit of detection, and obtain additional template material.


  1. DNA template (DNA PCR P+Maj2) dilutions used for the reactions:

  • 19.5 ng/µl

  • 1.95 ng/µl

  • 0.195 ng/µl

  • 0.0195 ng/µl

  • 0.00195 ng/µl.

  1. The following reactions were assembled: 


Table 11: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1.1

DNA PCR P+Maj2 (19.5 ng/µl; GalF & GalR)

PrymcrRNA1

2.1

DNA PCR P+Maj2 (1.95 ng/µl; GalF & GalR)

3.1

DNA PCR P+Maj2 (0.195 ng/µl; GalF & GalR)

4.1

DNA PCR P+Maj2 (0.0195 ng/µl; GalF & GalR)

5.1

DNA PCR P+Maj2 (0.00195 ng/µl; GalF & GalR)

(-).1

Negative control (Water in RPA instead of the template)

1.2

DNA PCR P+Maj2 (19.5 ng/µl; GalF & GalR)

PrymcrRNA2

2.2

DNA PCR P+Maj2 (1.95 ng/µl; GalF & GalR)

3.2

DNA PCR P+Maj2 (0.195 ng/µl; GalF & GalR)

4.2

DNA PCR P+Maj2 (0.0195 ng/µl; GalF & GalR)

5.2

DNA PCR P+Maj2 (0.00195 ng/µl; GalF & GalR)

(-).2

Negative control (Water in RPA instead of the template)

(+)

Positive control (SynDNA)

- 


  1. There was a change in the RNase inhibitor used, thus its volume was adjusted to retain the same activity. From this moment onward, the same volumes of all the reagents were used in all of the assays– see SHERLOCK– protocol 2. 


Table 12: SHERLOCK samples content

Component

Volume for regular reactions (µl)

Volume for positive control (µl)

UltraPure Water

28.68

36.43

HEPES, pH 6.8, 1M

1 

1

MgCl2

0.45 

0.45

rNTP mix, 25mM each

2

-

Cas13a

5 

-

EURX Ribonuclease Inhibitor 50U/ul

2

-

T7 RNA polymerase

1.25 

-

crRNA (10 ng/μl) (interchangable)

2.5 

-

RNase Alert

3.13 

3.13


Conclusions: The high signal from the negative control samples for both PrymcrRNA1 and PrymcrRNA2 indicated possible contamination - no results regarding the LOD can be drawn. This result necessitated further testing.

17.06. - 23.06

21/06/2024


Goal: Determine the limit of detection (LOD) for the detection of PCR products.


  1. The same post-PCR DNA dilutions were used for the RPA reactions. 

  2. Compared to the previous assay, there was an additional negative control for synDNA included (an RPA reaction with water instead of template DNA).


Table 13: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1.1

DNA PCR P+Maj2 (19.5 ng/µl; GalF & GalR)

PrymcrRNA1

2.1

DNA PCR P+Maj2 (1.95 ng/µl; GalF & GalR)

3.1

DNA PCR P+Maj2 (0.195 ng/µl; GalF & GalR)

4.1

DNA PCR P+Maj2 (0.0195 ng/µl; GalF & GalR)

5.1

DNA PCR P+Maj2 (0.00195 ng/µl; GalF & GalR)

(-).1

Negative control (water in RPA mix instead of template) 

1.2

DNA PCR P+Maj2 (19.5 ng/µl; GalF & GalR)

PrymcrRNA2

2.2

DNA PCR P+Maj2 (1.95 ng/µl; GalF & GalR)

3.2

DNA PCR P+Maj2 (0.195 ng/µl; GalF & GalR)

4.2

DNA PCR P+Maj2 (0.0195 ng/µl; GalF & GalR)

5.2

DNA PCR P+Maj2 (0.00195 ng/µl; GalF & GalR)

(-).2

Negative control (water in RPA mix instead of template) 

(-).1/2

Negative control (water in RPA mix instead of template) 

PrymcrRNA1 + PrymcrRNA2

(+)

Positive control (SynDNA)

- 


Conclusions:

Unfortunately, the results indicated contamination in two of the three negative control samples: (-).1 and (-).2. No signal was observed in the wells containing the (-).1/2 sample. It was concluded that the contamination likely resulted from a faulty RPA reaction, most probably due to contaminated primer solutions.


24.06. - 30.06

24/06/2024


Goal: assessing preliminary limit of detection

  1. RPA reactions were conducted according to the Kellner et al protocol. The following target DNA dilutions were used:

  • post PCR– 200 nM (that is equal to the previously used 19.5 ng/µl concentration), 200 pM, 200 fM, 200 aM

  • genomic sample (Maj1)

  1. The SHERLOCK assay was assembled:


Table 14: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1.1

DNA PCR P+Maj2 (200 nM; GalF & GalR)

PrymcrRNA1

2.1

DNA PCR P+Maj2 (200 pM; GalF & GalR)

3.1

DNA PCR P+Maj2 (200 fM; GalF & GalR)

4.1

DNA PCR P+Maj2 (200 aM; GalF & GalR)

5.1

P. parvum genome isolate (GalF & GalR)

(-).1

Negative control (water in RPA mix instead of template DNA)

1.2

DNA PCR P+Maj2 (200 nM; GalF & GalR)

PrymcrRNA2

2.2

DNA PCR P+Maj2 (200 pM; GalF & GalR)

3.2

DNA PCR P+Maj2 (200 fM; GalF & GalR)

4.2

DNA PCR P+Maj2 (200 aM; GalF & GalR)

5.2

P. parvum genome isolate (GalF & GalR)

(-).2

Negative control (water in RPA mix instead of template DNA)

(-).1/2

Negative control (water in RPA mix instead of template DNA)

PrymcrRNA1 + PrymcrRNA2

(+)

Positive control

- 


Conclusions:

The high signal from the negative control makes it impossible to draw any definitive conclusions from the test. Several potential explanations for this result include:

  1. Contamination with RNases: Although this is unlikely since the negative control for PrymcrRNA2 was indeed negative.

  2. PrymcrRNA1 Binding Issue: There may be a problem with PrymcrRNA1, causing it to activate huLwCas13a even in the absence of target RNA.


Goal: Our instructors advised us to check for the presence of RNases in the reagents to determine if they might be responsible for the high signal observed in the PrymcrRNA1 negative control from the previous test.


  1. RNase alert and reagents were mixed in the proportions as in the SHERLOCK reaction. 

  2. The mixes were placed on a plate, incubated for 30 minutes in 37 °C and put in a fluorescence reader. The results obtained are listed below:


Table 15: Fluorescence of SHERLOCK reagents 

Reagent

Fluorescence [a.u.]

Water

1598

HEPES

1492

MgCl2

3069

rNTP mix

1967

huLwCas13a

2204

RNase inhibitor

2701

T7 RNA polymerase

4407

PrymcrRNA1

1737

PrymcrRNA2

2353

RPA buffer

1847

MgAc

1983

DTT

3855


Conclusions:

The highest fluorescence signals were observed for T7 polymerase, DTT, and MgCl2. However, none of these signals matched the high levels seen in the negative control for PrymcrRNA1 from Monday (24.06). Therefore, we doubt that RNase contamination is the cause of the elevated signal.

26/06/2024


  1. The samples were prepared by using the template DNA obtained from the RPA reactions carried out on 24/06/2024. 

  2. A new 1M MgCl2 solution was prepared to be sure that no RNase contamination was present.

Important! A new 384-well plate was used to eliminate potential contamination that might have occurred from reusing the same plate multiple times.

  1. The SHERLOCK assay was assembled in the exact same manner as on 24/06/2024. 

The assay was inconclusive and faulty due to improper calibration of the fluorescence reader settings for the new plate.

Conclusions:

No conclusions can be drawn from the results due to the low fluorescence signal, which appears to be noise. The plate reader settings need to be adjusted for the new plate.

28/06/2024


This assay is a repetition of the SHERLOCK test conducted on 24/06/2024. A new negative control (-).1/2.prym was included: RPA was performed on synthetic target RNA using both synthetic primers and primers specific for Prymnesium. This addition aimed to determine if the Prymnesium RPA primers might have inadvertently acted as a target for PrymcrRNA1, potentially explaining the observed signal in the PrymcrRNA1 negative control (in RPA: water + GalF & GalR). The details of the RPA reactions are listed below:


Table 16: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1.1

DNA PCR P+Maj2 (200 nM; GalF & GalR)

PrymcrRNA1

2.1

DNA PCR P+Maj2 (200 pM; GalF & GalR)

3.1

DNA PCR P+Maj2 (200 fM; GalF & GalR)

4.1

DNA PCR P+Maj2 (200 aM; GalF & GalR)

5.1

P. parvum genome isolate (GalF & GalR)

(-).1

Negative control (water in RPA mix instead of template DNA)

1.2

DNA PCR P+Maj2 (200 nM; GalF & GalR)

PrymcrRNA2

2.2

DNA PCR P+Maj2 (200 pM; GalF & GalR)

3.2

DNA PCR P+Maj2 (200 fM; GalF & GalR)

4.2

DNA PCR P+Maj2 (200 aM; GalF & GalR)

5.2

P. parvum genome isolate (GalF & GalR)

(-).2

Negative control (water in RPA mix instead of template DNA)

(-).1/2

Negative control (water in RPA mix instead of template DNA)

PrymcrRNA1 + PrymcrRNA2

(-).1/2.prym

Negative control (GalF & GalR + synDNA primers)

PrymcrRNA1 + PrymcrRNA2

(+)

Positive control

- 


No signal was observed in either the negative control or the test samples. Something inexplicable is occurring with all samples containing PrymcrRNA1, so we have decided to remove PrymcrRNA1 from further tests for now.

The negative control showed a low fluorescence signal. The current limit of detection for GalF-GalR-PrymCrRNA2 is 200 pM. 



08.07. - 14.07

  1. RPA was performed only on the genomic DNA sample (MAJ1; 39.3 ng/µl) to determine if new primers would enable amplification of the target sequence to a detectable level.

  2. The SHERLOCK assay was conducted on the following samples:


Table 17: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1

Positive control (SynDNA)

syncrRNA

2

Negative control (for SynDNA primers– water instead of template DNA)

syncrRNA

3

MAJ1 (AltF & AltR)

PrymcrRNA2

4

Negative control (AltF & AltR)

PrymcrRNA2

5

MAJ1 (ModF & ModF)

PrymcrRNA2

6

Negative control (ModF & ModF)

PrymcrRNA2


The Alt primers seem to be effective in detecting the genomic DNA. In case of Mod primers, the negative control emitted strong fluorescence singal but no signal was observed in the sample containing genomic DNA. Also no signal was observed in some previous experiments when using Gal primers. We have two hypotheses to explain why this is possible:

  1. Low Genomic DNA Concentration: The genomic DNA concentration might be below the limit of detection for our test.

  2. Tightly Packed DNA: The DNA in the region targeted by the primers could be more tightly packed. This is unlikely, as ribosomal genes are housekeeping genes and the chromatin should remain active at all times. We will nevertheless test if thermal denaturation can help generate any signal.

9/07/2024


  1. 3 post-PCR DNA samples were cleaned using Monarch PCR&DNA CleanUp Kit (NEB). The obtained concentrations for the sample were as follows:

  • Maj2– 25.9 ng/µl; A260/A280=1.66

  • Now5.1– 15.5 ng/µl; 1.89

  • Maj1 – 35.4 ng/µl; 1.78

  1. The sample “Maj1” was used for further testing. Dilutions of the sample were created: to obtain the following concentrations: 200 nM, 200 pM, 200 fM, 200 aM. 

  2. Genomic DNA sample (Maj1, 24.1 ng/μl) was thermally denatured for 10 minutes at 100°C, to check the hypothesis about faulty genomic DNA detection due to tightly packed chromatin.

  3. The SHERLOCK assay was conducted on the following samples:


Table 18: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1

DNA PCR Maj1 (200 nM; GalF & GalR)

PrymcrRNA2

2

DNA PCR Maj1 (200 pM; GalF & GalR)

3

DNA PCR Maj1 (200 fM; GalF & GalR)

4

DNA PCR Maj1 (200 aM; GalF & GalR)

5

P. parvum genome isolate after thermal denaturation (GalF & GalR)

6

Negative control (negative control from the PCR reaction used instead of template in RPA; we wanted to check whether the PCR mix itself does not cause the SHERLOCK reaction to be positive, even without the target RNA)

7

Negative control (water in RPA mix instead of template DNA)

8

Positive control (SynDNA)

syncrRNA



Conclusions:

Galuzzi primers proved to be ineffective – a very weak signal was observed in the 200 nM sample, with no signal in the fM, pM and aM samples. We suspect that the PCR product may be incorrect or non-specific, resulting in undetectability by Cas13a protein (in this test we used the Maj1 template, while on 24 and 28.06 Maj2 template). 


PCR on the target DNA, which proved to be successfully detected previously was carried out to obtain more template for the test repetition. 

The lack of signal in the genomic sample is not due to tightly condensed chromatin (as there was no signal in sample 5). It is likely that the concentration of the genomic DNA is below the limit of detection. This conclusion is supported by the following calculations:

 

Prymnesium parvum genome length

Based on this article: https://orbit.dtu.dk/en/publications/long-read-genome-sequencing-provides-novel-insights-into-the-harm, the P. parvum genome is somewhere between 97.56 and 107.32 Mb. For the clarity sake, the average length used for the calculations was 100 Mb.

 

The average weight of a single DNA bp is 650 daltons. So the molecular weight of the whole P. parvum genome is:

100 × 106 × 650 Da = 6.5 × 1010 Da

 

Based on that, we calculate the molar concentration:

 

(24.1 ng/μl / 6,5 × 1010 Da ) × 106 = 0,000370769 nM = 370.8 fM


However, taking into account the analysis conducted on 06.08 by Filip in the GenomeLab we know that on average 12 copies of ITS are present in the algal genome (25% of cells have 8 ITS copies, 50% have 12 copies, 25% have 16 copies)


Therefore, we multiply the concentration above by 12:

370.8 fM × 12 = 4449.6 fM = 4,45 pM

 

Such low concentration may be below the limit of detection for our test (most likely it is between 200 pM and 200 fM). The LOD for our test needs to be set more precisely in further tests.



The PCR for 0.5 μl of the target DNA from 24/06 and 28/06 (P+Maj2 sample) was successful, as confirmed by electrophoresis. The PCR and electrophoresis were conducted by Dominika and Karolina at AlgaLab.


9 μl of the PCR product was purified using Monarch PCR&DNA CleanUp Kit (NEB). The obtained concentration was 27.4 ng/μl. 

  1. Samples were diluted to the following concentrations: 200 nM, 200 pM, 20 pM, 2 pM, 200 fM, 200 aM. The addition of two new dilutions (20 pM and 2 pM) was caused by the fact, that the PrymFlow lab and our test from 28/06 indicated that the limit of detection is somewhere between 200 pM and 200 fM. 

  2. RPA reactions were conducted for 20 minutes and then stored at –20°C. 

11/07/2024


Repetition of the previous assay. 


  1. The SHERLOCK assay was conducted on the following samples:


Table 19: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1

DNA PCR Maj2 (200 nM; GalF & GalR)

PrymcrRNA2

2

DNA PCR Ma2 (200 pM; GalF & GalR)

3

DNA PCR Maj2 (200 fM; GalF & GalR)

4

DNA PCR Maj2 (200 aM; GalF & GalR)

5

Negative control (water in RPA mix instead of template DNA)

6

Positive control (SynDNA)

syncrRNA




The PCR amplified template was suitable for SHERLOCK tests. It was again confirmed that LOD for GalF-GalR-PrymCrRNA2 is between 200 pM and 200 fM.


11/07/2024


We aimed to assess the limit of detection (LOD) more precisely, which is likely between 200 pM and 200 fM.


  1. The SHERLOCK assay was conducted on the following samples:


Table 20: SHERLOCK reactions components


Template DNA used for RPA

crRNA

2

DNA PCR Maj2 (200 pM; GalF & GalR)

PrymcrRNA2

3

DNA PCR Maj2 (20 pM; GalF & GalR)

4

DNA PCR Maj2 (2 pM; GalF & GalR)

5

DNA PCR Maj2 (200 fM; GalF & GalR)

7

Negative control (water in RPA mix instead of template DNA)

8

Positive control (SynDNA)

syncrRNA


Conclusions:

The initial template DNA concentration does not show a linear relation with fluorescence intensity. Optimizing primer concentration may solve the issue. The detection of 200 fM by the assay is a promising sign for the LOD value. 

From the first SHERLOCK test, it was concluded that the LOD is between 200 pM and 200 fM. The second SHERLOCK test was performed to assess the LOD more precisely, and it was unexpectedly able to detect a 200 fM concentration.

15.07. - 21.07

16/07/2024


After the first test of Mod and Alt primers on 08.07 we wanted to evaluate their performance more deeply. We aimed to determine if the Mod or Alt primers used for RPA could detect a 200 fM sample of target DNA. Both primer sets were tested separately with PrymcrRNA1 and PrymcrRNA2.


  1. Adequate RPA reactions were assembled, using the KAC PCR product. The reaction ran for 20 minutes. 

  2. The SHERLOCK assay was conducted on the following samples:


Table 21: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1

DNA PCR KAC (530 nM; GalF & GalR)

PrymcrRNA2

2

DNA PCR KAC (200 fM; GalF & GalR)

PrymcrRNA2

3

Negative control (water in RPA GalF & GalR)

PrymcrRNA2

4

DNA PCR KAC (530 nM; AltF & AltR)

PrymcrRNA1

5

DNA PCR KAC (530 nM; AltF & AltR)

PrymcrRNA2

6

DNA PCR KAC (200 fM; AltF & AltR)

PrymcrRNA1

7

DNA PCR KAC (200 fM; AltF & AltR)

PrymcrRNA2

8

Negative control (water in AltF & AltR)

PrymcrRNA1

9

Negative control (water in AltF & AltR)

PrymcrRNA2

10

DNA PCR KAC (530 nM; ModF & ModF)

PrymcrRNA1

11

DNA PCR KAC (530 nM; ModF & ModF)

PrymcrRNA2

12

DNA PCR KAC (200 fM; ModF & ModF)

PrymcrRNA1

13

DNA PCR KAC (200 fM; ModF & ModF)

PrymcrRNA2

14

Negative control (water in ModF & ModF)

PrymcrRNA1

15

Negative control (water in ModF & ModF)

PrymcrRNA2

16

Positive control (SynDNA)

syncrRNA



Conclusions:

The best primer-PrymcrRNA pair appears to be Mod-PrymcrRNA1, as it achieved high fluorescence intensity for both 530 nM and 200 fM samples. No other combination was effective in detecting the 200 fM target concentration.

17/07/2024


To confirm that the obtained results were not a coincidence, the SHERLOCK assay was repeated. The procedures and descriptions from the previous assay were applied.


Conclusions:

Results show consistent detection of target DNA concentration, with slight variability in fluorescence reads possibly due to non-optimized RPA primer concentration.

17/07/2024


The purpose of this test was to determine if mixing PrymcrRNAs or forward and reverse primers between the sets could achieve a lower limit of detection than the previously established 200 fM (for Mod+PrymcrRNA1 and occasionally Gal+PrymcrRNA2).


  1. Adequate RPA reactions were assembled, using the KAC PCR product. The reaction ran for 20 minutes. Galuzzi primers were not used for the test with PrymcrRNA1+2 because it is known from the previous tests that Gal primers + PrymcrRNA1 give us false-positive results. 

  2. The SHERLOCK assay was conducted on the following samples:


Table 22: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1

DNA PCR KAC (480 nM; ModF & ModF)

PrymcrRNA1 PrymcrRNA2

2

DNA PCR KAC (200 fM; ModF & ModF)

PrymcrRNA1 PrymcrRNA2

3

Negative control (water in RPA ModF & ModF)

PrymcrRNA1 PrymcrRNA2

4

DNA PCR KAC (480 nM; AltF & AltR)

PrymcrRNA1 PrymcrRNA2

5

DNA PCR KAC (200 fM; AltF & AltR)

PrymcrRNA1 PrymcrRNA2

6

Negative control (water in AltF & AltR)

PrymcrRNA1 PrymcrRNA2

7

DNA PCR KAC (480 nM; ModF & GalR)

PrymcrRNA1

8

DNA PCR KAC (200 fM; ModF & GalR)

PrymcrRNA1

9

Negative control (water in ModF & GalR)

PrymcrRNA1

10

DNA PCR KAC (480 nM; ModF & GalR)

PrymcrRNA2

11

DNA PCR KAC (200 fM; ModF & GalR)

PrymcrRNA2

12

Negative control (water in ModF & GalR)

PrymcrRNA2

13

DNA PCR KAC (480 nM; ModF & AltR)

PrymcrRNA1

14

DNA PCR KAC (200 fM; ModF & AltR)

PrymcrRNA1

15

Negative control (water in ModF & AltR)

PrymcrRNA1

16

DNA PCR KAC (480 nM; ModF & AltR)

PrymcrRNA2

17

DNA PCR KAC (200 fM; ModF & AltR)

PrymcrRNA2

18

Negative control (water in ModF & AltR)

PrymcrRNA2

19

DNA PCR KAC (480 nM; AltF & ModF)

PrymcrRNA1 

20

DNA PCR KAC (200 fM; AltF & ModF)

PrymcrRNA1 

21

Negative control (water in AltF & ModF)

PrymcrRNA1 

22

DNA PCR KAC (480 nM; AltF & ModF)

PrymcrRNA2 

23

DNA PCR KAC (200 fM; AltF & ModF)

PrymcrRNA2 

24

Negative control (water in AltF & ModF)

PrymcrRNA2 

25

DNA PCR KAC (480 nM; AltF & GalR)

PrymcrRNA1 

26

DNA PCR KAC (200 fM; AltF & GalR)

PrymcrRNA1

27

Negative control (water in AltF & GalR)

PrymcrRNA1 

28

DNA PCR KAC (480 nM; AltF & GalR)

PrymcrRNA

29

DNA PCR KAC (200 fM; AltF & GalR)

PrymcrRNA2

30

Negative control (water in AltF & GalR)

PrymcrRNA2 

31

DNA PCR KAC (480 nM; GalF & ModF)

PrymcrRNA1

32

DNA PCR KAC (200 fM; GalF & ModF)

PrymcrRNA1

33

Negative control (water in GalF & ModF)

PrymcrRNA1 

34

DNA PCR KAC (480 nM; GalF & ModF)

PrymcrRNA2

35

DNA PCR KAC (200 fM; GalF & ModF)

PrymcrRNA2

36

Negative control (water in GalF & ModF)

PrymcrRNA2 

37

DNA PCR KAC (200 fM; GalF & AltR)

PrymcrRNA1

38

Negative control (water in GalF & AltR)

PrymcrRNA1

39

DNA PCR KAC (200 fM; GalF & AltR)

PrymcrRNA2

40

Negative control (water in GalF & AltR)

PrymcrRNA2 

41

Positive control (SynDNA)

syncrRNA


Conclusions:

The best combination appears to be ModF + GalR + PrymcrRNA1 because it yielded high signals for both 480 nM and 200 fM target DNA concentrations. No other sample produced a signal for 200 fM initial target concentration.

19/07/2024


To ultimately select the most promising primer pair for optimization, an assay was conducted using the primers that produced the most satisfactory results in the previous test. 

  1. ModF & GalR (17.07)

  2. ModF & ModF (16&17.07)

  3. AltF & GalR (17.07)


  1. Additional RPA reactions were set up for target concentrations of 200 aM and 200 zM, as the high fluorescence readouts suggested that the limit of detection (LOD) might be in that range. A genomic sample L1 was also included to test whether these primer-PrymcrRNA pairs could detect genomic DNA without prior PCR. New negative control samples were prepared for use in the assay.

  2. The SHERLOCK assay was conducted on the following samples:


Table 23: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1

DNA PCR KAC (200 nM; ModF & GalR)

PrymcrRNA1

2

DNA PCR KAC (200 fM; ModF & GalR)

PrymcrRNA1

3

DNA PCR KAC (200 aM; ModF & GalR)

PrymcrRNA1

4

DNA PCR KAC (200 zM; ModF & GalR)

PrymcrRNA1

5

DNA PCR KAC (L1; ModF & GalR)

PrymcrRNA1

6

Negative control (water in ModF & GalR)

PrymcrRNA1

7

DNA PCR KAC (200 nM; ModF & ModF)

PrymcrRNA1

8

DNA PCR KAC (200 fM; ModF & ModF)

PrymcrRNA1

9

DNA PCR KAC (200 aM; ModF & ModF)

PrymcrRNA1

10

DNA PCR KAC (200 zM; ModF & ModF)

PrymcrRNA1

11

DNA PCR KAC (L1; ModF & ModF)

PrymcrRNA1

12

Negative control (water in ModF & ModF)

PrymcrRNA1

13

DNA PCR KAC (200 nM; AltF & GalR)

PrymcrRNA1 

14

DNA PCR KAC (200 fM; AltF & GalR)

PrymcrRNA1 

15

DNA PCR KAC (200 aM; AltF & GalR)

PrymcrRNA1 

16

DNA PCR KAC (200 zM; AltF & GalR)

PrymcrRNA1 

17

DNA PCR KAC (L1; AltF & GalR)

PrymcrRNA1

18

Negative control (water in AltF & GalR)

PrymcrRNA1 

19

Positive control (SynDNA)

syncrRNA



Conclusions:

Based on the results from that day and the previous assay (17/07/2024), the best primer combination is ModF & GalR with PrymcrRNA1. This combination provides the highest fluorescence intensity and effectively detects a 200 fM target DNA concentration, as demonstrated in the previous test. Unfortunately the L1 genomic sample fro algal culture was not detected in any RPA primers-PrymCrRNA1 combination. 

22.07. - 28.07.

23/07/2024


Based on the previous assays (from 17/07/24 and 19/07/24) the best primer pair – PrymcrRNA combination proved to be ModF & GalR + PrymcrRNA1. 


Optimization of the RPA primer concentration enables the assay to potentially become quantifiable, where the amount of input DNA correlates with fluorescence intensity. To achieve this, an assay was conducted to compare how varying primer concentrations impact the amplification rate and fluorescence intensity. The method used is based on the approach presented in the following article: Jonathan S. Gootenberg et al. [3]


  1. RPA reactions were set up, with different primer and input DNA concentrations, alongside a positive control with SynDNA. For template dilutions, a PCR product coming from NOW5.1 algal culture was used. Dilutions of 200 nM, 2nM, 20 pM and 200 fM were tested, alongside the following primer concentrations: 960 nM, 480 nM, 240 nM and 120 nM. 

  2. The SHERLOCK assay was conducted on the following samples:


Table 24: SHERLOCK reactions components


Template DNA used for RPA

The primer concentration used for RPA

crRNA

1

DNA PCR KAC (200 nM; ModF & GalR)

960 nM

PrymcrRNA1

2

DNA PCR KAC (2 nM; ModF & GalR)

960 nM

PrymcrRNA1

3

DNA PCR KAC (20 pM; ModF & GalR)

960 nM

PrymcrRNA1

4

DNA PCR KAC (200 fM; ModF & GalR)

960 nM

PrymcrRNA1

5

Negative control (water in ModF & GalR)

960 nM

PrymcrRNA1

6

DNA PCR KAC (200 nM; ModF & GalR)

480 nM

PrymcrRNA1

7

DNA PCR KAC (2 nM; ModF & GalR)

480 nM

PrymcrRNA1

8

DNA PCR KAC (20 pM; ModF & GalR)

480 nM

PrymcrRNA1

9

DNA PCR KAC (200 fM; ModF & GalR)

480 nM

PrymcrRNA1

10

Negative control (water in ModF & GalR)

480 nM

PrymcrRNA1

11

DNA PCR KAC (200 nM; ModF & GalR)

240 nM

PrymcrRNA1

12

DNA PCR KAC (2 nM; ModF & GalR)

240 nM

PrymcrRNA1

13

DNA PCR KAC (20 pM; ModF & GalR)

240 nM

PrymcrRNA1 

14

DNA PCR KAC (200 fM; ModF & GalR)

240 nM

PrymcrRNA1 

15

Negative control (water in ModF & GalR)

240 nM

PrymcrRNA1 

16

DNA PCR KAC (200 nM; ModF & GalR)

120 nM

PrymcrRNA1 

17

DNA PCR KAC (2 nM; ModF & GalR)

120 nM

PrymcrRNA1

18

DNA PCR KAC (20 pM; ModF & GalR)

120 nM

PrymcrRNA1 

19

DNA PCR KAC (200 fM; ModF & GalR)

120 nM

PrymcrRNA1 

20

Negative control (water in ModF & GalR)

120 nM

PrymcrRNA1 

21

Positive control (SynDNA)

-

syncrRNA


Conclusions:

Based on the bar graphs and the R² value calculated for the final fluorescence concentration (background subtracted), the optimal primer concentration appears to be 960 nM. This concentration provides the most proportional relationship between the DNA target sample concentration used for RPA and the final fluorescence intensity.

An additional test will be conducted to further validate this finding and to determine the range of DNA concentrations for which the relationship between log₂[DNA] and fluorescence intensity is linear.

The assay needed to be manually extended, which caused a bump on the graph, but this does not impact the final results.


25/07/2024


Based on the optimal primer concentration established in the previous assay, an additional assay was conducted to:

  1. Determine the final LOD for our test.

  2. Establish the range of DNA concentrations for which the relationship between log₂[target DNA] and fluorescence intensity is linear, allowing for quantification of target DNA concentration in the test sample.

  3. Test two genomic samples to verify if genomic DNA isolated from the cultures can be detected using the chosen primer-PrymcrRNA pair (following the failed attempt with the L1 culture on 19/07).

To verify if RPA combined with SHERLOCK can be used for quantitative sample testing, we designed tests on 23/07 and 25/07 to assess the repeatability of both reactions:

  • SHERLOCK Reaction: On 25/07, we conducted the SHERLOCK assay in two separate runs (test duplicates). Both runs used the same RPA mixes from 25/07, so any differences in the fluorescence signal would be due to the kinetics of the SHERLOCK reaction. This test aimed to determine if the average final fluorescence intensity signal corresponding to a particular target DNA concentration can be used to quantify target DNA in test samples, potentially eliminating the need for a standard curve in every test.

  • RPA: On 25/07, we used a separate RPA reaction (but on the same algal template, NOW5.1) compared to the test from 23/07. This was done to check if RPA reactions conducted under the same conditions produce a comparable amount of target DNA for subsequent SHERLOCK reactions.


Methods:

  1. RPA reactions were set up, with different template DNA concentrations: 200 nM, 20 nM, 2 nM, 200 pM, 40 pM, 20 pM, 10 pM, 5 pM, 2 pM, 1 pM, 200 fM, 20 fM and 2 fM, as well as genomic DNA isolates, coming from liquid cultures L1 (80.6 ng/μl) and Szczecin (7.3 ng/μl). For template dilutions, a PCR product coming from NOW5.1 algal culture was used.

  2. The SHERLOCK assay was conducted on the following samples in 2 separate runs (duplicate of the test):


Table 25: SHERLOCK reactions components


Template DNA used for RPA

crRNA

1

DNA PCR KAC (200 nM; ModF & GalR)

PrymcrRNA1

2

DNA PCR KAC (20 nM; ModF & GalR)

PrymcrRNA1

3

DNA PCR KAC (2 nM; ModF & GalR)

PrymcrRNA1

4

DNA PCR KAC (200 pM; ModF & GalR)

PrymcrRNA1

5

DNA PCR KAC (40 pM; ModF & GalR)

PrymcrRNA1

6

DNA PCR KAC (20 pM; ModF & GalR)

PrymcrRNA1

7

DNA PCR KAC (10 pM; ModF & GalR)

PrymcrRNA1

8

DNA PCR KAC (5 pM; ModF & GalR)

PrymcrRNA1

9

DNA PCR KAC (2 pM; ModF & GalR)

PrymcrRNA1

10

DNA PCR KAC (1 pM; ModF & GalR)

PrymcrRNA1

11

DNA PCR KAC (200 fM; ModF & GalR)

PrymcrRNA1

12

DNA PCR KAC (20 fM; ModF & GalR)

PrymcrRNA1

13

DNA PCR KAC (2 fM; ModF & GalR)

PrymcrRNA1 

14

DNA PCR KAC (L1; ModF & GalR)

PrymcrRNA1 

15

DNA PCR KAC (Szczecin; ModF & GalR)

PrymcrRNA1 

16

Negative control (water in ModF & GalR)

PrymcrRNA1 

17

Positive control (SynDNA)

syncrRNA



Conclusions:

  1. Determining the Range of DNA Concentrations: Despite optimizing the RPA primer concentration, it is not possible to define a range of target DNA concentrations that are proportional to the final fluorescence intensity.

  2. SHERLOCK Reaction Repeatability: The SHERLOCK reaction proved to be unrepeatable. Different fluorescence intensities were observed for samples from the same RPA, and varying limits of detection (LOD) were determined for test duplicates: 1 pM for the first test and 200 fM for the second. This inconsistency undermines the ability to compare fluorescence intensities between tests from 23/07 and 25/07.

Given these observations, the test does not appear suitable for quantitative measurements. A range of concentrations proportional to fluorescence intensity could be established (point 1), then creating a standard curve for each test would provide reference points for quantifying DNA concentration.

However, we can conclude that the limit of detection (LOD) of our test is 1 pM. This concentration corresponds to 5 × 10¹⁰ Prymnesium parvum cells per liter of water (see calculations below). Additionally, we successfully detected Prymnesium parvum in the genomic sample isolated from the “Szczecin” culture. These findings suggest that SHERLOCK can be used for screening the presence of Prymnesium parvum in water with a detection limit of 1 pM.

Based on the analysis conducted on 06.08 in GenomeLab by Filip, we have determined that Prymnesium parvum's  ITS1-5.8S-ITS2 sequence is found exclusively on chromosome 20 in two haplotypes: one with 8 repetitions of the and another with 4 repetitions of the sequence. Statistically, 25% of the Prymnesium parvum population has 8 copies of the ITS1-5.8S-ITS2 sequence (haplotypes 4 + 4), 50% has 12 copies (8 + 4), and 25% has 16 copies (8 + 8).

Here we can make a simulation for further calculations:

Assuming there are 4 Prymnesium parvum cells in 1 L of water there should be 48 copies of the ITS1-5.8S-ITS2 sequence (1 cell with 8 copies, 2 with 12 and 1 with 16).


To convert this to moles:

48 ITS1-5.8S-ITS2 copies —- x mole

6.02 × 1023 —-- 1 mole

X = 7.97 × 10-23 mole

7.97 × 10-23 mole of ITS1-5.8S-ITS2 —- 4 Prymnesium parvum in 1 L of water


To detect 1 pM of ITS1-5.8S-ITS2:

10-12 —--- y mole

Y = 5 × 1010 = 50 billion of Prymnesium parvum cells in 1 L of water

These calculations indicate that our SHERLOCK assay, with an LOD of 1 pM, is capable of detecting Prymnesium parvum concentrations as low as 5 × 10¹⁰ cells per liter, making it a useful tool for screening water for the presence of this algae. To make the method more sensitive centrifugation of water samples (there are some that can be used in the field) or using syringes with filter can be applied to make water samples more condensed.

[1] M. J. Kellner, J. G. Koob, J. S. Gootenberg, O. O. Abudayyeh, and F. Zhang, “SHERLOCK: nucleic acid detection with CRISPR nucleases.,” Nat Protoc, vol. 14, no. 10, pp. 2986–3012, Oct. 2019, doi: 10.1038/s41596-019-0210-2. [2] Galluzzi, L., Bertozzini, E., Penna, A., Perini, F., Pigalarga, A., Graneli, E. and Magnani, M. (2008), Detection and quantification of Prymnesium parvum (Haptophyceae) by real-time PCR. Letters in Applied Microbiology, 46: 261-266.

[2] Galluzzi, L., Bertozzini, E., Penna, A., Perini, F., Pigalarga, A., Graneli, E. and Magnani, M. (2008), Detection and quantification of Prymnesium parvum (Haptophyceae) by real-time PCR. Letters in Applied Microbiology, 46: 261-266.

[3] Jonathan S. Gootenberg et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science360,439-444(2018).DOI:10.1126/science.aaq0179


SynLOCK Lab


10.06. - 16.06

Table 1. A list of all abbreviations and their meanings used throughout this notebook.

G7 plasmid

PSB1C5C plasmid backbone carrying the BBa_K2910000 part

System Vector Cassette (SVC)

The SynLOCK Cassette without the reporter device in the PSB1C5C plasmid backbone

System Vector Reporter (SVR)

The SynLOCK Cassette in the PSB1C5C plasmid backbone

Ultimate System Vector (USV)

 The SynLOCK Cassette in the pSB1C3 plasmid backbone

G5

BBa_J23110

K5

BBa_J23116

O5

BBa_J428032

G1

BBa_K1033906 (tsPurple)

G3

BBa_J97003 (TannenRFP)

K1

BBa_K1033919 (gfasPurple)

C1

BBa_J428092

A1

BBa_J428091

A11

PSB1C3 plasmid backbone  with the BBa_I20270 part

G8

pJUMP29-1A(sfGFP) plasmid 

BBa_J428341 part

A10

pJUMP28-1A(sfGFP) plasmid with 

Bba_J428353 part

  1. Two Petri dishes with chloramphenicol (170 µg/ml [1]) were warmed up in the incubator at 37°C.

  2. 10 µl of H₂O was added to the G7 well in Kit Plate 1 of the iGEM Distribution Kit 2024. The mixture was pipetted and left to incubate for 5 minutes. The liquid was observed turning red, as expected.

  3. The transformation was conducted using Top10 chemically competent E. coli cells (ThermoFisher) according to “Transformation Protocol I”. 

Plating modifications: 75 µl of the culture was spread on one plate. The remaining culture was centrifuged for 1 minute at maximum speed. 300 µl of the supernatant was discarded, the pellet was resuspended in the remaining liquid, and it was spread on the second plate. 

[1] QIAGEN. Growth of bacterial cultures. QIAGEN. https://www.qiagen.com/us/knowledge-and-support/knowledge-hub/technology-and-research/plasmid-resource-center/growth-of-bacterial-cultures. Accessed June 6, 2024.

Bacteria only grew on these plates on which concentrated samples were seeded.

Figure 1: Transformation results with the G7 plasmid.

A single colony was taken from the plate with a pipette tip and placed in a flask with 12 ml LB and 60 μl of chloramphenicol (final concentration: 170 mg/μl) and left to incubate overnight in 37°C.

The G7 plasmid was isolated according to the “Plasmid Isolation Protocol”.

 

Obtained concentration: 353 ng/μl.

17.06. - 23.06

Note: The goal of this digestion is to remove the unwanted coding sequence from the BBa_K2910000 part, leaving us with the PSB1C5C plasmid backbone. We'll then use this backbone to host the components of our SynLOCK system.


1. The G7 plasmid in concentration 353 ng/μl was digested according to the table below:


Table 2. Digestion reaction composition of the G7 plasmid. 

Reaction Component

Volume

plasmid

20.5 μl 

CutSmart x10 buffer

2.5 μl 

BsaI (10U/μlNEB)

2 μl 


2. The whole reaction mix was vortexed and short-spinned.

3. The samples were left overnight in an incubator at 37°C

  1. A 1% agarose gel was prepared, and the reaction products were visualised:

 

Figure 2.: Results of the G7 plasmid digestion using BsaI enzyme. 


Conclusion: Correct bands have been obtained at 2045 bp and at 892 bp. 


2. The G7 upper band was then cut out using a scalpel and transferred to an Eppendorf tube. The isolation of the DNA from the gel fragment was conducted according to the “DNA gel Extraction Protocol”. 


The G7 upper band weighed 97 mg. The measured concentration of isolated DNA was 28.2  ng/μl.

24.06. - 30.06

Table 3: Sequences of the oligos ordered to form the spine.

System_oligoF

AATGGAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACCGAAGAGCGAGCTCTTCCATGTCTTC

System_oligoR

AAGCGAAGACATGGAAGAGCTCGCTCTTCGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC


  1. The oligos were suspended in water to obtain 100 μM concentrations as in the manufacturer's manual. 

  2. The Oligos were then annealed according to the “Oligo Annealing and Ligation Protocol”.


Note: The PSB1C5C plasmid backbone digested with BsaI was used for the ligation reaction. The amount of plasmid DNA should be 50 ng so 2 μl of 28.2 ng/μl concentration of the backbone was used.


  1. Top 10 Competent E. coli (ThermoFisher) were transformed with the ligation reaction according to “Transformation Protocol I”.  


Note: We plated 100 μl of the outgrown culture, then spinned it down, removed most of the supernatant and plated the remaining 70 μl of the resuspended pellet on a separate plate.

Figure 8: Transformation results of ligating the SynLOCK Cassette spine into the PSB1C5C plasmid backbone, and the negative control. The plasmid obtained from this ligation was called System Vector Cassette (SVC). The black circles indicate colonies picked for overnight culture preparation. 

Three single colonies from the transformation plates from the previous day were used to prepare three liquid cultures which were shaken at 37°C overnight. 

  1. Six samples of the SVC plasmids were isolated according to the “Plasmid Isolation Protocol” from the overnight cultures prepared the previous day.

Table 4: Nanodrop measurement results:

plasmid

A260/280

A260/230

SVC1

1.86

2.04

SVC2

1.73

0.96

SVC3

1.86

2.34

SVC4

1.88

2.35

SVC5

1.82

1.56

SVC6

1.88

2.30


Note: DNA generally accepted as "pure" has a A260/280 ratio about 1.8 and A260/230 about 2.0-2.2.


Conclusion: Analysis of the spectrophotometric data reveals that samples 2 and 5 demonstrate the lowest purity among the tested samples. The observed absorbance values, which are lower than anticipated, suggest the presence of contaminants with absorption maxima at 230 nm. The quantified concentrations are high.


  1. Plasmids 2-6 were digested overnight (37oC) to ensure that the first stage of cloning was carried out successfully.

 

Table 5: Components of the digestion reaction mixture:

Plasmid sample

SVC1

SVC2

SVC3

SVC4

SVC5

SVC6

Concentration [ng/μl]

112

365

183

366

235

205

Plasmid [ul]

-

11

22

11

17

20

CutSmart buffer x10

-

2.5

2.5

2.5

2.5

2.5

SapI

-

2

2

2

2

2

water

-

9.5

-

9.5

3.5

0.5

Figure 9: Results of the digestion of the SVC plasmids with SapI. The non-digested versions were visualised for comparison. 


Conclusions: A single band on the gel indicates that the plasmids were successfully linearized. The band positioned slightly above 2000 bp matches the expected size of 2136 bp.

  1. The bands of digested SVC3 and SVC4 were isolated from the gel following the “DNA gel Extraction Protocol”.

  2. The DNA was eluted in 10 µl of water.

The final concentrations were measured using a NanoDrop. The concentration for SVC3 was 20.5 ng/µl, and for SVC4, it was 24 ng/µl. 

1.07. - 7.07

  1. To confirm that the SynLOCK Cassette spine was cloned inside the plasmids, a restriction analysis was planned. Two different analyses were conducted: 

    1.  SacI digestion:

    2. If the cassette is correctly ligated, the expected DNA fragments should be 1152 bp and 984 bp.

    3. If the cassette is not present, the linearized plasmid size should be 2136 bp.

    4. BsaI digestion:

    5. If the cassette is present, the expected DNA fragments should be 2045 bp and 111 bp.

    6. If the cassette is not present, the expected DNA fragments should be 2045 bp and 892 bp.

    7. To digest the plasmids, master mixes were prepared (6 µl per sample): 

    Table 6: The master mix components for the restriction analysis:

    Reaction Component

    Volume

    Enzyme volume (SacI/BsaI)

    1 μl 

    Water

    24 μl 

    Cut Smart buffer 10x

    5 μl 

    Total volume

    30 μl 

    Then 4 µl of SVC 3, 4, and 5 were added. An additional control with the complete G7 plasmid was prepared in the same way.


    Figure 10: Results of the restriction analysis of SVC plasmids using gel electrophoresis. (a) The corresponding samples and enzymes are described, with G7 serving as the control. (b) A longer exposure time revealed the smallest DNA fragment (111 bp) produced by BsaI digestion.

    Conclusions: The results confirmed that all three plasmids carry the SynLOCK Cassette spine. 


To ensure that the DNA sequences were consistent with the expected ones and free from mutations, we decided to send the plasmids for sequencing.


Figure 11: Sequencing data confirming the successful integration of the Cassette spine into the SVC3, SVC4, and SVC5 plasmids, with no detected mutations.

Note: We concluded that the 170 μg/ml concentration of chloramphenicol was too high and hindered the growth of our bacteria. 

 Table 11: Revised antibiotic concentrations used for further experimentation.

Antibiotic

Abbreviation

Concentration

Chloramphenicol

Cm

34 μg/ml

Kanamycin

Kan

50 μg/ml

Ampicillin

Amp

100 μg/ml

Note: After consulting with experts, we decided to add a Reporter Transcription Unit (TU) to our system to simplify the screening of correct colonies. Additionally, we chose to change the plasmid backbone to enable the transfer of our system into other backbones using BioBrick assembly.


Table 12: Parts from the distribution kit (Kit Plate 1) that were used to transform E.coli.

Well

Part Name

Part Type

Plasmid Resistance

Purpose in the system

G5

BBa_J23110

Promoter

Cm

Reporter TU component

K5

BBa_J23116

Promoter

Cm

Reporter TU component

O5

BBa_J428032

RBS

Cm

Reporter TU component

G1

BBa_K1033906 (tsPurple)

CDS

Cm

Reporter TU component

G3

BBa_J97003 (TannenRFP)

CDS

Cm

Reporter TU component

K1

BBa_K1033919 (gfasPurple)

CDS

Cm

Reporter TU component

C1

BBa_J428092

Terminator

Cm

Reporter TU component

A1

BBa_J428091

Terminator

Cm

Reporter TU component

A11

BBa_I20270

Device

Cm

BioBrick compatible vector

G8

BBa_J428341

Device

Kan

Reporter TU Acceptor

A10

Bba_J428353

Device

Kan

Reporter TU Acceptor


 All transformations were performed according to the “Transformation Protocol I”.

  1. The transformation plates were taken out of the incubator, looking like this:

 

Figure 12: Results of the transformation with DNA from different wells from the iGEM 2024 distribution kit. The respective wells are indicated in the image.


  1. The plates containing fluorescent reporter devices were visualised under UV light:

Figure 13: Visualisation of the colonies carrying plasmids with fluorescent modules under the UV light.


Conclusion: The transformation was successful. The reduced concentration of chloramphenicol (Cm) contributed to the enhanced transformation efficiency.

8.07. - 14.07

  1. Overnight cultures from one colony picked from every plate (C1, K1, G3, K5, G5, G1, O5, A10, G8, A1, A10) were prepared in 12 ml LB with corresponding antibiotics. Additionally, the picked colonies were stored for later on agar plates.

  2. Four transformations were performed with the DNA  taken from wells H1, M1, O1 and O13, according to the “Transformation Protocol II”.

  • All overnight liquid cultures grew correctly, except for A10.

  • All transformations from the previous day were successful.

 


Figure 14: Results of the transformation with DNA from different wells from the iGEM 2024 distribution kit. The respective wells are indicated in the image.


It was possible to successfully grow the clones picked yesterday on separate agar plates for storage:

 

Figure 16: Plates storing the clones picked for further experiments.

Overnight liquid cultures from colonies picked from all four plates were prepared. Additionally, picked clones were stored on a separate agar plate. For O13 a red colony was picked:


Figure 15: An agar plate showing the transformation results with DNA from the O13 well. The arrow points to the red colony that was picked as the correct one, since it carried the mRFP1.


Plasmids from overnight cultures of C1, K1, G3, K5, G5, G1, O5, G8, A1 were isolated according to “Plasmid Isolation Protocol II”. 

 

Table 13: The concentrations and purity of the obtained plasmids. 

Plasmid

Concentration [ ng/μl ]

A260/A280

A260/A230

G1

146.4

1.88

2.25

G3

259.0

1.88

2.23

G8

59.2

1.82

1.73

K1

185.9

1.83

1.83

K5

235.2

1.75

1.22

G5

204.5

1.80

1.49

C1

163.5

1.87

2.13

O5

172.0

1.87

2.21

A11

222.6

1.88

2.28

In order to obtain the reporter transcription unit for our system we set up a Golden Gate reaction according to the “Golden Gate Assembly of Four Parts: Protocol”.


Notes to the protocol mentioned above, as the reaction was performed:


Three different transcription units (TUs) were constructed to identify the one that exhibits the fastest and most intense colour.


Table 14: Components of the constructed transcription units. 

TU index

Promoter

RBS

CDS

Terminator

Destination Vector

TU1

G5

O5

G1

C1

A11

TU1

G5

O5

K1

C1

A11

TU3

G5

O5

G3

C1

A11


The transformation step was performed according to the “Transformation Protocol II”. 

None of the colonies showed any color. On top of that, the negative control had a lot of colonies. Nearly all the colonies glowed green under UV light.

 

Figure 16: Results of the transformation with the Golden Gate Reaction I mixtures. The respective transcription units are indicated in the image.


Realisation and Conclusion: There was an error in the reaction involving the choice of the destination plasmid. The plasmid used was A11, which isn't compatible with Type IIS assembly. Additionally, this plasmid has Cm resistance, allowing bacteria carrying it to grow on the negative control plate. In the negative control, bacteria with uncut plasmids carrying different parts could also grow because these part plasmids also had Cm resistance. The Golden Gate reaction failed due to the incompatible sticky ends between the A11 destination vector and the parts. The correct plasmid backbone should be G8.

Plasmids from overnight cultures of O13, H1, O1 and M1 were isolated according to the “Plasmid Isolation Protocol II” using and eluted in 30 μl of water. 


Table 15: The concentrations and purity of the obtained plasmids.

Plasmid

Concentration [ ng/μl ]

A260/A280

A260/A230

O12

256.1

1.82

1.75

H1

216.8

1.7

0.95

O1

184.2

1.77

1.23

M1

149.2

1.86

1.87

The Golden Gate reaction was repeated, according to the “Golden Gate Assembly of Four Parts: Protocol”. Four different Transcription Units (TUs) were constructed. 


Table 16:  Components of the constructed transcription units.

TU index

Promoter

RBS

CDS

Terminator

Destination Vector

TU 4

K5

H1

G1

C1

G8

TU 5

G5

O5

G1

C1

G8

TU 6

G5

O5

G3

C1

G8

TU 7

G5

O5

O1

C1

G8


The transformation step was performed according to the “Transformation Protocol II”. 

  • The negative control plate had a few colonies with green fluorescence, which was anticipated. The G8 destination vector contained a GFP expression module, so some of the vectors that remained closed or were not digested could have been uptaken by bacteria and consequently displayed green fluorescence.


  • None of the colonies on the other plates were fluorescent. TU5 colonies were slightly purple, making them barely visible against the purple background, while TU7 colonies were very lightly blue. Other TU colonies appeared completely white.

Figure 17: Results of the transformation with the Golden Gate Reaction II mixtures after 17h incubation at 37°C. The respective transcription units are indicated in the image.


Hypothesis: The G8 plasmid is a medium copy plasmid, which is why the color is developing slower. 

Information: The available data indicated that a 24-48 hour incubation may be needed for the color to be fully developed [2].


Conclusions: 

  • A higher copy plasmid would improve color formation. 

  • TU5 was the unit that developed colour the fastest during incubation and produced the highest intensity among all the units we tested. TU7 also showed potential.

  1. Overnight cultures of TU5 and TU7 were prepared in LB with Cm. 

  2. The plates were left to incubate overnight at room temperature, as recommended [1]. 

[1] Liljeruhm J, Funk SK, Tietscher S, et al. Engineering a palette of eukaryotic chromoproteins for bacterial synthetic biology. J Biol Eng. 2018;12:8. Published 2018 May 10. doi:10.1186/s13036-018-0100-0.

  • Colonies carrying TU5 showed a visible light-purple color.

  • Colonies carrying TU7 were greyish-blue.

  • Colonies carrying TU6 showed a barely visible pink color.

  • Colonies carrying TU4 remained white.


Figure 18: Plates with colonies carrying different transcription units (indicated in the picture) 30h after plating. 


  1. All four overnight cultures were centrifuged. 

Figure 19: Pellets formed after centrifuging the overnight cultures carrying various transcription units (indicated in the picture). 

1. Plasmid isolation from the overnight cultures of TU5 and TU7 (selected due to their strong colour visibility) was carried out according to “Plasmid Isolation Protocol I”. 

The overnight cultures for each transcription unit were split into two, and plasmids were isolated using separate columns, resulting in four samples in total. Each plasmid was labelled according to the transcription unit it contained. 


Table 17: TU5 and TU7 plasmid concentrations after isolation.

Plasmid

Concentration [ ng/μl ]

TU5

254 and 89.5

TU7

201.2 and 154.2


2. After centrifugation, the remaining pellets from the TU5 and TU7 clones were plated on separate agar plates containing kanamycin for storage. These plates were then left on the bench over the weekend.

15.07. - 21.07

Figure 20: The saved clones carrying expression modules TU7 and TU5 grew over the weekend, successfully developing colour.


Conclusion: After last week's experiments, we concluded that TU5 is the best choice as the reporter for our system. It was the fastest to develop a visible color, even in a medium-copy plasmid, and it also matches our team's color theme beautifully!

Purpose:  Our goal was to insert the reporter expression module into the cassette spine to create the complete SynLOCK Cassette, while preserving the SapI recognition sites. These sites would later enable the reporter to be excised and replaced with the crRNA spacer. Additionally, the final product needed to have compatible sticky ends after SapI digestion, allowing it to be ligated into the SVC plasmid. 

To do this, we designed and ordered two primers, which introduced SapI recognition sites into the TU5 fragment.


Table 18: Sequences of the primers introducing the SapI restriction sites.

Primer name

Primer Sequence

SapF

AAACCGAAGAGCCGTCTCTGGAGTTTACGGCTAGC

SapR

CGCTACTAGTAAAGCGAAGACATGGAAGAGCCG


PCR Setup:

  1. A dilution of the matrix DNA for the PCR was prepared by mixing 2 µl of isolated TU5 plasmid (254 ng/µl) with 38 µl H₂O.

Table 19: PCR Reaction Master Mix components (for a single reaction):

Component

Volume (µl)

Q5 mix

12.5

SapF primer (10 µM)

1.25

SapR primer (10 µM)

1.25

H₂O

9.0

Total

24


  1. After pipetting the master mix into PCR tubes, 1 µl of the TU5 plasmid dilution was added to all samples except for the negative control (substituted with H₂O).

Thermocycler Program:

  1. Initial denaturation: 98°C for 30s

  2. Denaturation: 98°C for 10s

  3. Annealing: 70°C (for negative control and one sample), 65°C (for another sample) for 15s

  4. Extension: 72°C for 25s

  5. Final extension: 72°C for 2min

  6. Hold: 4°C indefinitely

Steps 2, 3, and 4 were looped 30 times.

Note: The annealing temperature was calculated using the NEB Tm  Calculator tool and was estimated at 72°C. 


Gel electrophoresis of the PCR product

Figure 21: Gel electrophoresis of the TU5 module amplified with SapF and SapR primers.


Conclusion: An anticipated 939 bp band was obtained. As expected, the 72°C annealing temperature yielded higher reaction efficiency, as indicated by the brighter band on the gel. However, the product was also successfully created at 65°C.

The PCR products of both reactions were pooled into one tube. 

20 µl of the pooled PCR product was digested with 0.5 μl DpnI to ensure no matrix DNA remained in the sample. The reaction was placed at 37°C for 1h. 

Note: This step could have been avoided because, even if the matrix plasmid prevailed in the sample, it carried Kan resistance, while the vector intended for ligating the amplified PCR product later on carries Cm resistance. Therefore, colonies that took up the matrix plasmid would not grow.

  1. The clean-up was performed according to the “Post Enzymatic Reaction Clean-Up Protocol”. 

  2. The elution step was completed by adding 20μl of water. 

The concentration of the clean-up PCR product was 45.2  ng/μl.

Purpose: In order to later ligate the TU5 module into the SynLOCK Cassette Spine in the SVC plasmid, it was necessary to create compatible sticky ends flanking our PCR product. 


Table 20: Components used for enzymatic digestion using SapI.

Reaction Component

Volume (µl)

Cleaned up TU5 PCR product

20

SapI

1

Cut Smart Buffer

2


The reaction was incubated at 37°C overnight.

  1. TU5 PCR product was cleaned up after being digested with SapI according to the  The clean-up was performed according to the “Post Enzymatic Reaction Clean-Up Protocol”. 

  2. The obtained concentration was 81.6  ng/μl 

  1. The reaction was carried out following the “DNA Ligation Protocol For Cohesive Ends” protocol.

Notes: 67 ng of the insert were used in the reaction, based on calculations from the provided protocol equation. As for the vector, the SVC3 sample extracted from gel after digestion with SapI was used. 

Figure 22: Results of obtaining SVR plasmid-carrying colonies.


Conclusions: All colonies were visibly violet. The used plasmid backbone (PSB1C5C) is a high copy plasmid, therefore intense colour was visible in the morning after just one night of incubation. 

Overnight cultures were prepared from two colonies picked from the SVR plate (labelled SVR1 and SVR2). Additionally, those clones were stored on a separate plate. 

  1. All crRNA spacer oligonucleotide samples were diluted in water according to the manufacturer’s manual.

 

Table 21: Sequences of all oligos used to form crRNA spacer templates

Oligo name

Sequence

PrymCrRNA1_coding_oligo

CATAGGCGACGCTCGAGCCTTGATCTGGCGC

PrymCrRNA1_matrix_oligo

AACGCGCCAGATCAAGGCTCGAGCGTCGCCT

PrymCrRNA2_coding_oligo

CATGAGGATCCTCCCGTGCAACGCTGCCCTC

PrymCrRNA2_matrix_oligo

AACGAGGGCAGCGTTGCACGGGAGGATCCTC

SynCrRNA_coding_oligo

AACCGCCAAGCTTGCATGCCTGCAGGTCGAG

SynCrRNA_matrix_oligo

CATCTCGACCTGCAGGCATGCAAGCTTGGCG


  1. The annealing was carried out according to the “Oligo Annealing and Ligation Protocol”. 


PrymCrRNA1_coding_oligo was annealed with PrymCrRNA1_matrix_oligo, PrymCrRNA2_coding_oligo with PrymCrRNA2_matrix_oligo and SyncrRNA_coding_oligo with SynCrRNA_matrix_oligo. 


Note: After completing step 2 of the protocol, the samples were stored at -20°C. The plan was to finish the procedure the following week, once the isolated SVR plasmid backbone with the reporter sequence removed was obtained. This backbone would then be ready to accept the spacers generated from this annealing reaction.

Figure 23: SVR1 and SVR2 clones grown overnight. 


Figure 24: Overnight cultures of SVR1 and SVR2 colonies. 


Conclusions: The chromoprotein production in SVR vectors is very high — the colour is easily observed after an overnight incubation on a plate and in a liquid culture as well, which was not the case in previous cultures. This is the first time we observed colour in a liquid culture without having to centrifuge it. The high-copy plasmid backbone we chose for this assembly helped us maximise colour formation, which was the key goal for our system.

  1. The plasmid preparation was carried out from both liquid cultures according to “Plasmid Isolation Protocol I”. For each sample, 4 ml of the liquid culture were used, and for each culture (SVR1 and SVR2) two plasmid preps were carried out, yielding four samples. 


Figure 25: SVR pellets formed after centrifugation during the plasmid isolation protocol. 


  1. Obtained concentrations were as follows: 


Table 22. SVR plasmid concentrations

Plasmid

Concentration [ng/μl]

SVR1 sample 1

340

SVR1 sample 2

346.3

SVR sample 1

378.9

SVR sample 2

338.7


Purpose: To make sure the SapI recognition sites were preserved within the SVR plasmid sequence, a digestion reaction using this enzyme was prepared. 


  1.  Digestion reactions were prepared for the SVR1 sample 1 and SVR2 sample 2. 


Table 23: SapI digestion of SVR plasmids components. 

Component

Volume

SVR sample

1 μl 

SapI 

0.5 μl 

Cut Smart Buffer 

0.5 μl 

H₂O

5 μl 


  1. The digestion was left to incubate at 37°C for 30 minutes. 

  2. The digestion results were visualised by gel electrophoresis. 


Figure 26: Gel electrophoresis results of the digested SVR plasmid samples.


Conclusion: Anticipated bands were obtained at 934 and 2115 bp for both SVR1 and SVR2 samples. A small fraction of the plasmid remained undigested, marked by the band on 3049 bp. Both SVR plasmids after isolation were correct and could be used for further experiments. 

Purpose: After consulting with Vinoo Selvarajah, the Vice President of Technology at iGEM, we decided to change the plasmid backbone for our system. This will make it compatible with the RCF10 standard and allow Cassette transfer between different backbones using the BioBrick assembly. For that, it is necessary to introduce EcoRI and SpeI sites to flank our Cassette, which was the aim of this PCR reaction. 

To do this, we designed and ordered two primers, which introduced recognition sites to flank the Cassette fragment.


Table 24: Sequences of EcoF and SpeR primers

Primer name

Primer Sequence

EcoF

TCTGGAATTCGCGGCCGCTTCTAGAGAATGGAAATTAATACGACTCACTAT

SpeR

CGCTACTAGTAAAGCGAAGACATGGAAGAGCCG


PCR set up:

For this PCR the 340 ng/μl sample of SVR1 was chosen. It was diluted by taking 2 μl of the sample and adding 48 μl of water. 

Two reactions were prepared in final volume of 25 µl


Table 25: PCR Reaction Master Mix components (for a single reaction):

Component

Volume [µl]

Q5 mix

12.5

EcoF  primer (10 µM)

1.25

SpeR primer (10 µM)

1.25

H₂O

9.0

Total

24


After pipetting the master mix into PCR tubes, 1 µl of the SVR plasmid dilution was added to all samples except for the negative control (substituted with H₂O).

Thermocycler Program:

  1. Initial denaturation: 98°C for 30s

  2. Denaturation: 98°C for 10s

  3. Annealing: 70°C (for negative control and one sample), 65°C (for another sample) for 15s

  4. Extension: 72°C for 25s

  5. Final extension: 72°C for 2min

  6. Hold: 4°C indefinitely

Steps 2, 3, and 4 were looped 30 times.

Note: The annealing temperature was calculated using the NEB Tm Calculator tool and was estimated at 72°C. The negative control was performed at 70°C.


Figure 27: Gel electrophoresis of the SynLOCK Cassette amplified with EcoF and SpeR primers.

Conclusions: Expected bands of 1045 bp were obtained. 

The PCR products of both reactions were pooled into one tube and labelled “Cassette_Reporter” 

48 µL of the pooled PCR product was digested with 1 µL DpnI to remove any residual template DNA. The reaction was incubated at 37°C for 1 hour. The sample was then cleaned up following the “Post Enzymatic Reaction Clean-Up” Protocol.

The obtained concentration was 23 ng/μl. 

Three overnight digestions were set up according to the tables below:


Table 26: SapI digestion of the SVR plasmid setup. 

Component

Volume

SVR plasmid [340 ng/μl]

30 μl 

SapI 

1 μl 

Cut Smart Buffer 

5 μl 

H₂O

14 μl 


Table 27: EcoRI and SpeI digestion of the A11 plasmid setup. 

Component

Volume

A11 plasmid [222.6 ng/μl]

20 μl 

EcoRI-HF

1 μl 

SpeI-HF

1 μl 

Cut Smart Buffer 

2.5 μl 

H₂O

0.5 μl 


Table 28: EcoRI and SpeI digestion of the Cassette_Reporter setup. 

Component

Volume

Casette_Reporter [23 ng/μl]

15 μl 

EcoRI-HF

1 μl 

SpeI-HF

1 μl 

Cut Smart Buffer 

2 μl 

H₂O

2 μl 

Figure 28: Gel electrophoresis of the 5 µl samples of the plasmids digested overnight.


Table 29: Electrophoresis expectations.

Sample

Cutting Enzyme

Expected Bands

A11

EcoRI & SpeI

2049 bp, 942 bp

SVR

SapI

2115 bp, 934 bp


Conclusions: The plasmids were digested properly, making them suitable for further experimentation. While a small amount of undigested SVR plasmid remained in the sample, the majority was successfully digested.

Purpose: At this stage, we needed to insert the crRNA spacers into the SVR vector. To streamline and shorten the workflow, we decided to compare two DNA purification techniques: post-enzymatic reaction cleanup and the gel extraction method. Our reasoning was that post-enzymatic cleanup should be sufficient. After ligating the crRNA spacers into the SVR vector, the purple protein transcription unit would be removed, resulting in white colonies. This would allow us to easily identify and select the correct colonies, without needing to perform gel electrophoresis and gel extraction procedures.


  1. The SVR plasmid sample digested with SapI was divided into two: 20 µl were used for gel electrophoresis (the 2115 bp band was placed in the freezer over the weekend), and 20 µl were purified using the “Post Enzymatic Reaction Clean-Up” Protocol. 

  2. The Cassette_Reporter sample cut with EcoRI and SpeI was also purified using the “Post Enzymatic Reaction Clean-Up” Protocol, with elution performed using 15 µl of Tris pH=8. 

  3. The resulting concentrations after cleanup were:

  • SVR cut with SapI: 343.4 ng/µl


Cassette_Reporter cut with EcoRI and SpeI: 15.4 ng/µl

22.07. - 28.07

Purpose: Inserting the crRNA spacers into the Cassette to create plasmids ready for linearization and in vitro transcription.


Table 30: Ligation reaction setup using the SVR plasmid post-enzymatic reaction cleanup. 

Component

Volume [µl]

SVR cut with SapI post-enzymatic cleanup sample [343.4 ng/µl]

1.46

T4 buffer

1

1:200 dilution of crRNA spacer duplex

1

H₂O

5.54

T4 ligase

1


Table 31: Ligation reaction setup using the SVR plasmid post-DNA gel extraction. 

Component

Volume [µl]

SVR cut with SapI post-DNA gel extraction sample [37.4 ng/µl]

1.3

T4 buffer

1

1:200 dilution of crRNA spacer duplex

1

H₂O

5.7

T4 ligase

1


For the reactions described above, the duplexes used were PrymCrRNA1, PrymCrRNA2, and SynCrRNA. For each reaction setup, a negative control was prepared by using water instead of the oligo duplex. 

The samples were left at room temperature for 15 minutes. Afterwards, all of the volume was used for transformation according to the “Transformation Protocol II”. In the final step, ⅕ of the cells volume was used for plating. 

Figure 29: Transformation results following the ligation of the crRNA spacers into the SVR plasmid backbone, which was digested with SapI and purified using post-enzymatic reaction cleanup. Row a): PrymCrRNA1. Row b): PrymCrRNA2. Row c): SynCrRNA. The plates were visualised against both white and purple backgrounds to clearly display the colour differences.


Figure 30: Control plate for the transformation using the SVR plasmid backbone, which was digested with SapI and purified using post-enzymatic reaction cleanup. 


Figure 31: Transformation results following the ligation of crRNA spacers into the SVR plasmid backbone digested with SapI and obtained through gel extraction.  a): PrymCrRNA1. b): PrymCrRNA2. c): SynCrRNA. d) negative control 


Conclusions: The negative controls for both samples were as expected. Because no gel extraction was done with the post-enzymatic reaction cleanup, some plasmids retained the cut-out reporter, resulting in the anticipated purple colour. In contrast, the gel extraction procedure removed any reporter that could potentially relegate into the vector, leading to no colonies growing on the plates.

The results show that the ligation efficiency and colour formation is sufficient to rely solely on visual screening to identify colonies with correctly ligated crRNA spacers. This approach significantly simplifies and accelerates our workflow, confirming that a gel extraction step is not needed.

  1. Overnight cultures were prepared for all crRNA-carrying plasmids by picking white colonies from plates that had both white and purple colonies. Additionally, one false colony was picked to demonstrate its appearance the next day, and a negative control was included for comparison.

  2. For the A11 plasmid cut with EcoRI & SpeI, gel electrophoresis was performed, and the 2049 bp band was extracted according to the “DNA Gel Extraction Protocol”. 

The concentration of the extracted band was 35.9 ng/µl.

Purpose: To create a plasmid similar to the SVR but withan added BioBrick prefix and suffix, we chose to transfer the SynLOCK Cassette into the pSB1C3 plasmid backbone. This modification will ensure compatibility with both RCF10 and RCF1000 standards in our system.


  1. The predigested and extracted A11 plasmid backbone was used in the ligation reaction with the Cassette_Reporter fragment. 


Table 32: Ligation reaction components

Component

Volume [µl]

A11 digested EcoRI and SpeI 

1.4

T4 buffer

1

Cassette_Reporter [15.4 ng/µl]

5

H₂O

1,6

T4 ligase

1


For the negative control, water was used in place of the Cassette_Reporter. The transformation was carried out according to the Transformation Protocol II. After transformation, ⅕ of the reaction volume was plated.

Figure 32: a) The transformation results of the ligation reaction creating the USV plasmid visualised against white background and b) purple background. c) the negative control  

Conclusions: The ligation reaction was successful, as indicated by the purple colour of the colonies, which confirms that the reporter was ligated correctly.

Overnight cultures were prepared from two purple colonies picked from the plate.

The plasmid preparation was conducted according to the “Plasmid Isolation Protocol I”.

Figure 33: Pellets obtained after centrifuging 4 ml of overnight cultures carrying the respective plasmids. The results demonstrate that even if the wrong colony is accidentally picked from the plate, the mistake can be easily identified due to the distinct colour of the pellet.


Table 33: Concentration of the plasmids obtained after isolation

Plasmid

Concentration [ng/µl]

SVR + SyncrRNA

84.7

SVR + PrymcrRNA1

55.7

SVR + PrymcrRNA2

52.6

All obtained plasmids were digested with BbsI-HF enzyme to prepare them for in vitro transcription.


Table 34: Digestion reaction components

Component

Volume

Plasmid

16 μl 

BbsI-HF

0.5 μl 

Cut Smart Buffer 

2.5 μl 

H₂O

6 μl 


The digestion reaction was then visualised by gel electrophoresis:

Figure 34: Gel electrophoresis results of the digestion of SVR +crRNAs plasmids with BbsI.


Conclusions: All plasmids were correctly digested with BbsI, as indicated by a single band on the gel. 

  1. USV plasmids were isolated from overnight cultures according to the “Plasmid Isolation Protocol I”. The elution step was performed in 30 µl 10mM Tris pH=8. 


Table 35. Concentrations of obtained USV plasmid samples.

Sample

Concentration (ng/ul)

USV1

206

USV2

166.2


  1. The USV1 sample (later referred to as USV) was then digested with EcoRI and SpeI to demonstrate that the SynLOCK Cassette unit can now be transferred between Biobrick-compatible plasmid backbones. Additionally, a SapI digestion was performed to confirm that the reporter protein transcription unit could be excised.


Table 36: EcoRI and SpeI digestion reaction components

Component

Volume

USV (206 ng/µl)

1 μl 

EcoRI

0.2 μl 

SpeI

0.2 μl 

Cut Smart Buffer 

1 μl 

H₂O

7 μl 


Table 37: SapI digestion reaction components

Component

Volume

USV (206 ng/µl)

1 μl 

SapI

0.2 μl 

Cut Smart Buffer 

1 μl 

H₂O

7 μl 


  1. The reactions were incubated at 37°C for 30 minutes. 

  2. The results were visualised by gel electrophoresis: 


Figure 35: Electrophoresis results displaying the digestion of USV plasmid with the enzymes indicated in the image.


Table 38: Expected band size for each digestion of the USV plasmid.

Enzyme/s used

Expected Band Size (bp)

EcoRI &SpeI

2047 & 1031

SapI

2144 & 934


Conclusion: The correct bands were obtained, making the experiment successful. 


  1. Since the results were accurate, the digestion reaction was scaled up. A 10 µl sample of the USV plasmid was digested for one hour with SapI, followed by clean-up according to the “ost-Enzymatic Reaction Clean-Up” Protocol.


The concentration obtained after the clean up was 30.5 ng/µl 

Table 39: Ligation reaction setup using the USV plasmid post-enzymatic reaction clean-up sample. 

Component

Volume [µl]

USV cut with SapI post-enzymatic cleanup sample [30.5 ng/µl]

1.65

T4 buffer

1

1:200 dilution of crRNA spacer duplex

1

H₂O

15.35

T4 ligase

1


For the reactions described above, the duplexes used were PrymCrRNA1, PrymCrRNA2, and SynCrRNA. For each reaction setup, a negative control was prepared by using water instead of the oligo duplex. 

The samples were left at room temperature for 15 minutes. Afterwards all of the volume was used for transformation according to the “Transformation Protocol II”. In the final step 1/7 of the cells’ volume was used for plating.

Purpose: In vitro transcription (IVT) was conducted on the SVRs containing all crRNAs to determine if transcripts of the correct length could be produced from the vector.

A post-enzymatic reaction clean-up was carried out on all plasmids following linearization with BbsI, according to the “Post Enzymatic Reaction Clean-Up Protocol”.


Table 40: Concentration of the plasmids obtained after clean-up:

Plasmid

Concentration [ng/µl]

SVR + SyncrRNA

25.6

SVR + PrymcrRNA1

22.7

SVR + PrymcrRNA2

12.5


IVT was carried out in 20 μl reactions using T7 RNA polymerase from A&A Biotechnology, following the recommended protocol included in the reagent manual (https://www.aabiot.com/en/t7-polimeraza-rna). The IVT reactions were incubated for 4 hours at 37°C. A mastermix was prepared (as shown in Table 41) and added to each IVT reaction (Tables 41A-C).


Table 41: IVT master mix components.
Volumes were calculated for 3x 20 μl reaction = 60 μl.

Component

Volume [μl]

rNTP mix (25 mM)

4.8

T7 buffer

12

T7 RNA polymerase

3

RNase inhibitor (50 U/μl)

1.2


Table 41A: IVT reaction components for SVR + SyncrRNA.

Component

Volume [μl]

Purified and linearized DNA (~200 ng)

7.8

IVT master mix

7

RNase-free water

5.2


Table 41B: IVT reaction components for SVR + PrymcrRNA1.

Component

Volume [μl]

Purified and linearized DNA (~200 ng)

8.8

IVT master mix

7

RNase-free water

4.2


Table 41C: IVT reaction components for SVR + PrymcrRNA2.

Component

Volume [μl]

Purified and linearized DNA (~200 ng)

13

IVT master mix

7

RNase-free water

0


Phenol-chloroform extraction was carried out according to the protocol described in SHERLOCK Lab documentation.

Results: No RNA pellet was recovered during the precipitation and centrifugation steps.

Conclusions: No RNA was obtained, possibly due to an experimental error during the phenol-chloroform extraction or a low starting amount of DNA. The entire procedure should be repeated.

Figure 36: The ligation results of the crRNA spacers into the USV vector, visualised against both a white (a) and a purple background (b).


Conclusions:  The reaction was successful, as both white and purple colonies are visible on the plates containing the ligation reaction. In contrast, only purple colonies appear on the control plate.

Overnight cultures were prepared from USV and SVR plasmids containing three different crRNA spacers. Additionally, a colony from the negative control and a mistakenly picked purple colony from one of the crRNA plates were included to show that it's possible to identify a wrongly picked colony based solely on the colour of the pellet. 

Samples of SVR plasmids carrying PrymCrRNA1, PrymCrRNA2 and SynCrRNA were digested with the BbsI-HF enzyme to prepare them for in vitro transcription.


Table 42: Digestion reaction components

Component

Volume

Plasmid [330 ng/μl]

15 μl 

BbsI-HF

0.2 μl 

Cut Smart Buffer 

5 μl 

H₂O

29.8 μl 


The reaction was left to incubate for an hour at 37°C.

The digestion reaction was then visualised by gel electrophoresis:


Figure 37: Linearization results. 1: SVR + PrymCrRNA1, 2: PrymCrRNA2, 3: SynCrRNA


Conclusion: All plasmids were successfully linearized, making them ready for in vitro transcription (IVT).

IVT was repeated using the same protocol, but this time the reaction volume was doubled to 40 μl. All calculations remained the same as those in Table 41, A-C from 25/07/2024, but adjusted for the increased volume. The IVT reactions were incubated for 2 hours at 37°C. Phenol-chloroform extraction was performed following the standard protocol.

Results: No RNA pellet was recovered during the precipitation and centrifugation steps.

Conclusions: No RNA was obtained. After consulting with dr Mateusz Wawro, our instructor, we decided to repeat the procedure, this time using a larger amount of input DNA and the HiScribe® T7 High Yield RNA Synthesis Kit from New England Biolabs, in hopes of achieving a higher RNA yield.

Figure 38: Overnight cultures after centrifugation of 4 mL samples. a) SVR + PrymCrRNA1, b) SVR + PrymCrRNA2, c) SVR + SynCrRNA, d) USV + PrymCrRNA1, e) USV + PrymCrRNA2, f) USV + SynCrRNA.

Purpose: To obtain all plasmids carrying crRNAs, including both SVRs and USVs, and to compare the performance of two available miniprep kits.

Miniprep plasmid isolation was performed using 7 mL of overnight E. coli culture. Two kits, Syngen and NEB, were used side by side for comparison, following “Plasmid Isolation Protocol I” and “Plasmid Isolation Protocol II”, respectively.


Table 43: Summary of plasmid concentrations obtained for SVR + crRNAs.

Vector

Concentration obtained with Syngen kit [ng/μl]

Concentration obtained with NEB Monarch kit [ng/μl]

SVR + PrymcrRNA1

284.2

139

SVR + PrymcrRNA2

224.6

125.8

SVR + SyncrRNA

106.7

108.8


Table 44: Summary of plasmid concentrations obtained for USV + crRNAs.

Vector

Concentration obtained with Syngen kit [ng/μl]

Concentration obtained with NEB Monarch kit [ng/μl]

USV + PrymcrRNA1

163.4

91.5

USV + PrymcrRNA2

174.2

82.5

USV + SyncrRNA

129.6

52.4

29.07. - 4.08.

Purpose: In vitro transcription (IVT) was conducted on the SVR + PrymcrRNA1 vector to test the procedure using the HiScribe® T7 High Yield RNA Synthesis Kit and determine if any RNA could be obtained from the vector.

For this experiment, the HiScribe® T7 High Yield RNA Synthesis Kit from New England Biolabs was used, following the protocol for short templates (< 0.3 kb). An IVT master mix was prepared according to the protocol, with the FLuc Control Template from the kit serving as a positive control.

A mastermix was prepared (as shown in Table 45) and added to each IVT reaction (Tables A-B).


Table 45: IVT master mix. Volumes were calculated for 3x 20 μl reaction = 60 μl.

Component

Volume [μl]

10X reaction buffer

4.5

ATP (100 mM)

4.5

UTP (100 mM)

4.5

GTP (100 mM)

4.5

CTP (100 mM)

4.5

DTT (0.1 M)

3


Table 45A: SVR + PrymcrRNA1 IVT master mix components.

Component

Volume [μl]

IVT master mix

8.5

RNase-free water

0

Purified and linearized DNA (~500 ng)

9.5

T7 RNA Polymerase Mix

2


Table 45B: FLuc control template IVT master mix components.

Component

Volume [μl]

IVT master mix

8.5

RNase-free water

5

FLuc Control Template (500 ng/μl)

1

T7 RNA Polymerase Mix

2


IVT reactions were incubated for 4 h at 37°C.

DNase I treatment was performed to digest any remaining DNA. The reaction mix was prepared using components from the Monarch® Total RNA Miniprep Kit and incubated for 15 minutes at 37°C.


Table 46: DNase I treatment reaction mix.

Component

Volume [μl]

IVT reaction

20

RNase-free water

70

10X DNase I Buffer

10

DNase I

2


Post-enzymatic reaction cleanup was carried out using the Monarch® Total RNA Miniprep Kit. The RNA Reaction Cleanup protocol from the Monarch Total RNA Miniprep Kit (NEB #T2010) was followed.

A protocol for the entire above described procedure “IVT and RNA Cleanup Protocol” has also been included in the “Experiments” page.

The concentrations of the obtained RNA samples were measured using a NanoDrop Microvolume Spectrophotometer.


Table 47: Concentrations of crRNA samples obtained in the trial IVT.

crRNA

Concentration [ng/μl]

A260/A280

A260/A230

SVR PrymcrRNA1

610.7

2.18

2.41

FLuc Control Template

672.2

2.10

1.98


Results: RNA was obtained and purified successfully. The measured concentration and purity was satisfactory as well.


Conclusions: A successful IVT and cleanup procedure workflow was established, which will later be applied to all vectors.

To carry out the remaining IVT reaction combinations, we prepared digestions of USV and SVR plasmids containing the additional crRNA spacers, as outlined in Tables 48 A-E.


Table 48 A: Digestion reaction components for USV + PrymCrRNA2 plasmid

Component

Volume

Plasmid [174 ng/μl]

28 μl 

BbsI-HF

0.2 μl 

Cut Smart Buffer 

5 μl 

H₂O

17 μl 


Table 42 B: Digestion reaction components for SVR + PrymCrRNA2 plasmid

Component

Volume

Plasmid [224.6 ng/μl]

22 μl 

BbsI-HF

0.2 μl 

Cut Smart Buffer 

5 μl 

H₂O

23 μl 


Table 42 C: Digestion reaction components for USV +SynCrRNA plasmid

Component

Volume

Plasmid [129.8 ng/μl]

39 μl 

BbsI-HF

0.2 μl 

Cut Smart Buffer 

5 μl 

H₂O

6 μl 

T

Table 42 D: Digestion reaction components for SVR + SynCrRNA plasmid

Component

Volume

Plasmid [108.8 ng/μl]

46 μl 

BbsI-HF

0.2 μl 

Cut Smart Buffer 

5 μl 

H₂O

 - 


Table 42 E: Digestion reaction components for USV + PrymCrRNA 1 plasmid

Component

Volume

Plasmid [163.4 ng/μl]

44 μl 

BbsI-HF

0.2 μl 

Cut Smart Buffer 

5 μl 

H₂O

2 μl  


The reactions were left to incubate for an hour at 37°C.

Purpose: This experiment aimed to perform IVT on all vectors following the successful trial IVT conducted the previous day. The goal was to check if transcripts of the correct length could be obtained from the vectors.

First, the cleanup of the overnight digest reaction with BbsI was performed as previously described.

Table 43: Obtained concentrations of vectors.


Vector

Concentration [ng/μl]

SVR + SyncrRNA

68.9

SVR + PrymcrRNA2

65.2

USV + SyncrRNA

41.7

USV + PrymcrRNA2

26.4

USV + PrymcrRNA1

106.7


IVT was set up following the previously described procedure and incubated for 4 hours at 37°C. The IVT reactions were then treated with DNase I, and the cleanup procedure was carried out as previously described.


Table 44: Concentrations of obtained crRNA samples.

crRNA

Concentration [ng/μl]

SVR SyncrRNA

1637.9

SVR PrymcrRNA2

1665

USV SyncrRNA

742

USV PrymcrRNA1

971.8

USV PrymcrRNA2

828.8


After obtaining all RNAs, gel electrophoresis was performed using the previously established protocol described in the SHERLOCK Lab documentation, with one modification: a loading buffer without added EtBr was used to prepare the samples. Following separation at 90V for approximately 40 minutes, the gel was first washed in the TBE buffer for 10 minutes. It was then washed in a TBE + EtBr solution for 10 minutes, and finally washed again in the TBE buffer for 10 minutes.

The Thermo Scientific RiboRuler High Range RNA Ladder (200 to 6000 bases) was used. All transcripts expected length was 64 bp, so bands below 200 bp would be assumed to be the correct transcripts.


Figure 39: RNA electrophoresis – IVT results.


Results: Transcripts of the correct length were successfully obtained, but some bands appeared faint. This could indicate that the vectors may not have been fully digested with BbsI, or that the DNase I treatment was only partially effective. 

Conclusions: The correct transcript length confirms that the system is functioning as expected. However, further technical optimization is needed to improve the efficiency of RNA synthesis. Despite this, we have established a proof of concept demonstrating that both SVR and USV crRNA synthesis systems work correctly.

Protein Lab



Protein Lab Goals

Primary Objective:

1. Production and Purification of huLwCas13a:

  • The initial goal was to produce and purify the huLwCas13a protein for use in our SHERLOCK assay.

Expanded Objectives (Post Consultation):

2. Production and Purification of CcaCas13b:

  • After consulting with Prof. Andrzej Górecki, we decided to produce and purify an additional protein, CcaCas13b, as a backup in case huLwCas13a faced issues such as inefficient purification or inactivity. This strategy ensured that the project's workflow would continue smoothly without interruption.

3. Comparative Analysis of Proteins with and without Tags:

  • We aimed to compare the structure, stability, and activity of huLwCas13a and CcaCas13b both with and without the 6xHis-TwinStrep-SUMO tag. This comparison would help determine whether the expensive process of cleaving off the tag using SUMO protease is necessary.

Final Goals:

  • Production and Purification of Both Proteins: Successfully produce and purify both huLwCas13a and CcaCas13b.
  • Assessment of 6xHis-TwinStrep-SUMO Tag Impact: Evaluate how the presence of the 6xHis-TwinStrep-SUMO tag influences the proteins' structure, thermal stability, and activity.
  • Optimization of the Purification Protocol: Refine the purification process to maximize the yield and activity of the proteins, whether tagged or untagged.

How Cas13 Proteins Work in the SHERLOCK System

One of the essential components for detecting DNA/RNA using the SHERLOCK system is a protein from the Cas (CRISPR-associated) family. Cas proteins generally target and cleave invading DNA (types I, II, IV, V) or RNA (types III and VI). Cas13a and Cas13b, specifically, belong to type VI, which targets RNA [1].

In addition to the cis-cleavage activity common among Cas proteins (such as Cas9), Cas13 proteins possess a unique trans-cleavage or collateral activity. This collateral activity enables Cas13 to cleave any single-stranded RNA (ssRNA) in the vicinity of the protein, regardless of its sequence. When the CRISPR RNA (crRNA) binds to its specific target RNA, it induces a conformational change in the Cas13 protein, activating its nucleolytic domain [2, 3].

Once activated, Cas13 indiscriminately cuts any nearby ssRNA, a feature that SHERLOCK exploits to generate a detectable signal. The SHERLOCK system detects the cleavage of ssRNA reporters tagged with a fluorophore and a quencher. When the reporter is cleaved, fluorescence is emitted, indicating the presence of the target RNA. The Lateral Flow Assay (LFA) test also relies on this collateral activity, but uses biotin and fluorescein tags for detection.

Background

Numerous procedures have been described in the literature for purifying Cas13 proteins, with huLwCas13a being the most commonly studied. These procedures often involve single-step purification using Immobilized Metal Affinity Chromatography (IMAC) [4-6], and sometimes include an additional Size Exclusion Chromatography (SEC) step [7]. Another approach involves a more complex three-step purification process: starting with affinity chromatography using a streptavidin [8] or histidine [9] tag (IMAC), followed by Ion Exchange Chromatography (IEC), and finishing with SEC.

In many protocols, the 6xHis-TwinStrep-SUMO tag located at the N-terminus of the protein is cleaved off after purification [5][6][8]. However, no specific data justifying the removal of the tag, which requires the use of the relatively expensive SUMO protease, has been found in the literature.

This study focuses on optimizing the purification protocol to obtain the purest, most active form of huLwCas13a protein with minimal labor and cost. Based on our literature research, particularly Kellner et al. [8], and the experience of our instructors, we developed our own protocols for the purification of huLwCas13a and CcaCas13b.

Key Steps in Protein Production and Purification Process

The primary goal was to obtain pure and active Cas13a and Cas13b proteins for use in SHERLOCK detection. Below are the key steps:

  1. Protein Expression: Proteins were expressed in E. coli strain Rosetta 2(DE3)pLysS using the pET system.
  2. Bacterial Cell Disruption: Sonication was used to lyse the bacterial cells.
  3. Protein Purification:
    • IMAC: Evaluated HisTag versus StrepTag purification efficiency (Figures 11-14).
    • IEC: Removed remaining contaminants and concentrated the sample before SEC (Figures 15-18).
    • SEC: Achieved highly pure Cas13a and Cas13b proteins (Figures 21-22).
  4. Comparative Analysis: The tag’s effect on structure, thermal stability, and activity was evaluated via Circular Dichroism (Figures 27-28), NanoDSF (Figures 29-30), and SHERLOCK activity tests (Figure 26).

Conclusion:

The optimized protocol enabled the production of highly pure and active Cas13a and Cas13b proteins suitable for SHERLOCK detection assays, eliminating the need for the tag cleavage step as it does not significantly affect protein structure, stability, or activity.

The optimised protocol can be found here: Click for protocol.

13.11. - 19.11

Plasmids:
1. pC013 (huLwCas13a) (pC013 - Twinstrep-SUMO-huLwCas13a was a gift from Feng Zhang (Addgene plasmid # 90097 ; http://n2t.net/addgene:90097 ; RRID:Addgene_90097)) [3].


Figure 1. pC013 plasmid coding 6xHis-TwinStrep-SUMO-huLwCas13a.

2. pR0306 (CcaCas13b) (pR0306 CcaCas13b His6-TwinStrep-SUMO was a gift from Feng Zhang (Addgene plasmid # 182687 ; http://n2t.net/addgene:182687 ; RRID:Addgene_182687)) [10].


Figure 2. pR0306 plasmid coding 6xHis-TwinStrep-SUMO-CcaCas13b.

were bought in Addgene.

GOAL: Isolate purchased plasmids and prepare samples for sequencing to confirm the correct nucleotide sequence.

METHODS: Bacteria were streaked on agar plates (ampicillin 100 μg/ml for pR0306, ampicillin 100 μg/ml and chloramphenicol 34 μg/ml for pC013). Bacteria were incubated overnight at 37°C.

The next day 15 ml TB liquid cultures were inoculated (antibiotics in concentrations as in agar plates). Cultures grew overnight in a shaker – 300 r.p.m., 37°C. The next day plasmids were isolated using NZYMiniprep (NZYtech) – protocol is available in the protocols section.
0.8% agarose gel was prepared by dissolving 0.8 g of agarose in 100 ml of TAE buffer in a microwave. The mixture was cooled to a temperature of about 50°C, 3 μl of Midori Green DNA Stain (Nippon Genetics) was added. Agarose was poured into a gel tray with the well comb in place. When the gel was solid 1 kb GeneRuler marker and plasmid samples were loaded into the wells. Gel ran for 30 min, 99 V.
RESULTS:


Figure 3. Agarose gel after pC013 (Cas13a) and pR0306 (Cad13b) plasmid isolation. Key: d = plasmid digested using enzymes BamHI and XbaI, nd = plasmid non-digested.

Table 1. Plasmid pC013 and pR0306 concentration measurement

Sample DNA concentration [ng/μl]
pC013 (1) 561.4
pC013 (2) 596.6
pR0306 138.8

In the digested sample, a single band was observed for the pR0306 plasmid (Figure 3), indicating that the sample was ready for sequencing (Figure 1). However, the pC013 plasmid showed more than two bands, which we suspected was due to the presence of the pRARE plasmid in the Rosetta 2(DE3)pLysS cells. This plasmid codes for rare tRNAs and has a selectable marker for chloramphenicol. To obtain clear sequencing results, we decided to remove the pRARE plasmid from the bacteria.


To achieve this, DH5α cells were transformed with varying amounts of the pC013 plasmid – 100 ng, 10 ng, and 0.1 ng – added to approximately 1 ml of competent bacteria. The bacteria were then streaked onto agar plates containing ampicillin but no chloramphenicol. After incubation overnight at 37°C, growth was observed only on the plates with 10 ng and 100 ng of plasmid DNA. Notably, the number of colonies on both plates was similar.

20.11. - 26.11

GOAL: Selection of colonies that lost the pRARE plasmid.

METHODS: To select colonies that had lost the pRARE plasmid but retained pC013, colonies were picked from the plate with bacteria transformed with 10 ng of plasmid DNA. These colonies were resuspended in 200 μl LB, and 100 μl was transferred to glass tubes containing LB with ampicillin, while another 100 μl was transferred to LB with ampicillin and chloramphenicol. A total of 19 such samples were prepared and incubated overnight in a shaker at 37°C, 300 r.p.m.

The following day, bacterial growth was observed in 18 out of 19 tubes containing LB with ampicillin. No growth was seen in any tube containing chloramphenicol, indicating successful removal of the pRARE plasmid from the cells. Plasmid isolation was performed using the NZYMiniprep kit on six randomly selected tubes.


Figure 4. Agarose gel after pC013 plasmid isolation. Numbers correspond to the following samples of grown bacteria. d = plasmid digested using enzymes BamHI and XbaI, nd = plasmid non-digested.


Figure 4 confirms successful removal of the pRARE plasmid, as only one band is observed in every digested (d) sample.


Table 2. Plasmid pC013 concentration measurement

Sample DNA concentration [ng/μl] A260/A280
1 48.3 2.15
2 42.6 2.1
3 38.3 2.31
4 34.9 2.05
5 39.6 2.2
6 36.1 2.19

GOAL: Confirming that pC013 and pR0306 plasmids have the proper sequence coding for Cas proteins.

METHODS: For pC013 sequencing, we selected sample 1 from plasmid isolation (22.11). For pR0306 sequencing, we chose a sample from plasmid isolation performed on 16.11.

Sequencing was ordered using both T7 promoter and T7 terminator primers, ensuring thorough verification of the sequence. Comparing the 5' and 3' ends of the sequence with the one deposited by the vendor allows for greater confidence in the accuracy of the CDS sequence for the Cas13 protein.

Results for pC013:


Figure 5. Alignment of sequenced fragment and pC013 plasmid sequence (T7 promoter primer).


Figure 6. Alignment of sequenced fragment and pC013 plasmid sequence (T7 terminator primer).

Results for pR0306:


Figure 7. Alignment of sequenced fragment and pR0306 plasmid sequence (T7 promoter primer).


Figure 8. Alignment of sequenced fragment and pR0306 plasmid sequence (T7 terminator primer).

Conclusions:

The obtained sequencing reads demonstrate high quality, with all nucleotides in the sequence successfully determined. The substitutions observed in the initial segments of the sequence are attributed to the high abundance of these DNA fragments post-amplification, which caused fluorescence reading distortions due to signal saturation. This phenomenon is characteristic of Sanger sequencing methodology, as are the mismatches observed closer to the end of sequenced fragments. Consequently, it can be concluded that the sequencing results align with the plasmid sequence deposited on the vendor's (Addgene) website.

04.12 - 10.12

GOALS: Transforming Rosetta 2(DE3)pLysS cells with sequenced plasmids (pC013, pR0306).

METHODS: Transformation was performed using a heat shock method (20 min on ice, 45 s in a thermoblock at 42°C, 2 min on ice) into the competent Rosetta 2(DE3) pLysS cells. 1 µl of plasmid was used per 1 ml of competent bacteria. The bacteria were streaked on LB-agar plates containing ampicillin (100 μg/ml) and chloramphenicol (34 μg/ml) and incubated overnight at 37°C.

RESULTS:


Figure 9. Single colony grown after transformation of Rosetta 2(DE3)pLysS cells with sequenced pC013 sample.


Figure 10. Colonies grown after transformation of Rosetta 2(DE3)pLysS cells with sequenced pR0306 sample.

CONCLUSIONS: For the colony transformed with pC013 (Figure 9), precultures will be prepared before inoculating mother cultures. For pR0306 (Figure 10), there are plenty of colonies that will be used for mother culture inoculation.

GOAL: Multiplying the number of bacterial cells containing pC013.

METHODS: 5 ml of TB media supplemented with ampicillin (100 μg/ml) and chloramphenicol (34 μg/ml) was inoculated using the colony observed in Figure 9. The bacteria were grown overnight at 37°C in a shaker at 300 r.p.m.

RESULTS: Bacterial growth was observed in the glass tube.

CONCLUSIONS: The preculture will be used the next day for mother culture inoculation.

GOAL: Preparing mother cultures (50 ml) for protein expression.

METHODS: Single colonies for Cas13b (see Figure 10) were used to prepare six mother cultures. These cultures were incubated overnight with shaking at 37°C in 50 ml of TB medium supplemented with antibiotics (ampicillin 100 μg/ml and chloramphenicol 34 μg/ml).

RESULTS: Bacterial growth was observed in all six flasks.

CONCLUSIONS: The mother cultures will be used the next day for inoculating large-scale cultures for protein expression.

GOAL: Producing Cas proteins in large-scale cultures (9 L).

METHODS: Six flasks, each containing 1.5 L of TB medium with the same composition as the mother cultures, were inoculated with 30 ml of the mother cultures. OD600 was monitored, and when it reached between 0.4-0.6, the flasks were cooled to 4°C for 30 minutes in a cold room. Then, 1.5 ml of 0.5 M IPTG (isopropyl-β-D-thiogalactopyranoside) inducer was added, and the cultures were shaken for 18 hours at 21°C. After incubation, the cultures were centrifuged (7 min, 5,000 g, 4°C), yielding six Falcon tubes of bacterial pellet, with masses ranging from 13-18 g per tube. The pellets were stored at -20°C until further use.

RESULTS:

  • For Cas13a, 95.18 g of bacterial pellet was obtained, of which 15.12 g was used for further purification.



11.12 - 17.12

GOAL: Producing Cas proteins in large-scale cultures (9 L).

METHODS: Six flasks, each containing 1.5 L of TB medium with the same composition as the mother cultures, were inoculated with 30 ml of the mother cultures. OD600 was monitored, and when it reached between 0.4-0.6, the flasks were cooled to 4°C for 30 minutes in a cold room. Then, 1.5 ml of 0.5 M IPTG (isopropyl-β-D-thiogalactopyranoside) inducer was added, and the cultures were shaken for 18 hours at 21°C. After incubation, the cultures were centrifuged (7 min, 5,000 g, 4°C), yielding six Falcon tubes of bacterial pellet, with masses ranging from 13-18 g per tube. The pellets were stored at -20°C until further use.

RESULTS:

  • For Cas13b, 96.7 g of bacterial pellet was obtained, of which 18.82 g was used for further purification.

08.01 - 14.01

GOAL: Disrupting bacteria and releasing accumulated Cas proteins.

METHODS: The bacterial pellets were resuspended in double the volume of NI buffer with the following additions:

  • 1 cOmplete Ultra tablet
  • 30 mg of lysozyme
  • 10 μl benzonase nuclease (activity ≥ 250 U/μl)
  • 45 μl DTT (1 M)

The tube was placed on ice, and 20 sonication cycles were performed. Each cycle consisted of 30 seconds of sonication followed by a 30-second pause. The sonicator was set to not exceed a temperature of 30°C, with an amplitude of 40%. After sonication, the sample was centrifuged for 30 minutes at 30,000 g at 4°C.

Buffer without imidazole (NI): 0.5 M NaCl, 20 mM Na₃PO₄, 5% glycerol, 1 mM DTT, protease inhibitors, pH = 8.0.

GOALS: Reduce contamination and concentrate Cas proteins in samples.

METHODS: The first stage of protein purification was carried out due to the presence of an N-terminal histidine tag, which binds to the nickel resin column. The process was conducted at 4°C.

The column with packed resin was washed with NI buffer (flow rate: 3 ml/min, 5 column volumes (cv)), the sample (supernatant from centrifugation in the previous step) was loaded (flow rate: 1.5 ml/min), and the column was washed with 5 cv of NI buffer (flow rate: 3 ml/min) to remove unbound residues. A two-step elution was performed: first with a buffer mixing NI and I buffers in a 1:1 ratio (final imidazole concentration of 150 mM), followed by buffer I with 300 mM imidazole. Fifteen 2-ml fractions were collected for each elution step.

Buffers:

  • NI buffer (without imidazole): 0.5 M NaCl, 20 mM Na₃PO₄, 5% glycerol, 1 mM DTT, protease inhibitors, pH 8.0.
  • I buffer (with 300 mM imidazole): 0.5 M NaCl, 20 mM Na₃PO₄, 5% glycerol, 1 mM DTT, protease inhibitors, 300 mM imidazole, pH 8.0.

Note: Before use, add 1 cOmplete Ultra tablet per 30 ml of buffer.

RESULTS:


Figure 11. SDS-Page gel for huLwCas13a - samples from expression and IMAC purification. Cas13a is indicated by a violet arrow.


Figure 12. SDS-Page gel for CcaCas13b - samples from expression and IMAC purification. Cas13b is indicated by a yellow arrow.

Wells key: unind. – uninduced bacterial culture, ind. – culture after 18h IPTG induction, sonic. – supernatant after sonication and centrifugation, prec. – sediment after sonication and centrifugation, FT – flow-through from sample application on His-resin column, wash – flow-through from column washing before elution; E1, E2, E3… - fractions eluted with 150 mM imidazole buffer, *E1, *E2, *E3 - fractions eluted with 300 mM imidazole buffer.


Figure 13. Total eluted protein concentrations in fractions after IMAC (Cas13a).


Figure 14. Total eluted protein concentrations in fractions after IMAC (Cas13b).

CONCLUSIONS: IMAC was effective in partially purifying both proteins, reducing contaminant levels. Although contaminants were still present, the fractions were enriched with the produced proteins, as indicated by thicker bands on the SDS-PAGE gel (marked by arrows).

  • For Cas13a, 150 mM imidazole elution was efficient, but a small portion of the protein was eluted with 300 mM imidazole. In future purifications, 300 mM elution is recommended (see Figures 11 and 13).
  • For Cas13b, a significant amount of protein remained bound to the column after 150 mM elution. The 300 mM elution was more effective (see Figures 12 and 14).

15.01-21.01 (Cas13a), 11.03-17.03 (Cas13b)

GOALS: Divide Cas13a and Cas13b into two pools – SUMO protease digested and undigested (with and without the 6xHis-TwinStrep-SUMO tag), in order to compare their activity, structure, and stability after final purification.

METHODS: 10 ml of selected samples for Cas13a (samples 1, 3, 5, 7, and 9) and 14 ml of Cas13b (samples 1, 3, 5, 7, 9, 11, and 13) were diluted to 30 ml with buffer A. To this, 10 μl of DTT (1 M), 60 μl of NP-40 detergent, and 50 μl of SUMO protease (1 U/μl) were added. The mixtures were digested overnight on a rocker at 4°C.

Buffer A: 20 mM Na₃PO₄, 5% glycerol, 1 mM DTT, pH 7.5

22.01-28.01 (Cas13a), 11.03-17.03 (Cas13b)

GOALS: Further removal of protein contaminants and concentrating the Cas protein sample before final purification using SEC.

METHODS: This purification stage was conducted separately for two samples: the digested protein (with a theoretical pI of 9.62 for Cas13b and 9.72 for Cas13a) and the undigested protein (pI 9.5 for Cas13b and 9.62 for Cas13a).

The separation was performed using an ӒKTA Pure FPLC (Fast Protein Liquid Chromatography) system and a cation exchange column Mono S 4.6/100PE (Cytiva) with a volume of 1.7 ml.

The device was programmed based on the protocol [8], starting with pre-equilibrating the column with 12.5% buffer B (5 column volumes (cv)). The undigested protein sample (Cas13a) was diluted with buffer A (pH 7.5) to 30 ml and loaded onto the column. The column was washed with 12.5% buffer B (5 cv) and the bound protein was eluted with a gradient of 12.5% to 100% buffer B (10 cv), collecting 2 ml fractions. The column was washed with 100% buffer B (10 cv) and equilibrated with 12.5% buffer B (5 cv). The flow-rate for all steps was 1 ml/min.

The same procedure was repeated for the digested Cas13a sample and both Cas13b samples with the following changes: for elution, a gradient of 12.5% to 80% buffer B was used, and the volume of collected fractions was 0.5 ml.

Buffers:

  • Buffer A: 20 mM Na₃PO₄, 5% glycerol, 1 mM DTT, pH 7.5
  • Buffer B: 2 M NaCl, 20 mM Na₃PO₄, 5% glycerol, 1 mM DTT, pH 7.5

RESULTS:


Figure 15. SDS-Page gel for huLwCas13a - samples after IEC. Cas13a with the tag is indicated by the violet arrow, Cas13a without the tag by the blue arrow. The purple rectangle marks two bands corresponding to the cleaved 6xHis-TwinStrep-SUMO tag.

Wells key:

  • Entry – pooled fractions after IMAC
  • Sample appl. – flow-through from sample application on the column
  • Wash – flow-through from column washing
  • E1, E2, E3… - eluted fractions, numbers correspond to the numbers of fractions on chromatograms (Figure 17, Figure 18). Samples with * correspond to samples after SUMO protease digestion


Figure 16. SDS-Page gel for CcaCas13b - samples after IEC. Cas13b with the tag is indicated by the yellow arrow, Cas13b without by the orange arrow. The black circle marks the cleaved tag.

Wells key:

  • Eluted fractions of Cas13b (left picture for SUMO protease undigested, right for digested) E6, E8, E10... -  numbers correspond to the numbers of fractions on chromatograms (Figure 19,  Figure 20).
  • Flow-through - from sample application on the column
  • Wash – flow-through from column washing. The area where a band for the digested tag was expected is marked with black circles. For the undigested protein there is one band in this area, while for the digested protein, there are two. Therefore, the additional band is likely the tag.


Figure 17. Chromatogram. Cas13a IEC for SUMO protease undigested sample.


Figure 18. Chromatogram. Cas13a IEC for SUMO protease digested sample.


Figure 19. Chromatogram. Cas13b IEC for undigested sample of Cas13b.


Figure 20. Chromatogram. Cas13b IEC for SUMO protease digested sample.

CONCLUSIONS: For both Cas13a and Cas13b (SUMO protease digested and undigested samples), a 2-fold reduction in protein contaminants was observed, though contaminants still remain in significant amounts. The concentration of Cas13a and Cas13b in the collected fractions was visible, with the elution maximum for both proteins occurring at approximately 35% buffer B, which corresponds to 0.7 M NaCl.

Using a cation-exchanger was effective in separating the cleaved tag (marked by the purple rectangle in Figure 15 for huLwCas13a and the black circle in Figure 16 for CcaCas13b). The pI of the 6xHis-TwinStrep-SUMO tag is 6.57, which prevents the tag from binding to the column bedding.

04.03-10.03 (Cas13a), 11.03-17.03 (Cas13b)

Protein samples concentration

GOALS: Reducing the volume of the sample to inject it into the SEC column.

METHODS: Chosen samples (4-6 and 9-20 for Cas13a, 9-14 for digested and undigested Cas13b) were concentrated in a centrifugal concentrator to a volume of approximately 0.5 ml (centrifugation parameters: 15 min, 4,000 g, 4°C).

RESULTS: The sample volume for both proteins was reduced to approximately 0.5 ml.

GOALS: Obtaining pure huLwCas13a and CcaCas13b.

METHODS: Size-exclusion chromatography (SEC) was performed on the same device as IEC, with a flow rate of 0.5 ml/min. The Superdex 200 10/300 GL (Merck) column was equilibrated with buffer S (1 column volume (cv)), and the concentrated sample of undigested protein was loaded. The sample was eluted, collecting 0.5 ml fractions (1 cv), followed by washing and re-equilibrating the column (1 cv). The SUMO-digested sample was then loaded.

Buffer S: 50 mM Tris-HCl (pH 7.5), 0.6 M NaCl, 5% glycerol. pH = 7.5.

RESULTS:


Figure 21. SDS-Page gel for huLwCas13a - samples after SEC. Cas13a with tag is indicated by the violet arrow, without tag by the blue arrow. Samples with * correspond to samples after SUMO protease digestion.


Figure 22. SDS-Page gel for Cas13b - samples after SEC. Cas13b with tag is indicated by the yellow arrow, without by the orange arrow. Samples with * correspond to samples after SUMO protease digestion.


Figure 24. Chromatogram. Cas13a SEC. First sample is SUMO protease undigested, second is digested.


Figure 25. Chromatogram. Cas13b SEC. First sample is SUMO protease undigested, second is digested.

CONCLUSIONS: We successfully completed the protein production and purification process for both Cas proteins. However, two bands are present for SUMO protease-digested samples (Figures 21 and 22). The higher band corresponds to the protein with the 6xHis-TwinStrep-SUMO tag (violet arrow for Cas13a, yellow for Cas13b), and the lower band corresponds to the protein without the tag (blue for Cas13a, orange for Cas13b).

Pooled fractions for huLwCas13a:

  • Undigested: Fractions 17-20 (0.5 ml each, total 2 ml). Protein concentration: 0.73 mg/ml (measured using the Bradford method). Total huLwCas13a mass: 1.46 mg.
  • Digested: Fractions 40-44 (0.5 ml each, total 2.5 ml). Protein concentration: 0.87 mg/ml. Total huLwCas13a mass: 2.175 mg.

Pooled fractions for CcaCas13b:

  • Undigested: Fractions 44-48 (0.5 ml each, total 2.5 ml). Protein concentration: 0.52 mg/ml. Total CcaCas13b mass: 1.3 mg.
  • Digested: Fractions 75-79 (0.5 ml each, total 2.5 ml). Protein concentration: 0.35 mg/ml. Total CcaCas13b mass: 0.875 mg.

15.04 - 21.04

GOAL: Comparing the activity of huLwCas13a with and without the 6xHis-TwinStrep-SUMO tag.

METHODS: The SHERLOCK test was conducted by Kasia and Nina in the SHERLOCK Lab. The procedure followed the protocol described by Kellner [1].

The test focused on huLwCas13a, and we decided not to order specific synthetic DNA for CcaCas13b activity testing because redesigning the synDNA provided by Kellner by changing the DR sequence specific to CcaCas13b would be required. Initially, we aimed to test huLwCas13a activity, and since it worked, we used it for further SHERLOCK reactions.

RESULTS:


Figure 26. Comparing activity of huLwCas13a with and without the 6xHis-TwinStrep-SUMO tag.

Figure key:

  • 1 – SUMO protease digested huLwCas13a added to SHERLOCK mix
  • 2 – SUMO protease undigested huLwCas13a added to SHERLOCK mix
  • 3 – Water added instead of Cas13a (negative control)
  • 4 – RNase A added instead of Cas13a (positive control)
  • 5 – Target RNA and crRNA replaced with water in SHERLOCK mix, for SUMO digested huLwCas13a
  • 6 – Target RNA and crRNA replaced with water in SHERLOCK mix, for SUMO undigested huLwCas13a

CONCLUSIONS: The produced huLwCas13a is active. There are no statistically significant differences in activity between the SUMO protease digested (1) and undigested (2) samples. The protein does not exhibit constitutive collateral activity, as indicated by the significantly lower signal observed in samples without target RNA and crRNA (5-6). The produced huLwCas13a can be used in further SHERLOCK tests.

22.04 - 28.04

GOAL: Comparing the structure of both proteins (huLwCas13a and CcaCas13b) with and without the 6xHis-TwinStrep-SUMO tag.

METHODS: Measurements were conducted using a Jasco J-710 spectropolarimeter with the following parameters:

  • Wavelength range: 190-250 nm
  • Resolution: 1 nm
  • Scanning mode: continuous
  • Scanning speed: 20 nm/min
  • Response time: 4 s
  • Bandwidth: 2.0 nm

Five data series were collected using a quartz cuvette with an optical path length of 0.1 mm.

RESULTS:


Figure 27. Dependence of mean residue molar ellipticity for huLwCas13a with and without the tag in the far-UV range.


Figure 28. Dependence of mean residue molar ellipticity for CcaCas13b with and without the tag in the far-UV range.

Table 2. Proportions of various secondary structure types determined from Circular Dichroism spectra for huLwCas13a.

huLwCas13a α-helix β-sheet β-turn unordered
Undigested 64.5 ± 2.1 3.8 ± 0.9 10.2 ± 0.7 20.9 ± 2.5
Digested 58.1 ± 10.2 4.7 ± 6.3 18.2 ± 9.9 19.5 ± 7.2

Table 3. Proportions of various secondary structure types determined from Circular Dichroism spectra for CcaCas13b.

CcaCas13b α-helix β-sheet β-turn unordered
Undigested 76.8 ± 11.1 1.5 ± 2 6.9 ± 4.3 15.2 ± 10.5
Digested 80.4 ± 7.4 0.5 ± 2 4.4 ± 3.3 14.7 ± 7.8

CONCLUSIONS: For both proteins, the mean residue ellipticity spectra (Figures 27, 28) overlap, and the proportions of the individual secondary structures (Tables 2 and 3) do not differ significantly. This indicates that the tag’s presence does not significantly impact the protein structure, and therefore, it should not affect the protein's function, as confirmed in earlier activity tests.

GOALS: Comparing the thermal stability of both proteins (huLwCas13a and CcaCas13b) with and without the 6xHis-TwinStrep-SUMO tag.

METHODS: Measurements were conducted using the Prometheus NT.48 device (NanoTemper Technologies). The heating range was from 20°C to 95°C, at a rate of 1°C/min. Measurements were performed in triplicates.

RESULTS:


Figure 29. Dependence of the first derivative of the fluorescence intensity change from temperature for huLwCas13a.


Figure 30. Dependence of the first derivative of the fluorescence intensity change from temperature for CcaCas13b.

Key:

  • D – SUMO protease digested sample
  • UD – SUMO protease undigested sample

CONCLUSIONS: The curves corresponding to the digested (D) and undigested (UD) proteins overlap, indicating that the tag’s presence does not significantly impact the proteins’ thermal stability. This justifies not cleaving off the 6xHis-TwinStrep-SUMO tag, as the tag does not alter protein function, which has also been confirmed in earlier tests.

FINAL CONCLUSIONS FROM OUR TESTS:

We recommend purifying huLwCas13a and CcaCas13b according to the following protocol: Click for protocol.

From the sediments used for protein purification, we obtained:

  • 1.46 mg tagged huLwCas13a – enough for 11,500 reactions according to Kellner’s protocol [8]
  • 2.175 mg untagged huLwCas13a – enough for 17,000 reactions
  • 1.3 mg tagged CcaCas13b – enough for 10,300 reactions
  • 0.875 mg untagged CcaCas13b – enough for 6,900 reactions

This supports the use of a longer and more costly purification protocol (compared to 1-step purification protocols suggested in some publications [4], [5], [6]) to obtain the purest possible Cas protein preparation, ensuring greater reliability of SHERLOCK test results.

We also observed that IMAC can effectively replace StrepTag affinity chromatography as suggested by Kellner [8]. In fact, IMAC may be more effective, as we obtained 3.635 mg of pure Cas13a from 1.5 L of culture and 2.175 mg of Cas13b, while Kellner reports only 0.5-1 mg from a 4 L culture.

Not cleaving off the 6xHis-TwinStrep-SUMO tag is justified by activity tests (Figure 26), CD (Figure 27, Figure 28), and NanoDSF (Figure 29, Figure 30) results, making the purification protocol faster and cheaper.

Additional recommendations (not tested):

  • Use more protease inhibitors or change the product to reduce proteolysis observed on the SDS-Page gel after IMAC (Figure 11, Figure 12).
  • Use a different cell disruption method (e.g., French press) – during sonication, the mixture heated up quickly, extending the process to more than 30 minutes instead of the predicted 20 minutes.
  • Prewash the His-NiNTA column with 30 mM imidazole buffer before elution with 300 mM (or higher) imidazole – this could result in purer eluted fractions.

  1. Y. Xu and Z. Li, “CRISPR-Cas systems: Overview, innovations and applications in human disease research and gene therapy,” Comput Struct Biotechnol J, vol. 18, pp. 2401–2415, 2020, doi: 10.1016/j.csbj.2020.08.031.
  2. O. O. Abudayyeh et al., “C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector.,” Science, vol. 353, no. 6299, p. aaf5573, Aug. 2016, doi: 10.1126/science.aaf5573.
  3. J. S. Gootenberg et al., “Nucleic acid detection with CRISPR-Cas13a/C2c2,” Science (1979), vol. 356, no. 6336, pp. 438–442, Apr. 2017, doi: 10.1126/science.aam9321.
  4. A. S. Savinova, E. Yu. Koptev, E. V. Usachev, A. P. Tkachuk, and V. A. Guschin, “Cas13a: purification and use for detection of viral RNA,” Bulletin of Russian State Medical University, no. 2, pp. 21–25, 2018, doi: 10.24075/brsmu.2018.021.
  5. B. An et al., “Rapid and Sensitive Detection of Salmonella spp. Using CRISPR-Cas13a Combined With Recombinase Polymerase Amplification,” Front Microbiol, vol. 12, Oct. 2021, doi: 10.3389/fmicb.2021.732426.
  6. H. Khan et al., “CRISPR-Cas13a mediated nanosystem for attomolar detection of canine parvovirus type 2,” Chinese Chemical Letters, vol. 30, no. 12, pp. 2201–2204, Dec. 2019, doi: 10.1016/j.cclet.2019.10.032.
  7. M. 2022 iGEM Team, “Cas13a Purification Protocol.” Accessed: Jun. 05, 2024. [Online]. Available: https://2022.igem.wiki/montpellier/results
  8. M. J. Kellner, J. G. Koob, J. S. Gootenberg, O. O. Abudayyeh, and F. Zhang, “SHERLOCK: nucleic acid detection with CRISPR nucleases.,” Nat Protoc, vol. 14, no. 10, pp. 2986–3012, Oct. 2019, doi: 10.1038/s41596-019-0210-2.
  9. A. East-Seletsky et al., “Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection,” Nature, vol. 538, no. 7624, pp. 270–273, Oct. 2016, doi: 10.1038/nature19802.
  10. J. S. Gootenberg, O. O. Abudayyeh, M. J. Kellner, J. Joung, J. J. Collins, and F. Zhang, “Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6.,” Science, vol. 360, no. 6387, pp. 439–444, Apr. 2018, doi: 10.1126/science.aaq0179.

PrymFlow Lab


Background information

The SHERLOCK method, like other CRISPR/Cas-based detection techniques, is compatible with a Lateral Flow readout format. The Lateral Flow Test is known for its speed, simplicity, and ease of interpretation. This study aimed to adapt the SHERLOCK components, previously studied and optimized by the SHERLOCK Lab, for use with Lateral Flow dipsticks, resulting in the development of the PrymFlow test for detecting the presence of Prymnesium parvum.

The HybriDetect - Universal Lateral Flow Assay Kit (Milena Biotec) is the most commonly used dipstick for SHERLOCK assays and was also utilized in this study. This test strip, based on lateral flow technology with Gold Nanoparticles (GNPs), offers a simple and rapid method for developing custom rapid tests [1]. The HybriDetect strip allows users to assess the status of the RNA reporter used in the SHERLOCK method (for a detailed overview of the SHERLOCK method principle, see Project Description page). In the Lateral Flow Assay procedure, a single-stranded RNA reporter labeled with 6-Carboxyfluorescein (6-FAM) at the 5′ end and biotin at the 3′ end is used. Cas13-dependent cleavage of the reporter results in the separation of these terminal labels, enabling the HybriDetect dipstick to distinguish between intact and cleaved reporters, providing a semi-quantitative readout [2].

LFA result interpretation

If the target is present, the T-line becomes visible, indicating a positive result. Meanwhile, the C-line serves as a control that is less visible when greater amounts of the target sequence are present. Gold nanoparticles (GNPs) with anti-FAM antibodies provide the visual indication of the test result (Figure 1).

WHAT HAPPENS WHEN PRYMNESIUM PARVUM IS NOT PRESENT IN THE WATER SAMPLE?

Streptavidin, immobilized on the C-line, captures the biotin-labeled ends of the intact reporters. The reporters are captured on the C-line, and the binding of gold nanoparticles (GNPs) conjugated with anti-FAM antibodies makes only the C (control) line visible.

AND WHEN IT IS PRESENT?

The reporters are cleaved by the activated Cas protein. Consequently, gold nanoparticles (GNPs) with anti-FAM antibodies capture the FAM-labeled fragments, which then bind to the anti-anti-FAM antibody immobilized on the test line (T-line), producing a strong signal. This strong T-line indicates the presence of Prymnesium parvum. Some intact reporters might remain in the mix (the amount depends on how many target DNA molecules were present in the sample, influencing the ratio of activated to non-activated Cas13 protein and the number of cleaved reporter molecules). As a result, a weak control line (C-line) is visible.

Figure 1: Explanation of the lines visible on the Lateral Flow test during a negative and positive result.


[1] Milenia GenLine HybriDetect, Instructions for Use https://www.milenia-biotec.com/uploads/2024/08/MGHD_1_IFU_D.pdf (Accessed 21.08.2024)

[2] Milenia GenLine HybriDetect, A Short Guide for Improved Readout-Performance https://www.milenia-biotec.com/uploads/2019/07/improved-CRISPR-readout_final-1.pdf (Accessed 21.08.2024)

24.06. - 30.06

Purpose: The purpose of this experiment was to attempt the LFA detection procedure for the first time and test whether all reagents work correctly. Secondly, it aimed to see whether Prymnesium DNA isolated from cultures can be directly detected using the LFA.

The dual-labelled RNA reporter was resuspended in 697 μl of RNase-free water, as per the manufacturer’s instructions.

Figure 2: Manufacturer’s manual for the RNA reporter for use in the LFA procedure.

This experiment utilized the GalF and GalR primers as well as PrymcrRNA1 and PrymcrRNA2. The sequences as well as descriptions of these parts can be found in the iGEM Registry. RPA was performed according to the “RPA Protocol” included in the “Experiments” page, which was adapted from [3].

Samples labelled “Prymnesium gDNA” indicate Prymnesium parvum genomic DNA isolated from our culture. For this experiment, the sample labelled “DNA P 27/05” was used (see AlgaLab documentation for a description of the culture’s origin).

In this experiment, 7 RPA reactions were assembled:

Table 1: RPA samples summarized.

Sample number

Sample name*

Template DNA used for RPA

RPA primers used

1

RPA (-)

–

GalF + GalR

2

synDNA

synDNA

SynF + SynR

3-4

Prymnesium gDNA

Prymnesium gDNA

GalF + GalR

5

SHERLOCK (-)

–

GalF + GalR

6

RNase A (+)

–

–

7

RNase A (+) no inhibitor

–

–


*Note: Sample names in Table 1 indicate the following:

  • RPA (-): negative control for RPA – UltraPure water was  added instead of DNA to RPA reaction

  • SHERLOCK (-): negative control for LFA detection – water added instead of RPA mixture for detection

  • RNase A (+): RNAse A added instead of Cas13a to mixture for detection

  • RNase A (+) no inhibitor: RNAse A added instead of Cas13a to mixture for detection, with no RNase inhibitor added to reaction mix.

  • synDNA and syncrRNA. These samples serve as a positive control for the whole procedure since they utilize example sequences for testing SHERLOCK (Table 2 in [3]). These parts have also been included in the iGEM Repository by our team.

The same nomenclature has been adapted throughout this notebook.

Next, SHERLOCK LFA detection was carried out according to the “SHERLOCK LFA Protocol” included in the “Experiments” page, which was adapted from [3].


SHERLOCK LFA samples:

  1. RPA (-) + PrymcrRNA1/2* (RPA negative control)

  2. synDNA + syncrRNA (SHERLOCK positive control)

  3. Prymnesium gDNA + PrymcrRNA1

  4. Prymnesium gDNA + PrymcrRNA2

  5. SHERLOCK (-) + PrymcrRNA1/2 (SHERLOCK negative control)

  6. RNase (+)

  7. RNase (+) no inhibitor**


*Note: PrymcrRNA1/2 refers to an equimolar mixture of the two PrymcrRNAs, with a 1:1 ratio of PrymcrRNA1 to PrymcrRNA2. This mixture was used for the negative control to minimize the number of LFA strips needed. Since neither of the individual crRNAs should yield a positive result, a positive outcome for this negative control would indicate a need for further investigation.


**Note: Reaction no. 7 was prepared after it was realized that an RNase inhibitor had been mistakenly included in reaction no. 6, which was intended to be the positive control. The negative result observed led to the hypothesis that the RNase inhibitor might have caused the negative outcome. To test this, reaction 7 consisted of 100 μl assay buffer, 2 μl RNase, and 1.2 μl LFA probe, with the dipstick being directly placed in the solution for detection.


Results


Figure 3: LFA test result 28/06/2024.


Table 2: SHERLOCK LFA samples and results summarized.

Strip number

Input sample name

crRNA added

Result

Comment(s)

1

RPA (-)

PrymcrRNA1/2

Positive

Unexpected positive result for negative control

2

synDNA

syncrRNA

Fully positive, only T-band visible

Expected positive result for positive control

3

Prymnesium gDNA

PrymcrRNA1

Positive


4

Prymnesium gDNA

PrymcrRNA2

Negative


5

SHERLOCK (-)

PrymcrRNA1/2

Negative

As expected

6

RNase (+)

–

Negative

Unexpected negative result for positive control

7

RNase (+) no inhibitor

–

Slightly positive



Conclusions:

  • The results validate that the procedure and all test components function as intended, as evidenced by a strong positive result for the synDNA + syncrRNA positive control and a negative result for the SHERLOCK (-) + PrymcrRNA1/2 negative control.

  • However, an unexpected positive result was observed for the RPA (-) control, an issue previously noted in the fluorescent readout tests (as documented in the SHERLOCK Lab records on 24/06/2024). This suggests a possible interaction between PrymcrRNA1 and one of the RPA primers: GalF or GalR. The negative outcome for the SHERLOCK (-) control further supports the hypothesis that one of the RPA components is responsible for this issue. In future experiments, separate RPA (-) controls should be conducted for PrymcrRNA1 and PrymcrRNA2 to verify preliminary fluorescent readout results indicating that PrymcrRNA1, and not PrymcrRNA2, is causing this problem.

  • It's unusual that reaction 7 did not yield a fully positive result, which could be attributed to its preparation differing from the other reactions (as noted earlier). This reaction should be repeated with identical conditions and incubation as the other samples to ensure consistent results.


[3] Kellner, Max J., Jeremy G. Koob, Jonathan S. Gootenberg, Omar O. Abudayyeh, and Feng Zhang. “SHERLOCK: Nucleic Acid Detection with CRISPR Nucleases.” Nature Protocols 14, no. 10 (October 2019): 2986–3012. https://doi.org/10.1038/s41596-019-0210-2.

01.07. - 07.07

Purpose: The purpose of this experiment was to test the new ModF & ModF and AltF & AltR primers.

We performed RPA using primers that were designed based on those described in the paper [4]. These primer sequences were obtained by the GenomeLab, as detailed in their documentation. To facilitate transcription, the primers were modified by adding a T7 promoter to the 5' end of the forward primer.

The sequences of the primers used were as follows:

Primers "mod"/"M"


PR-RPA-4-F-mod+T7: GAAATTAATACGACTCACTATAGGGAATCATCGAACTTTTGAACGCAACTGG

PR-RPA-4-R-mod: GTAGGCGGCCTACTAGCACGTCGGCACA

 

Primers "alt"/"A"


RPA-alt-F+T7: GAAATTAATACGACTCACTATAGGCTTCCAGGTTCCGCCTGGGAGCATGTTTCTTC

RPA-alt-R: GTACCGGTGGGCGGAAACGCGACGACCTA


These primers have also been added to the iGEM Repository by our team.

Primers were dissolved in water to make a 100 μM stock solution according to the manufacturer's instructions.



Figure 4: Manufacturer’s manual for the Alt and Mod primers.


Samples labeled “Prymnesium gDNA” indicate Prymnesium parvum genomic DNA isolated from our culture. In this experiment, the gDNA sample "NOW5 DNA" (concentration of 164 ng/μl, sample origin is described in AlgaLab documentation). RPA was performed according to previously described procedure.


Table 3: RPA samples summarized.

Sample number

Sample name

Template DNA used for RPA

RPA primers used

1-3

Prymnesium gDNA (Mod)

Prymnesium gDNA

ModF + ModF

4

RPA (-) (Mod)

–

ModF + ModF

5-7

Prymnesium gDNA (Alt)

Prymnesium gDNA

AltF + AltR

8

RPA (-) (Alt)

–

AltF + AltR


The RPA samples were stored at -20°C for use the following day.

Purpose: The purpose of this experiment was to obtain a readout from the RPA reactions conducted on 03/07/2024.


SHERLOCK LFA detection was performed according to the established protocol. However, we did not follow the correct order of adding components as outlined in the Kellner paper [3]. This was an oversight, and care should be taken in future experiments to ensure that components are added in the correct sequence.


SHERLOCK LFA samples:

  1. RPA (-) (Alt) + PrymcrRNA1

  2. RPA (-) (Alt) + PrymcrRNA2

  3. Prymnesium gDNA (Alt) + PrymcrRNA1

  4. Prymnesium gDNA (Alt) + PrymcrRNA2

  5. RPA (-) (Mod) + PrymcrRNA1

  6. RPA (-) (Mod) + PrymcrRNA2

  7. Prymnesium gDNA (Mod) + PrymcrRNA1

  8. Prymnesium gDNA (Mod) + PrymcrRNA2

  9. RNase (+)

  10. RNase (+) no inhibitor


Results


Figure 5: LFA test result 05/07/2024.


Table 4: SHERLOCK LFA samples and results summarized.

Strip number

Input sample name

crRNA added

Result

Comment(s)

1

RPA (-) (Alt)

PrymcrRNA1

Negative


2

RPA (-) (Alt)

PrymcrRNA2

Negative


3

Prymnesium gDNA (Alt)

PrymcrRNA1

Negative


4

Prymnesium gDNA (Alt)

PrymcrRNA2

Negative


5

RPA (-) (Mod)

PrymcrRNA1

Negative


6

RPA (-) (Mod)

PrymcrRNA2

Negative


7

Prymnesium gDNA (Mod)

PrymcrRNA1

Negative


8

Prymnesium gDNA (Mod)

PrymcrRNA2

Negative


9

RNase (+)

–

Negative


10

RNase (+) no inhibitor

–

Negative




Conclusions:

  • All tests returned negative results, indicating that Prymnesium DNA was not detected. This outcome contrasts with previous experiments where negative controls showed unexpected positive results, suggesting that the issue of false positives has been resolved by using different primer pairs.

  • However, Prymnesium gDNA has also not been detected This might be due to a low concentration of the target DNA – further testing is required.

  • The positive control with RNase did not yield a positive result, regardless of the presence of an inhibitor. This could suggest that the RNase used does not cleave the reporter as expected.

  • For future experiments, the synDNA samples will always be included as a positive control since the RNase positive control has proven unreliable.


[4] Luo, Huang, and Jiang, “Establishment of Methods for Rapid Detection of Prymnesium Parvum by Recombinase Polymerase Amplification Combined with a Lateral Flow Dipstick.”

08.07. - 14.07

Purpose:

The purpose of this experiment was to evaluate the usefulness of three sets of primers for PCR amplification of Prymnesium gDNA, intended for use as input in future LFA (Lateral Flow Assay) tests.

This was done to address previously encountered issues with the low concentration of Prymnesium gDNA. By PCR-amplifying the detected fragment, we aimed to obtain a higher concentration of the target DNA for more reliable testing and to enable precise quantification of its concentration.

Direct measurement of gDNA concentration is unreliable because our algal cultures were established from an environmental sample taken from a water body affected by Prymnesium parvum blooms, meaning they are not pure cultures and may contain DNA from various other organisms. Consequently, the gDNA isolated from these cultures likely includes DNA from these other organisms in addition to Prymnesium parvum. When DNA concentration is measured using a NanoDrop Microspectrophotometer, it quantifies all DNA present in the sample, of which Prymnesium parvum DNA might constitute only a small percentage. 

PCR was carried out using 3 sets of primers:

  • KAC39 primers:

    • Forward: ATCATTACCGGTCTTTCCACCCAC

    • Reverse: GAGTCCAATGGTGCGCGC

  • ITS primers:

    • ItsF: TCCGTAGGTGAACCTGCGG

    • ItsR: TCCTCCGCTTATTGATATGC

  • Gal primers:

    • Gal_T7: GAAATTAATACGACTCACTATAGGGTGTCTGCCGTGGACTTAGTGCT

    • GalR: ATGGCACAACGACTTGGTAGG

The origins of these sequences have been described in the GenomeLab documentation. The sequences themselves have been added to the iGEM Repository by our team.

PCR and post-PCR clean-up were carried out according to the “PCR on Prymnesium parvum genome Protocol” included in the “Experiments” page, with the exception that a gradient of primer annealing temperatures was used: 55°C, 60°C, 65°C and 70°C to assess temperature where we get the most pure amplicon.

A mix of the “NOW 5.1” and “Maj1” samples of Prymnesium gDNA were used (sample origin is described in AlgaLab documentation).

Anticipated PCR product lengths were:

  • 157 bp for Galluzzi RPA primers

  • 672 bp for KAC39 primers

  • 760 bp for ITS primers

Results

Figure 6: PCR result from 08/07/2024.


Note: The gel did not run evenly, which caused the bands for the KAC39 primers to appear higher than their actual position. For future experiments, ensure that a ladder is included on both sides of the gel to avoid this issue.


Observations:

  • The Galluzzi RPA primers failed to amplify any product.

  • The ITS primers did amplify a product, but multiple bands were observed, indicating non-specific amplification.

  • The KAC39 primers, at annealing temperatures of 65°C and 70°C, produced a single product of the correct length. This product was successfully purified and will be used in future experiments.

The measured concentration of the obtained KAC39 PCR product (pooled samples from 65°C and 70°C annealing temperatures) was 98 ng/μl.


Conclusions:

  • The KAC39 primers are the most effective for this procedure and will be used for all subsequent experiments at 70°C annealing temperature.

Purpose: The purpose of this experiment was to evaluate the LFA procedure using PCR-amplified Prymnesium gDNA as the input.

PCR using the Gal primers was carried out by the AlgaLab and its results are included in their documentation.

This experiment utilized the RPA reactions performed by the SHERLOCK Lab on 28/06/2024. Table 5 summarizes the components of these samples, however the numbers and formatting has been changed in relation to the original in the SHERLOCK Lab documentation.


Table 5: RPA samples summarized.

Sample number

Sample name

Template DNA used for RPA

RPA primers used

1

Gal PCR 200 nM

DNA PCR P+Maj2* (200 nM)

GalF + GalR

2

Gal PCR 200 pM

DNA PCR P+Maj2* (200 pM)

GalF + GalR

3

Gal PCR 200 fM

DNA PCR P+Maj2* (200 fM)

GalF + GalR

4

RPA (-)

–

GalF + GalR

5

synDNA

synDNA

SynF + SynR


*DNA PCR P+Maj2 refers to a sample of the PCR-amplified Prymnesium gDNA using Gal primers. Since the reaction was performed by the AlgaeLab, this is their naming convention. Concentrations of this PCR product after clean-up are given in brackets.

SHERLOCK LFA detection was carried out according to the established protocol.

SHERLOCK LFA samples:

  1. RPA (-) + PrymcrRNA1

  2. RPA (-) + PrymcrRNA2

  3. Gal PCR 200 nM + PrymcrRNA1

  4. Gal PCR 200 pM + PrymcrRNA1

  5. Gal PCR 200 fM + PrymcrRNA1

  6. Gal PCR 200 nM + PrymcrRNA2

  7. Gal PCR 200 pM + PrymcrRNA2

  8. Gal PCR 200 fM + PrymcrRNA2

  9. synDNA + syncrRNA

Results


Figure 7: LFA test result 08/07/2024.


Table 6: SHERLOCK LFA samples and results summarized.

Strip number

Input sample name

crRNA added

Result

Comment(s)

1

RPA (-)

PrymcrRNA1

Positive

Unexpected positive result for negative control

2

RPA (-)

PrymcrRNA2

Negative

Expected negative result for negative control

3

Gal PCR 200 nM

PrymcrRNA1

Positive

Result cannot be reliably interpreted

4

Gal PCR 200 pM

PrymcrRNA1

Positive

Result cannot be reliably interpreted

5

Gal PCR 200 fM

PrymcrRNA1

Positive

Result cannot be reliably interpreted

6

Gal PCR 200 nM

PrymcrRNA2

Positive


7

Gal PCR 200 pM

PrymcrRNA2

Positive

Primary LOD is between 200 pM and 200 fM

8

Gal PCR 200 fM

PrymcrRNA2

Negative

9

synDNA

syncrRNA

Fully positive, only T-band visible



Conclusions:

The results of this experiment align with the observations made in the fluorescent readout tests by the SHERLOCK Lab (24, 28/06/2024:

  • The combination of PrymcrRNA1 and Gal primers causes false positives, confirming previous concerns about its specificity. Therefore, results of PCR-amplified Prymnesium DNA for strips 3-5 cannot reliably be interpreted. As a result, PrymcrRNA1 will not be used in combination with Gal primers in future experiments.

Positive results for PrymcrRNA2 with Gal primers were observed for both 200 nM and 200 pM concentrations, but not for the 200 fM concentration. This suggests that the Limit of Detection (LOD) for this primer and crRNA combination likely falls between 200 pM and 200 fM.

29.07. - 04.08

Purpose: The purpose of this experiment was to repeat the SHERLOCK reaction conducted on 19/07/2024 to confirm the previously obtained results.


SHERLOCK samples:

  1. L1 Mod-Gal + PrymcrRNA1

  2. Szczecin  Mod-Gal + PrymcrRNA1

  3. RPA (-) Mod-Gal + PrymcrRNA1

  4. KAC39 PCR (480 nM) Mod-Gal + PrymcrRNA1

  5. synDNA + syncrRNA


Figure 12: LFA test results 29/07/2024.


Table 13: SHERLOCK LFA samples and results summarized.

Strip number

Input sample name

crRNA added

Result

Comment(s)

1

L1 Mod-Gal

PrymcrRNA1

Positive

T-line less intense than C-line

2

Szczecin Mod-Gal

PrymcrRNA1

Positive

T-line more intense than C-line

3

RPA (-) Mod-Gal

PrymcrRNA1

Negative


4

KAC39 PCR (480 nM) Mod-Gal

PrymcrRNA1

Positive

T-line more intense than C-line

5

synDNA

syncrRNA

Fully positive

Only T-line visible


Conclusions:

Results remained consistent with the results from 22/07/2024. The test successfully detected Prymnesium gDNA in samples isolated from our algal culture ("Szczecin" samples) as well as in samples directly obtained from a water body affected by Prymnesium parvum blooms ("L1" samples). Indicating that our LFA test can detect the Prymnesium parvum’s genomic DNA obtained directly from water samples.

Purpose: The purpose of this experiment was to compare the effectiveness of incubating the RPA and SHERLOCK reactions using body heat versus thermocycler incubation. This was done to assess whether the reaction can be effectively carried out by the user holding it in their hand.


RPA and SHERLOCK reactions were carried out according to the established protocol. Each of the five RPA reactions was prepared in duplicate: one set was incubated in a thermocycler, and the other set was incubated in the palm of a hand. Post-RPA samples that were hand-incubated were also hand-incubated for the SHERLOCK reaction, while those incubated in the thermocycler continued to be incubated in the thermocycler for the SHERLOCK reaction.


Table 14: RPA samples summarized.

Sample number

Sample name

Template DNA used for RPA

RPA primers used

1, 6

KAC39 PCR (480 nM)

KAC39 PCR (480 nM)

ModF + GalR

2, 7

KAC39 PCR (200 fM)

KAC39 PCR (200 fM)

ModF + GalR

3, 8

Szczecin

Szczecin

ModF + GalR

4, 9

L1

L1

ModF + GalR

5, 10

RPA (-)

–

ModF + GalR


SHERLOCK samples:

  1. KAC39 PCR (480 nM) + PrymcrRNA1

  2. KAC39 PCR (200 fM) + PrymcrRNA1

  3. Szczecin + PrymcrRNA1

  4. L1 + PrymcrRNA1

  5. RPA (-) + PrymcrRNA1


Figure 13: LFA test results from 29/07/2024. Samples incubated using the thermocycler are labeled in red, while those incubated by hand (palm of the hand) are denoted in black.


Table 15: SHERLOCK LFA samples and results summarized.

Strip number

Input sample name

crRNA added

Result

Comment(s)

1 (black)

KAC39 PCR (480 nM)

PrymcrRNA1

Positive

T-line more intense than C-line

2 (black)

KAC39 PCR (200 fM)

PrymcrRNA1

Negative


3 (black)

Szczecin

PrymcrRNA1

Negative

Extremely faint T-line visible, but despite this interpreted as negative result

4 (black)

L1

PrymcrRNA1

Negative


5 (black)

RPA (-)

PrymcrRNA1

Negative

T-line faint

1 (red)

KAC39 PCR (480 nM)

PrymcrRNA1

Positive

T-line more intense than C-line

2 (red)

KAC39 PCR (200 fM)

PrymcrRNA1

Negative

Extremely faint T-line visible, but despite this interpreted as negative result

3 (red)

Szczecin

PrymcrRNA1

Negative

Extremely faint T-line visible, but despite this interpreted as negative result

 4 (red)

L1

PrymcrRNA1

Negative


5 (red)

RPA (-)

PrymcrRNA1

Negative



Conclusions:

The test results for both thermocycler and hand incubation methods do not show significant differences, suggesting that hand incubation is as effective as thermocycler incubation for this protocol. However, only test 1 one the tested conditions yielded a positive result, indicating that there may be issues with either the RPA reaction reagents or the DNA templates used in the other tests, since other conditions have been positive in previous tests. This inconsistency in results points to the need for further optimization or troubleshooting of the reaction components to ensure reliable outcomes across all tests.

Purpose: The purpose of this experiment was to determine the final Limit of Detection (LOD) for our LFA test.


The Limit of Detection (LOD) was determined as the lowest concentration of PCR-amplified Prymnesium gDNA for which the test result remained positive, indicated by the presence of a visible T-line. For this experiment, samples were incubated in a PCR thermocycler.


Table 16: RPA samples summarized.

Sample number

Sample name

Template DNA used for RPA

RPA primers used

1

200 nM

KAC39 PCR (200 nM)

ModF + GalR

2

20 nM

KAC39 PCR (20 nM)

ModF + GalR

3

2 nM

KAC39 PCR (2 nM)

ModF + GalR

4

200 pM

KAC39 PCR (200 pM)

ModF + GalR

5

40 pM

KAC39 PCR (40 pM)

ModF + GalR

6

20 pM

KAC39 PCR (20 pM)

ModF + GalR

7

10 pM

KAC39 PCR (10 pM)

ModF + GalR

8

5 pM

KAC39 PCR (5 pM)

ModF + GalR

9

2 pM

KAC39 PCR (2 pM)

ModF + GalR

10 

1 pM

KAC39 PCR (1 pM)

ModF + GalR

11

200 fM

KAC39 PCR (200 fM)

ModF + GalR

12

20 fM

KAC39 PCR (20 fM)

ModF + GalR

13

2 fM

KAC39 PCR (2 fM)

ModF + GalR

14

L1

L1

ModF + GalR

15

Szczecin

Szczecin

ModF + GalR

16

RPA (-)

–

ModF + GalR

17

synDNA

synDNA

SynF + SynR


Figure 14: LFA test results from 30/07/2024.


Conclusions:

  • Tests 1-13 were conducted using progressively decreasing amounts of Prymnesium parvum DNA, as reflected by the corresponding decrease in test band intensity. By comparing these with test 16, a negative control, it can be estimated that the limit of detection (LOD) for our Sherlock assay is approximately 10 pM, as indicated by test 8. However, this conclusion is somewhat subjective, given that band intensity was not quantified. To obtain a more precise and reliable LOD determination, this test should be repeated.

  • The synDNA positive control (stripe 17) yielded a positive result. However, the test performed on older RPA samples previously provided a more definitive positive result (C-line was not visible). This suggests there may be inefficiencies in the RPA procedure or potential contamination of its reagents, which could be affecting the consistency of the results.

The tests for both the L1 (water DNA isolation) and Szczecin samples returned negative results, indicating that Prymnesium parvum DNA was not detected in these samples. This is likely due to unidentified issues within the procedure, possibly linked to the RPA step or sample handling.

Purpose: The purpose of this experiment was to test out the one-pot Sherlock procedure using proportions and concentrations similar to those in the two-pot procedure instead of ones suggested in Kellner et al.


Half of the tested samples were incubated in the palm of a hand and half in a thermocycler set to 37°C. Different incubation times were also tested, some reactions were incubated for 30 minutes, some for 60 min.


Table 23: 1-pot Sherlock mix components..

Component

Volume x1 [μl]

One-pot mix (volume x4.5) [μl]

RPA primer F 

2.24

10.08

RPA primer R 

2.24

10.08

RPA rehydration buffer

7.34

33.03

LwaCas13a in SB DTT

2

9

LFA sensor

0.2

0.9

RNAse inhibitor

1

4.5

rNTP mix

0.8

3.6

T7 polymerase (5U/μl)

0.5

2.25

MgCl2

0.18

0.81

MgAc

1.25

5.625

Sum

17.75

79.875


Procedure:

  • Two one-pot mixes were prepared, one with ModF + GalR RPA primers, one with syn RPA primers.

  • 4.5 μl of crRNA (PrymcrRNA 1 or syn) was added.

  • 75 μl of a mix was added per RPA reaction aliquot. Such reaction mix was pipetted up and down until the lyophilizate was dissolved.

  • 18.75 μl of reaction mix was transferred per PCR tube.

  • 1.25 μl of DNA (PrymcrRNA 1 or syn) was added per PCR tube


Table 24: 1-pot Sherlock samples summarized.

Sample number

Sample name

Template DNA used for RPA

RPA primers used

1

KAC PCR thermocycler 60 min

KAC PCR

ModF + GalR

2

KAC PCR thermocycler 30 min

KAC PCR

ModF + GalR

3

KAC PCR hand 60 min

KAC PCR

ModF + GalR

4

KAC PCR hand 30 min

KAC PCR

ModF + GalR

5

synDNA thermocycler 60 min

synDNA

SynF + SynR

6

synDNA thermocycler 30 min

synDNA

SynF + SynR

7

synDNA hand 60 min

synDNA

SynF + SynR

8

synDNA hand 30 min

synDNA

SynF + SynR


Figure 17: LFA test results from 1/08/2024.


Table 25: SHERLOCK LFA samples and results summarized.

Strip number

Input sample name

crRNA added

Result

Comment(s)

1

KAC PCR thermocycler 60 min

PrymcrRNA1

Negative


2 

KAC PCR thermocycler 30 min

PrymcrRNA1

Negative


3

KAC PCR hand 60 min

PrymcrRNA1

Negative


4

KAC PCR hand 30 min

PrymcrRNA1

Negative


5

synDNA thermocycler 60 min

syncrRNA

Negative


6

synDNA thermocycler 30 min

syncrRNA

Negative


7

synDNA hand 60 min

syncrRNA

Negative


8

synDNA hand 30 min

syncrRNA

Negative



Conclusions:

Since all of the tests gave a negative result, there is a chance that the 1-pot procedure described in Kellner et al. was inadequate or that the alterations made for this experiment were not suitable.

Purpose: The purpose of this experiment was to determine if performing the LFA detection of Prymnesium parvum in half of the standard time would produce significant results.

Labeling of the samples refers to the RPA incubation times. When RPA time was reduced, the Sherlock reaction time was also half the standard protocol time.


Table 26: RPA samples summarized.

Sample number

Sample name

Template DNA used for RPA

RPA primers used

1

KAC PCR thermocycler 30 min

KAC PCR

ModF + GalR

2

KAC PCR thermocycler 15 min

KAC PCR

ModF + GalR

3

KAC PCR hand 30 min

KAC PCR

ModF + GalR

4

KAC PCR hand 15 min

KAC PCR

ModF + GalR

5

synDNA thermocycler 30 min

synDNA

SynF + SynR

6

synDNA thermocycler 15 min

synDNA

SynF + SynR

7

synDNA hand 30 min

synDNA

SynF + SynR

8

synDNA hand 15 min

synDNA

SynF + SynR


Sherlock samples:

  1. KAC PCR thermocycler 30 min + PrymcrRNA1

  2. KAC PCR thermocycler 15 min + PrymcrRNA1

  3. KAC PCR hand 30 min + PrymcrRNA1

  4. KAC PCR hand 15 min + PrymcrRNA1

  5. synDNA thermocycler 30 min + syncrRNA

  6. synDNA thermocycler 15 min + syncrRNA

  7. synDNA hand 30 min + syncrRNA

  8. synDNA hand 15 min + syncrRNA


Figure 18: LFA test results from 1/08/2024.


Table 27: SHERLOCK LFA samples and results summarized.

Strip number

Input sample name

crRNA added

Result

Comment(s)

1

KAC PCR thermocycler 30 min

PrymcrRNA1

Negative

Extremely faint T-line visible, but despite this interpreted as negative result

2 

KAC PCR thermocycler 15 min

PrymcrRNA1

Negative

Extremely faint T-line visible, but despite this interpreted as negative result

3

KAC PCR hand 30 min

PrymcrRNA1

Positive


4

KAC PCR hand 15 min

PrymcrRNA1

Negative

Extremely faint T-line visible, but despite this interpreted as negative result

5

synDNA thermocycler 30 min

syncrRNA

Positive


6

synDNA thermocycler 15 min

syncrRNA

Positive


7

synDNA hand 30 min

syncrRNA

Positive


8

synDNA hand 15 min

syncrRNA

Positive



Conclusions:

A positive result was obtained after a shortened incubation time for the synDNA samples, but this was not observed in all samples containing Prymnesium parvum DNA. This inconsistency might be due to the poor quality of the original DNA, as the test was conducted on KAC39 PCR products, which showed blurred bands on the PCR gel. However, based on preliminary observations, the T-band intensity in the synDNA samples did not significantly decrease despite the shortened incubation time. This suggests that the incubation period could potentially be reduced, allowing for quicker test results.

That said, further experiments are needed to confirm whether the incubation time can indeed be shortened to 15 minutes. Additionally, a detailed investigation should be conducted to determine how the reduced incubation time affects the limit of detection (LOD).

Algae Lab


The main purpose of the Algae lab was to create and maintain Prymnesium parvum laboratory culture in order to isolate DNA of the golden algae, which was necessary for further experiments with the SHERLOCK system. Furthermore, the lab aimed to optimise culture conditions by testing different sea salt concentrations and lighting conditions.

06-12.05

Reviewing the Occupational Safety and Health (BHP) Principles and On-the-Job Training.

The medium preparation protocol is also available on the Experiments page under the F/2 medium preparation protocol.

F/2 is a widely utilised medium specifically designed for cultivating coastal marine algae, although it also works well for freshwater species.

Prior to preparing the medium, 100x concentrated stock solutions of each medium ingredient were made. Table 1 shows the final concentrations.

Table 1: F/2 medium ingredients.

Ingredient name

Final concentration [mg/L]

ZnSO4 · 7 H2O 22
CoCl2 · 6 H2O 10
MnCl­2 · 4 H2O 180
Na2Mo4·2 H2O 6
NaNO3 75
NaH2PO4 · 2 H2O 56.5
Na2EDTA 4160
FeCl­3 · 6 H2O 3150
CuSO4 · 5 H2O 10

F/2 medium also contains sea salt, which is added after mixing all the other ingredients. The default concentration of sea salt is 16 g/L.

Total volume of 800 ml was prepared, which contains:

  • 8 ml of each of 9 stocks concentrated 100x (72 ml in total)
  • 728 ml of distilled water
  • 12.8 g of sea salt (16 g/L)

The medium was divided into two bottles: one containing 300 ml and the other 400 ml. Since the total volume was too large for sterilisation, 100 ml was discarded. To prepare F/2 agar medium for future cultures on plates, 3 g of agar was added to the 300 ml portion. Both portions were then sterilised using a microwave autoclave.

Vitamin stock solutions

1000x concentrated stock solutions of vitamins B1, B7, B12 were prepared, each with a volume of 6 ml. Table 2 shows the final concentration of each vitamin solution:

Table 2: Final concentration of vitamin solutions.

Vitamin

Concentration [mg/L]

B1 100
B7 0.5
B12 0.5

The stocks were sterilised by filtration with a membrane filter.

Sterilisation procedure:

  • Previously prepared vitamin solution was taken in sterile conditions with a syringe and a needle.
  • The needle was removed and a membrane filter was attached to the syringe.
  • The solution was filtered to a new sterile tube and secured.

The vitamins cannot be added directly to the F/2 medium, as they degrade under the extreme conditions of the sterilisation process. They are added separately to every new liquid culture. In this notebook, the combination of vitamins B1, B7, B12 will be referred to as “the vitamins”.

13-19.05

Water samples were collected from the Czernica reservoir in Lower Silesia, Poland. This water body is directly connected to the main channel of the Oder River and has experienced recurring Prymnesium parvum blooms since the Oder River disaster in 2022.

Three samples of 1.5 L were collected from three distinct places:

1. Middle of the lake


Figure 1. Environmental sample collection site (middle of the lake).

2. Bay area


Figure 2. Environmental sample collection site (bay area).

3. The outlet to the Oder River


Figure 3. Environmental sample collection site (the outlet to the Oder River).

A sample of river mud was also collected from the same place as sample no. 2. For each place, there is a sample containing vitamins (W) and a sample with no vitamins added (BW). Therefore, the names of the samples are: 1W, 1BW, 2W, 2BW, 3W, 3BW.

1L of each water sample was transferred to a separate water bottle, and vitamins B1, B7, and B12 were added to the cultures. Vitamins were purchased from the pharmacy and were in pill form that contained only the given vitamin (not multivitamins). Before adding to the water sample, they were ground in a mortar. Table 4 shows the vitamin content in the water samples.

Table 4: Vitamin content [mg] in Oder water samples.

Water sample B1 B7 B12
1W 33 10 0
2W 33 10 0
3W 100 10 0.5

Two centrifuged samples of Prymnesium parvum were obtained from Gdańsk. The samples were obtained in the form of sediments. One of the samples was fully utilised for DNA isolation, while the other was used to establish liquid cultures.

Purpose: Observation of Oder water samples and received Prymnesium parvum samples and identification of Prymnesium parvum based on morphological features.

This protocol is also available on the Experiments page under the Preparing liquid algal cultures samples for imaging protocol.

Preparation of a Sample for Imaging
  • Transfer 1-1.5 mL of water/culture sample into Eppendorf tube.
  • Centrifuge using table-top centrifuge at 2000 rpm for 1 minute.
  • Discard supernatants.
  • Resuspend the pellet in the small volume left in the tube after discarding the supernatant.
  • Apply sample on glass slide, cover with coverslip.
  • Image sample using the 40x air objective.
  • Use the TopView Software.
  • Use fluorescence to image chloroplasts.


Figure 4. 2W Oder water sample – microscopic image.


Figure 5. 1W Oder water sample – microscopic image.


Figure 6. 1BW Oder water sample – microscopic image.


Figure 7. 2BW Oder water sample – microscopic image.


Figure 8. 3BW Oder water sample – fluorescent microscopic image.


Figure 9. Prymnesium parvum Gdańsk sample – microscopic image.

Notes
  • We can add some glycerol to a sample (1:1 with water, for example) to slow down algae movements to make imaging easier.
  • We could also glue the coverslip to the slide next time.
  • When saving images, save them to a folder on the computer and only later transfer everything to a disk/pendrive.

This protocol is also available on the Experiments page under the Setting up liquid algal cultures protocol.

All liquid cultures were prepared under sterile conditions using sterilised tools and culture media. After preparation, the cultures were sealed and placed in the growth chamber. This protocol applies to all future liquid cultures as well.

Oder Water Liquid Cultures

Six liquid algal cultures were prepared from the Oder water samples in previously sterilised glass bottles. The volumes of the cultures were 80 ml, 40 ml, and 10 ml. Each culture contained Oder water (or river mud) and the F/2 medium in a 1:1 ratio.

Table 4: Characteristics of the liquid cultures from Oder water.

Culture volume 80 ml 40 ml 10 ml
Type of inoculated sample 1W 2W River mud
1BW 2BW 3BW

The Oder water samples already contain vitamins, therefore there was no need for extra enrichment with the vitamins.

Gdańsk Liquid Cultures

20 µl of Prymnesium parvum sample was transferred into a 12-well plate containing 3 ml of F/2 medium in 4 wells. Serial dilutions were made.

The rest of the sample was split and transferred into two flasks that contain 20 ml of F/2 medium with the addition of the vitamins. Culture names: Gdańsk 1, Gdańsk 2.

This protocol is also available on the Experiments page under the Establishing algae cultures on solid medium protocol.

All plate cultures were prepared under sterile conditions using sterilised tools and media. After preparation, the cultures were secured and placed in the growth chamber. This protocol applied to all future plate cultures as well.

Six culture plates with sterilised and cooled F/2 agar medium were prepared. Three of them were inoculated with 100 µl of water samples 1BW, 2BW, and 3BW, and the remaining three were inoculated with 100 µl of water samples 1W, 2W, and 3W.

Purpose: Collecting DNA of Prymnesium parvum in the largest possible quantity.

The isolation protocol is available on the Experiments page under the Algal DNA isolation with QIAwave DNA blood and tissue kit protocol.

DNA was isolated from 2W and Gdańsk 1 liquid cultures. Total culture volumes used for the isolation:

  • Gdańsk 1 – 6 ml
  • 2W – 66 ml

The isolation was performed with the QIAwave DNA Blood & Tissue Kit (Qiagen), with some modifications to the manufacturer's protocol: Purification of Total DNA from Animal Tissues.

Steps:
  • The cultures were split into 2 ml samples and centrifuged (5 min, 14,000 rpm). Supernatants were discarded, and pellets were collected.
  • 20 µl of proteinase K and 180 µl of ATL buffer were added to each sample. The samples were mixed thoroughly by vortexing.
  • The samples were incubated at 56°C for 7 hours with shaking.
  • A pre-mix of 96% ethanol and AL buffer was prepared.
  • After incubation, 400 µl of the ethanol-AL buffer pre-mix was added to each sample and mixed thoroughly by vortexing.
  • For each sample, a DNeasy Mini Spin Column was put in a 2 ml Waste Tube provided in the isolation kit.
  • The mixtures from step 5 were transferred into the DNeasy Spin Columns. The samples were centrifuged at 8000 rpm for 1 min. The flow-through was discarded.
  • 500 µl of AW1 buffer was added to the columns, followed by centrifugation at 8000 rpm for 1 min. The flow-through was discarded.
  • 500 µl of AW2 buffer was added to the columns, followed by centrifugation at 14,000 rpm for 3 min. The flow-through and Waste Tubes were discarded.
  • The columns were put in 2 ml tubes, and 200 µl of AE buffer was pipetted directly onto the membrane of the column.
  • The samples were incubated at room temperature for 1 min and centrifuged at 8000 rpm for 1 min.

As a result, 6 DNA solutions of 200 µl were obtained. Half of them come from our Prymnesium parvum cultures (K samples – from “Kraków”), and the other half come from Gdańsk (G samples – from “Gdańsk”). DNA concentration was measured with a NanoDrop spectrophotometer.

Table 5: Concentration of the isolated DNA.

Sample name DNA concentration [ng/µl] A260/A280
K1 6.5 1.47
K2 4.8 1.50
K3 5.8 1.34
G1 8.2 1.64
G2 14.9 1.46
G3 19.5 1.09

Legend:

  • K1, K2, K3 – DNA isolated from Oder water liquid cultures
  • G1, G2, G3 – DNA isolated from Gdańsk liquid cultures

Purposes
  • Confirming that the isolated DNA contains the ITS2 sequence, which is specific to Prymnesium parvum. The sequence is 132 bp in length.
  • Determining the optimal primer concentration for the reaction.

The PCR protocol is also available on the Experiments page under the PCR reaction on DNA isolated from algae cultures protocol.

Primers Sequences
  • GalF 5' TGTCTGCCGTGGACTTAGTGCT 3'
  • GalR 5' ATGGCACAACGACTTGGTAGG 3'

The PCR reaction was performed on two DNA samples named Kz (DNA isolated from Oder liquid cultures) and Gz (DNA isolated from Gdańsk liquid cultures), which were previously concentrated in the SHERLOCK lab. DNA concentration:

  • Kz – 170 ng/µl
  • Gz – 32.5 ng/µl

Reaction volume was 20 µl. The reaction was performed using two different primer concentrations.

Preparation of Primer Solutions
  • Concentration 200 nM: Primers FOR and REV were pre-diluted 10x in one tube. 1 µl of each primer was added to 8 µl of pure water. Then 0.8 µl of the primers mixture was added to the reaction mixture.
  • Concentration 400 nM: Primers FOR and REV were separately pre-diluted. 1 µl of each primer was added to 9 µl of pure water in two separate tubes. Then 0.8 µl of each primer was added to the reaction mixture.

Table 6: PCR samples composition. Primers concentration 200 nM. Reaction volume = 20 µl

PCR reagent Volume [µl]
Sample Gz Sample Kz
DNA template 2 0,5
PCR Mix (A&A Biotechnology) 10 10
Primers mix 0,8 0,8
Water 7,2 8,7

Table 7: PCR samples composition. Primers concentration 400 nM. Reaction volume = 20 µl

PCR reagent Volume [µl]
Sample Gz Sample Kz
DNA template 2 0,5
PCR Mix (A&A Biotechnology) 10 10
FOR primer 0,8 0,8
REV primer 0,8 0,8
Water 6,4 7,9

Table 8: PCR Reaction Conditions.

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 98 30
Denaturation 98 10
Annealing 67 60
Elongation 72 5
Final elongation 72 300

Number of cycles: 40

DNA Electrophoresis of the PCR Product

Electrophoresis was conducted on a 2% agarose gel at 85 V for 45 minutes. A total of 5 µl of each PCR product was loaded into the gel wells. Two distinct DNA standards were used for reference: the GeneRuler 1kb DNA Ladder and the O'GeneRuler DNA Ladder Mix.


Figure 10. Gel electrophoresis of the PCR product – result.

Legend:
  • O'GeneRuler DNA Ladder Mix
  • Gz primers 200 nM
  • Gz primers 400 nM
  • Kz primers 200 nM
  • Kz primers 400 nM
  • GeneRuler 1kb DNA Ladder Mix
Conclusions

Samples Gz and Kz contain the ITS2 sequence of 132 bp, with clear bands visible between the 200 bp and 100 bp markers. No specific product was observed in row 2, likely due to an error during the preparation of the reaction mix. Based on these results, it can be concluded that the algal DNA isolated on 21/05/2024 contains Prymnesium parvum genomic DNA.

There were no significant differences in product visibility across the different primer concentrations tested, so a concentration of 200 nM will be used for future reactions.

Preparation of Isolated DNA for Sequencing
  • DNA isolated from the 2W culture was concentrated.
  • 250 µl of the precipitation buffer was added to 250 µl of DNA.
  • The sample was centrifuged at 14,000 rpm for 10 minutes.
  • The supernatant was discarded.
  • The pellet was dried in an open tube for 20 minutes.
  • The DNA pellet was suspended in 30 µl of ultrapure water.
  • DNA concentration was measured: 33.9 ng/µl.
  • The primers used in the previous PCR reaction were diluted to a concentration of 5 µM in 20 µl of ultrapure water, following the manufacturer’s guidelines.
  • The samples containing the PCR products and primers were then secured and sent to Genomed S.A. for sequencing.

PCR with KAC 39 Primers

Purpose: Amplification of a specific fragment of Prymnesium parvum genome that contains the ITS2 sequence. The fragment length is about 700 bp. To achieve this, KAC 39 primers, complementary to the desired DNA fragment, were designed.

KAC 39 Primers Sequences:

  • FOR: 5' ATCATTACCGGTCTTTCCACCCAC 3'
  • REV: 5' GAGTCCAATGGTGCGCGC 3'

The PCR reaction was performed on two DNA samples named Kz (DNA isolated from Oder liquid cultures) and Gz (DNA isolated from Gdańsk liquid cultures), which were previously concentrated in the SHERLOCK lab. DNA concentrations were as follows:

  • Kz: 170 ng/µl (11 samples)
  • Gz: 32.5 ng/µl (2 samples)

The primers’ initial solution (100 µM) was diluted twice: 10x and 20x to the final concentration of 500 nM:

  • First dilution (10x): 2 µl + 2 µl + 16 µl (pure water)
  • Second dilution (20x): 1 µl + 19 µl (reaction mix)

Table 9. PCR samples composition. Reaction volume = 20 ul

PCR reagent Volume [µl]
Sample Gz Sample Kz
DNA template 2 0,5
PCR Mix (A&A Biotechnology) 10 10
Primers mix 1 1
Water 7 8,5

Table 10: PCR Reaction Conditions

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 98 30
Denaturation 98 10
Annealing 65 30
Elongation 72 60
Final Elongation 72 120

Number of Cycles: 40

Gel Electrophoresis of the PCR Product

Electrophoresis was conducted using a 2% agarose gel, run at 85 V for 45 minutes. 8 µl of each PCR product was loaded into the gel wells. Two DNA standards were used: GeneRuler 1 kb DNA Ladder and O'GeneRuler DNA Ladder Mix.


Figure 11. Gel Electrophoresis of the PCR Products – Results.

  • 1 – O'GeneRuler DNA Ladder Mix
  • 2 - 3 – DNA template Kz
  • 4 - 14 – DNA template Gz
  • 15 – GeneRuler 1 kb DNA Ladder
Conclusions

No specific product was obtained. Blurred stripes visible at the bottom of the gel are probably primer dimers. Optimization of PCR conditions is necessary.

20-26.05

F/2 Medium Preparation

The medium preparation protocol is also available on the Experiments page under the F/2 Medium Preparation Protocol.

The F/2 medium was prepared by using previously made 100x concentrated stocks. The total medium volume: 400 ml, which contains:

  • 4 ml of each of 9 stocks, 36 ml in total
  • 364 ml of distilled water
  • 6.4 g of sea salt (16 g/L)

After mixing all the ingredients, the medium was sterilised with a microwave autoclave.

Plate Cultures – Microscopic Screening

Algal plate cultures made 13/05 were observed under the microscope.

Notes
  • The brown areas are mostly diatoms, the green spots contain organisms we are more interested in.
  • Morphology of the organisms within the green spots varies between the plates and often also within one plate. For example, some are more round, and some more longitudinal.
Imaging Difficulties:
  • The microscope is not fully tailored toward the shape of our plates. Hence the plates sometimes keep moving as they are being scanned, requiring frequent image sharpening.
  • The agar is quite thick in certain places.
  • There is a need to readjust the image sharpness when switching from microscope view to the computer screen.
  • At times, it was nearly impossible to clearly see the large colonies of organisms within the green areas.

Our instructor, Dr Paweł Jedynak, suggests creating a large-volume liquid culture to reduce the need for frequent algal culture passages and to have a backup culture in case issues arise with the others. The algae are expected to grow very slowly, which is why a high volume is recommended, likely in a dimly lit environment.

Another suggestion is that we create a culture in a bottle and place it in a dimly lit place, similar to the Chlamydomonas cultures, to create a sustainable culture.

Most of the plate cultures did not contain Prymnesium parvum or other organisms with similar morphological characteristics. The 1W plate was the only one on which a colony potentially identifiable as Prymnesium parvum was observed.


Figure 12. 1W plate culture – microscopic image.

New Oder Water Samples

Eight water samples of 0.5 L were taken from different places in the Oder river. The samples were observed under the microscope. Prymnesium parvum was present in sample number 5. Samples 3, 4 and 8 also looked promising.


Figure 13. Environmental sample collection site of NOW1 and NOW2.


Figure 14. Environmental sample collection site of NOW3.


Figure 15. Environmental sample collection site of NOW4 and NOW5.


Figure 16. Environmental sample collection site of NOW6.


Figure 17. Environmental sample collection site of NOW7.


Figure 18. Environmental sample collection site of NOW8.

New Oder Water (NOW) Liquid Cultures

Purpose: New liquid cultures were set up in order to increase the amount of biological material for future DNA isolations.

This protocol is also available on the Experiments page under the Setting up liquid algal cultures protocol.

Five liquid cultures were made: NOW 3, NOW 4, NOW 5, NOW 5.1, NOW 8 (NOW – New Oder Water). Based on microscopic imaging, water sample number 5 contained the highest concentration of Prymnesium parvum cells, so an additional liquid culture, NOW 5.1, was prepared.

The cultures were made in glass flasks that contained portions of previously prepared F/2 medium (salt 16 g/L). Oder water was transferred into the flask with F/2 medium. The Oder water to F/2 medium volume ratio was either 1:3 or 1:2, depending on the capacity of the flask. Stocks of vitamins were added to each flask.

Independently from the flask cultures, 8 mini-liquid cultures with a volume of 3 ml each were set up in a 12-well plate. The cultures contained the same mix of F/2 medium and vitamins.

New Oder Water 5 – Serial Dilutions

Serial dilutions of the sample 5 from the New Oder Water were made on a 12-well plate.


Figure 19. Scheme of the serial dilutions performed.

All the wells of the plate were filled with 3 ml of F/2 medium. 1 ml of sample 5 was added to wells 1A, 2A, 3A, and mixed by pipetting. Then, in each row, 1 ml from the A well was transferred into the B well and mixed. The procedure was repeated for the C and D wells. The vitamins were added into each well.

PCR Reactions with Galluzzi, KAC 39, and White Primers

Purposes:

  • Amplification of the ITS2 sequence from Prymnesium parvum genome with Galluzzi primers.
  • Optimization of PCR reaction conditions for KAC 39 and White primers by performing a gradient PCR.

The PCR protocol is also available on the Experiments page under the PCR reaction on DNA isolated from algae cultures protocol.

White primers were designed by White et. al. [2]. They amplify the same DNA sequence as KAC 39 primers designed by our team members.

Table 11. Sequences of the Primers Used in PCR.

PCR Primer Name Sequence
GalF 5' TGTCTGCCGTGGACTTAGTGCT 3'
GalR 5' ATGGCACAACGACTTGGTAGG 3'
KacF 5' ATCATTACCGGTCTTTCCACCCAC 3'
KacR 5' GAGTCCAATGGTGCGCGC 3'
ItsF** 5' TCCGTAGGTGAACCTGCGG 3'
ItsR** 5' TCCTCCGCTTATTGATATGC 3'

*Primers designed by Galluzzi et. al. [1], that were used in previous PCR reactions.
** Primers designed by White et. al. [2].

The PCR reaction was performed on two DNA samples named K (DNA isolated from Oder liquid cultures) and G (DNA isolated from Gdańsk liquid cultures), which were previously concentrated in SHERLOCK lab. DNA concentration:

  • K: 118.6 ng/µl
  • G: 147.6 ng/µl

Galluzzi PCR

The primers’ initial solution 100 µM was diluted twice: 10x and 50x to the final concentration of 200 nM.

  • First dilution (10x): 1 µl + 1 µl + 8 µl (pure water)
  • Second dilution (50x): 1 µl + 49 µl (reaction mix)

Table 12. PCR Samples Composition. Reaction Volume = 50 µl

PCR Reagent Volume [µl]
DNA Template 1
PCR Mix (A&A Biotechnology) 25
Primer Mix 1
Water 23

Table 13. PCR Reaction Conditions (16/05 Source Description)

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 98 30
Denaturation 98 10
Annealing 67 60
Elongation 72 5
Final Elongation 72 300

Table 14. PCR Samples Composition – KAC 39 and White. Reaction Volume = 20 ul

PCR Reagent Volume [µl]
DNA Template 0.5
PCR Mix (A&A Biotechnology) 10
Primer Mix 0.4
Water 9.1

Table 15. PCR Reaction Conditions

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 95 180
Denaturation 95 30
Annealing 50/55/60/65/70 30
Elongation 72 30
Final Elongation 72 600

Gel Electrophoresis of the PCR Product

Electrophoresis was carried out on a 2% agarose gel at 85 V for 45 minutes. 8 µl of each PCR product were loaded into the gel wells. Two distinct DNA standards were used: GeneRuler 1 kb DNA Ladder and O'GeneRuler DNA Ladder Mix.


Figure 20. DNA Electrophoresis of the PCR Products – Results.

  • 1 – O'GeneRuler DNA Ladder Mix
  • 2 – 5 – Galluzzi, DNA sample: K
  • 6 – 7 – Galluzzi, DNA sample: G
  • 8 – 12 – Gradient PCR, KAC 39; 50/55/60/65/70°C respectively, (sample K)
  • 13 – 17 – Gradient PCR, White; 50/55/60/65/70°C respectively (sample K)
  • 18 – O'GeneRuler 1 kb DNA Ladder Mix
Conclusions

In the PCR reaction with Galluzzi primers, the ITS2 DNA fragment was successfully amplified using DNA sample K as a template. However, DNA sample G, derived from liquid cultures from Gdańsk, did not show a specific and clear band on the gel, indicating that these PCR reactions were not successful.

For the PCR with KAC39 primers, no specific product was visible on the gel, suggesting that further optimization is needed.

In the PCR with White primers, two distinct bands were observed in lanes 13 and 14, corresponding to annealing temperatures of 50°C and 55°C, respectively. One of the bands in each lane had the expected length of approximately 700 bp, which may indicate the desired product. The reaction should be repeated at these two annealing temperatures for confirmation.

Another Water Samples – Brand New Oder Water (BOW)

Two water samples of 0.5 L were collected from another area of Czernica lake.


Figure 21. Environmental sample collection site of BOW1 and BOW2

Brand New Oder Water Liquid Cultures

Purpose: New liquid cultures were set up in order to increase the amount and variety of biological material for future DNA isolations.

This protocol is also available on the Experiments page under the Setting up liquid algal cultures protocol.

Two liquid cultures were made, one for each water sample: 5 ml of each Oder water sample was added to 20 ml of F/2 medium (sea salt 16 g/L) with the addition of vitamins in glass flasks. The cultures were named BOW 1 and BOW 2.

Mini-cultures on a 12-well plate were also prepared. 1 ml of each Oder water sample was transferred into two wells of a 12-well plate containing 3 ml of F/2 medium with the addition of vitamins.

PCR with Galluzzi Primers

Purpose: The aim of the experiment was to evaluate whether the ITS2 sequence is present in the DNA samples isolated on 16/05 and concentrated in the SHERLOCK lab.

This protocol is also available on the Experiments page under the PCR reaction on DNA isolated from algae cultures protocol.

P. parvum genomic DNA isolated from Krakow liquid cultures was used from the following samples:

  • G1: 95.1 ng/µl
  • K1: 125.2 ng/µl
  • K2: 188.3 ng/µl

Primers complementary for the ITS2 region were designed by Galluzzi et al. [1].

  • KacF 5' TGTCTGCCGTGGACTTAGTGCT 3'
  • KacR 5' ATGGCACAACGACTTGGTAGG 3'

Primers stock solutions (100 µM) were diluted 500x to the final concentration of 200 nM:

  • First dilution (25x): 1 µl + 1 µl (primers) + 23 µl (water)
  • Second dilution (20x): 2.5 µl (primer mix) + 47.5 µl (PCR reaction mix)

Table 16. PCR Samples Composition. Reaction Volume = 50 µl

PCR Reagent Volume [µl]
DNA Template 2.5
PCR Mix (A&A Biotechnology) 25
Primers Mix 2.5
Water 20

Table 17. PCR Reaction Conditions (Source Description - 16/05)

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 98 30
Denaturation 98 10
Annealing 67 60
Elongation 72 5
Final Elongation 72 300

Number of Cycles: 40

DNA Electrophoresis of the PCR Product

Electrophoresis was performed in a 2% agar gel at 85 V for 45 minutes. 10 µl of each PCR product was added to the gel wells. Two distinct DNA standards were used: GeneRuler 1kB DNA Ladder and O'GeneRuler DNA Ladder Mix (SM033).

Results: No specific product was observed. The photo could not be taken due to the device failure.

Conclusions

None of the tested samples yielded a PCR product. The experiment is not reproducible with the DNA samples isolated on 16/05. Newly isolated DNA samples are needed.

27.05 - 02.06

Algal DNA Isolation

Purpose: DNA isolation from liquid algal cultures containing Prymnesium parvum's cells and verification of the presence of the Prymnesium parvum genome at the request of the SHERLOCK lab team.

The isolation protocol is available on the Experiments page under the Algal DNA isolation with QIAwave DNA blood and tissue kit protocol.

Before isolation, all liquid cultures were examined macroscopically, and the best-looking ones were selected:

  • NOW 5
  • NOW 5.1
  • P (samples from two 12-well plates mixed together)
  • BOW 1
  • BOW 2
  • 2W
  • Gdańsk 2

DNA isolation was performed in the same way as described on 16/05/2024.

Elution was performed twice, with 200 µl of AE buffer each time. As a result, 7 DNA samples of 400 µl were received. The concentration of the isolated DNA was measured with a NanoDrop spectrophotometer.

Table 18. DNA Concentrations After the Isolation

Sample Concentration [ng/µl] A260/A280
NOW 5 5.8 1.66
NOW 5.1 4.9 1.65
P 12.7 1.67
BOW 1 5.6 1.53
BOW 2 6.4 1.55
2W 11.2 1.28
Gdańsk 2 5.2 1.8

Increasing the Concentration of Isolated DNA

This protocol is also available on the Experiments page under the increasing the DNA concentration protocol.

The concentration of samples NOW 5, P, BOW 2, Gdańsk 2 was increased according to the following protocol:

  1. 1/10 volume of sodium acetate (pH=5,5) was added to the samples.
  2. Isopropanol equivalent to the volume of the sample was added and the samples were mixed by gentle rotating.
  3. The samples were centrifuged at maximum speed for 10 min.
  4. Samples were then washed twice with ethanol (with 5 min centrifugation in between and gentle rotation to mix them).
  5. Pellets were suspended in 15 μl of water and the concentration was measured. The concentrations were as follows:

Table 19. DNA Concentrations After the Increase

Sample Name Concentration [ng/µl] A260/A280 A260/A230
NOW 5 164.9 1.63 0.93
P 280.6 1.60 0.93
BOW 2 154.3 1.63 0.94
Gdańsk 2 127.2 1.78 1.19

Samples BOW 2 and NOW 5.1 were left and secured in case the concentration process fails.

PCR with Galluzzi Primers on DNA Isolated 27/05

Purposes:

  • To determine whether the Prymnesium parvum ITS2 sequence is present in the DNA samples isolated from liquid cultures and concentrated the previous day.
  • To optimize PCR conditions by testing those recommended by the PCR Mix manufacturer.

Prymnesium parvum genomic DNA was used from the following samples:

  • NOW 5: 164.9 ng/µl
  • P: 280.6 ng/µl
  • BOW 2: 154.3 ng/µl
  • Gdańsk 2: 127.2 ng/µl

Primers complementary for the ITS2 region were designed by Galluzzi et. al. [1]

  • KacF: 5' TGTCTGCCGTGGACTTAGTGCT 3'
  • KacR: 5' ATGGCACAACGACTTGGTAGG 3'

Primers stock solutions (100 µM) were diluted 500x to the final concentration of 200 nM.

  • First dilution (25x): 1 µl + 1 µl (primers) + 23 µl (water)
  • Second dilution (20x): 1 µl (primer mix) + 19 µl (PCR reaction mix)

Table 20. PCR Samples Composition. Reaction Volume = 20 ul

PCR Reagent Volume [µl]
DNA Template 2
PCR Mix (A&A Biotechnology) 10
Primers Mix 0.8
Water 7.2

Number of Cycles: 40

The PCR was performed in two different conditions. A – conditions used routinely in our lab for Galluzzi primers (source description - 16/05). B – conditions adjusted for the Taq polymerase that was used, according to the manufacturer's instruction.

Table 21. PCR Conditions Tested in the Experiment


Reaction step

Conditions A

Conditions B

Temperature [°C]

Time [s]

Temperature [°C]

Time [s]

Pre-denaturation

98

30

95

60

Denaturation

98

10

95

15

Annealing

67

60

67

60

Elongation 

72

5

72

15

Final elongation

72

300

72

300


DNA Electrophoresis of the PCR Product

Electrophoresis was performed in 2% agar gel, at 85 V for 45 min. 5 µl of each PCR product were added to wells of the gel. Two distinct DNA standards were used: GeneRuler 1kb DNA Ladder and O'GeneRuler DNA Ladder Mix (SM033).


Figure 22. Gel Electrophoresis of PCR Products – Results.

  • 1 – O'GeneRuler DNA Ladder Mix
  • 2 – negative control (water)
  • 3 – P
  • 4 – BOW 2
  • 5 – NOW 5
  • 6 – Gdańsk 2
  • 7 – negative control (water)
  • 8 – P
  • 9 – BOW 2
  • 10 – NOW 5
  • 11 – Gdańsk 2
  • 12 – GeneRuler 1kb DNA Ladder Mix
Conclusions

A product of the correct length was observed in rows 8 and 10 (conditions B, samples P and NOW 5, respectively). The negative control sample showed no visible band. This indicates that samples P and NOW 5 contain the Prymnesium parvum genome and are suitable for further experiments in the SHERLOCK lab.

Additionally, a band of the proper length was visible in the 3rd row for conditions A. However, since the negative control sample also displayed a product of the same length, conditions A will be discontinued. Conditions B will be used for subsequent PCR reactions.

PCR with White Primers

Purposes:

  • To amplify the ribosomal cistron sequence of Prymnesium parvum using PCR with White primers.
  • To optimize reaction conditions.

Primers used in the reaction were designed by White et. al. [2]:

  • ItsF: 5' TCCGTAGGTGAACCTGCGG 3'
  • ItsR: 5' TCCTCCGCTTATTGATATGC 3'

DNA template – coming from liquid cultures set up 13/05, concentrated in the SHERLOCK lab:

  • K: 118.6 ng/µl

The primers’ initial solution (100 µM) was diluted twice: 10x and 50x to the final concentration of 200 nM:

  • First dilution (10x): 1 µl + 1 µl + 8 µl (pure water)
  • Second dilution (50x): 1 µl + 49 µl (reaction mix)

Table 22. PCR Samples Composition. Reaction Volume = 50 ul

PCR Reagent Volume [µl]
DNA Template 1
PCR Mix (A&A Biotechnology) 25
Primers Mix 1
Water 23

PCR was performed under two different conditions (A and B). Condition A followed the protocol described by Binzer et al. [3], who used these primers. Due to the use of a different polymerase in our reaction compared to Binzer et al., the conditions were adjusted for our polymerase, resulting in Condition B. Each set of conditions was tested in duplicate, with the samples labeled as A1, A2, B1, and B2.

Table 23. PCR Reaction Conditions


Reaction step

Conditions A

Conditions B

Temperature [°C]

Time [s]

Temperature [°C]

Time [s]

Pre-denaturation

95

720

95

180

Denaturation

95

30

95

30

Annealing

54

30

50

30

Elongation 

72

40

72

120

Final elongation

72

300

72

600

Gel Electrophoresis of the PCR Product

Electrophoresis was performed in 2% agar gel, at 85 V for 45 min. 20 µl of each PCR product were added to wells of the gel (10 µl per well). Standard: GeneRuler 1kB DNA Ladder (Thermo Fisher).


Figure 23. DNA Electrophoresis of PCR Products – Results.

  • 1, 10 – GeneRuler 1 kB DNA Ladder
  • 2, 3 – A1
  • 4, 5 – A2
  • 6, 7 – B1
  • 8, 9 – B2
Conclusions

The only DNA products visible on the gel were in rows 6 and 7. Both rows displayed two bands: a longer one, approximately 700 bp, and a shorter one, around 600 bp. All stripes were cut out from the gel before photographing to prevent DNA degradation from prolonged UV exposure.

The DNA was isolated from the gel with the Syngen kit, following the manufacturer's instructions. DNA concentration was measured:

  • Shorter product: 0.3 ng/µl
  • Longer product: 0.1 ng/µl

Concentration of both PCR products isolated from the gel was too low for Sanger sequencing procedure.

Conclusions

The stripes that were cut out of the gel were poorly visible, likely due to low amplification efficiency. Reaction conditions require further optimization.

03.06 - 09.06

F/2 Medium Preparation

The medium preparation protocol is also available on the Experiments page under the F/2 Medium Preparation Protocol.

The F/2 medium was prepared by using previously made 100x concentrated stocks. Total medium volume: 700 ml, which contains:

  • 7 ml of each of 9 stocks (63 ml in total)
  • 637 ml of distilled water
  • 11,2 g of sea salt (16 g/L)

After mixing all the ingredients, the medium was sterilised with a microwave autoclave.

Algal Cell Passage

This protocol is also available on the Experiments page under the Passaging Liquid Algal Cultures Protocol.

Some of the liquid cultures made on 13/05 were already dark yellow, therefore the first passage of algal liquid culture was performed, following these steps:

  • A portion of F/2 medium was transferred in sterile conditions into a flask. The medium amount should be sufficient to form a layer approximately 1 cm thick at the bottom.
  • 1 ml of the 1W liquid culture was added to the flask.
  • A proper amount of the vitamins stocks was added to the flask.
  • The new culture was gently mixed by rotating, secured, and left in the growth chamber.

As a result, new liquid cultures were made: 1W1, 2W1, 1BW1, 2BW1, 3BW1, Gdańsk 11, Gdańsk 21.

Notes
  • Culture Classification System: Each successive "1" in the culture name indicates an additional passage.
  • Biohazard Waste: All waste, including pipette tips and liquid waste that have come into contact with Prymnesium, should be treated as a biohazard. Store this waste in a separate beaker and dispose of it according to Dr Jedynak's instructions.
  • Sterilisation Warning: When sterilising the F/2 medium with agar for plate cultures, do not tighten the cap of the bottle. Avoid cooling the capped bottle immediately after removing it from the water bath or autoclave, as this can cause the bottle to explode or implode.

Information about growth life cycle of Prymnesium:
Prymnesium Life Cycle Information

Testing Various Lighting Conditions

Cultures 2W1 and 1BW1 were left in a place with lower light intensity in the growth chamber. They will serve as a test to determine whether Prymnesium parvum can thrive under such conditions.

High Volume Liquid Culture

1 ml of 2W liquid culture was added in sterile conditions to a glass bottle with 700 ml F/2 medium. The cap of the bottle was left untightened and the bottle was left in the growth chamber.

Prymnesium parvum Sample from Szczecin

A 30 ml sample of Prymnesium parvum liquid sample was obtained from Szczecin. Figure 24 shows a microscopic image of the sample.


Figure 24. Prymnesium parvum liquid sample from Szczecin – microscopic image.

Liquid stocks of the F/2 medium ingredients, concentrated 1000x, were received along with the Prymnesium parvum sample. The ingredients were as follows:

  • NaNO3
  • H2PO4
  • NaSiO2
  • Trace metal solution
  • Vitamin mix solution

The sea salt was received as a solid.

F/2 Medium Preparation from the Received Ingredients Stocks

The F/2 medium was prepared using the stocks received from Szczecin. The stocks are 1000x concentrated. Total medium volume: 200 ml, which contains:

  • 200 µl of each of the stocks (1 ml in total)
  • 199 ml of distilled water
  • 0,6 g of sea salt (3 g/L)

According to the instructions from the team in Szczecin, a sea salt concentration of 3 g/L was used.

After mixing all the ingredients, the medium was sterilised in a microwave autoclave. The vitamin solution was added after the sterilisation in order to avoid the vitamin degradation.

Liquid Cultures from the Szczecin Sample

Purpose: Propagation of a Prymnesium parvum laboratory liquid culture so as to compare it with liquid algal cultures made from environmental samples.

This protocol is also available on the Experiments page under the Setting up liquid algal cultures protocol.

The sample from Szczecin was split and two liquid cultures were prepared, in different medium versions:

  • 7 ml of the sample was added to 23 ml of F/2 medium (salt 16 g/L). Sample name: Szczecin
  • 15 ml of the sample was added to 15 ml of F/2 medium (salt 3 g/L). Sample name: Szczecin F/2

New liquid cultures were left in a growth chamber, where the conditions described below prevailed, following the recommendations of the team from Szczecin.

  • Temperature: 22°C
  • Lighting: 100 photon fluence rate
  • Light/dark cycle: 14 h/10 h

Note: The culture density was too low for DNA isolation, therefore the liquid cultures were set up to increase the amount of Prymnesium parvum cells.

10.06 - 16.06

PCR with Galluzzi Primers on Selected DNA Samples Isolated on 27/05

Purpose: The goal was to provide DNA templates for sensitivity tests of the SHERLOCK assay. This involved using two samples that had been successfully amplified in the previous PCR with Galluzzi primers (P and NOW 5), along with two samples that had not been successfully amplified (BOW 2 and Gdańsk 2).

P. parvum genomic DNA isolated from Krakow liquid cultures was used from the following samples:

  • NOW 5 – 164.9 ng/µl (2 PCR reactions)
  • P – 280.6 ng/µl (2 PCR reactions)
  • BOW 2 – 154.3 ng/µl (1 PCR reaction)
  • Gdańsk 2 – 127.2 ng/µl (1 PCR reaction)

Primers Sequences:

  • KacF: 5' TGTCTGCCGTGGACTTAGTGCT 3'
  • KacR: 5' ATGGCACAACGACTTGGTAGG 3'

Primers stock solutions (100 uM) were diluted 500x to the final concentration of 200 nM:

  • First dilution (25x) – 1 µl + 1 µl (primers) + 23 µl (water)
  • Second dilution (20x) – 2.5 µl (primer mix) + 47.5 µl (PCR reaction mix)

Table 24. PCR Samples Composition. Reaction Volume = 50 µl

PCR Reagent Volume [µl]
DNA Template 1
PCR Mix (A&A Biotechnology) 25
Primers Mix 2.5
Water 21.5

Table 25: PCR Reaction Conditions Based on the Manufacturer’s Instruction (A&A Biotechnology)

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 95 60
Denaturation 95 15
Annealing 67 60
Elongation 72 15
Final Elongation 72 300

Number of Cycles: 30

DNA Electrophoresis of the PCR Product

Electrophoresis was performed in 2% agar gel, at the 85 V voltage for 45 min. 5 µl of each PCR product were added to wells of the gel. Two distinct DNA standards were used: GeneRuler 1kB DNA Ladder and O'GeneRuler DNA Ladder Mix (SM033).


Figure 25. DNA Electrophoresis of the PCR Product – Results.

  • 1 – GeneRuler 1kB DNA Ladder
  • 2 – Negative control (water)
  • 3, 4 – P
  • 5, 6 – NOW 5
  • 7 – Gdańsk 2
  • 8 – BOW 2
  • 9 – O'GeneRuler DNA Ladder Mix
Conclusion

Specific products of the correct length were obtained for DNA samples P, NOW5, and BOW 2, indicating successful amplification, unlike the results from the PCR conducted on 28/05. PCR with Gdańsk 2 as the DNA template did not yield any specific product.

The PCR products were purified after the enzymatic reaction to remove any potential PCR inhibitors.

Macroscopic Observations of Liquid Cultures

Observation: Cultures growing in standard light conditions exhibit slightly faster growth compared to those left in a darker environment.

17.06 - 23.06

Changes in Algal Morphology

The sample preparation for imaging protocol is available on the Experiments page under the Preparing liquid algal cultures samples for imaging protocol.

We observed a significant change in algal morphology in liquid cultures made 13/05 from environmental samples. In every observed culture, the algal cells became oval, small, and very similar to each other. Two chloroplasts, which are a characteristic feature of Prymnesium parvum, are no longer visible in the fluorescent light of the microscope. We hypothesise that under stressful conditions, Prymnesium parvum transitioned to the haploid cyst stage, which accounts for the observed morphological changes. By stressful conditions, we mean laboratory conditions, which differ from the natural habitat of the algae.

Figure 26 and 27, respectively, show a sample view of the cultures before and after the morphological change.


Figure 26. Algae liquid culture before the morphological change.


Figure 27. Algae liquid culture after the morphological change.

High Volume Liquid Culture: We observed slight growth of algae as a golden-brown precipitate at the bottom of a flask.

F/2 Medium – Testing Various Sea Salt Concentrations

Purpose: Determining which sea salt concentration will be optimal for algae growth.

The medium preparation protocol is also available on the Experiments page under the F/2 medium preparation protocol.

Three portions of F/2 medium with varying concentrations of sea salt were prepared. The medium was made following the same procedure as outlined on 10/05, with a volume of 200 ml for each salt concentration. The sea salt concentrations tested were: 2.5 g/L, 5 g/L, and 10 g/L.

3 ml of each of the medium variants was put into two wells of a 12-well plate, and the vitamin mix was added. The liquid culture chosen for the test was 2W1, as it was in the best condition. Then, 100 µl of 2W1 liquid culture was transferred from the flask to each well. The plate was secured and left in the growth chamber.

24.06 - 30.06

F/2 Medium Preparation

The medium preparation protocol is also available on the Experiments page under the F/2 medium preparation protocol.

The F/2 medium was prepared by using previously made 100x concentrated stocks. Total medium volume: 800 ml, which contains:

  • 8 ml of each of 9 stocks (72 ml in total)
  • 728 ml of distilled water
  • 12,8 g of sea salt (16 g/L)

After mixing all the ingredients, the medium was sterilised in an autoclave.

Algal Cell Passage

This protocol is also available on the Experiments page under the Passaging liquid algal cultures protocol.

The passage was carried out in the same manner as described on 03/06. Cultures 2BW1, 3BW1, Gdańsk 11, and Gdańsk 21 looked badly – they were fully coloured green, which is probably because of green algae growth that had replaced Prymnesium parvum. Therefore, the listed cultures were not passaged and 2BW1 and 3BW1 were disposed of.

As a result, new liquid cultures were made:

  • 1W11
  • 2W11
  • 1BW11
  • NOW 31
  • NOW 41
  • NOW 51
  • NOW 5.11
  • NOW 81
  • BOW 11
  • BOW 21

Disposal of Old Cultures

This protocol is also available on the Experiments page under the Algae liquid culture disposal protocol.

Liquid cultures 2BW1 and 3BW1 were disposed of following these steps:

  • Medicarine solution was prepared – 1 pill of Medicarine was dissolved in 1 L of tap water.
  • The Medicarine solution was added to the cultures until the culture flask was nearly full.
  • The cultures were left for 15 minutes so that all the microorganisms were neutralised.
  • After that time, the flasks were emptied and washed.

Gradient PCR with Galluzzi Primers Containing T7 Promoter Sequence

Purpose: Introduction of the T7 promoter sequence into the ITS2 sequence from Prymnesium parvum genome by PCR amplification. To achieve this, the forward primer designed by Galluzzi et.al [1] was modified by adding the T7 promoter sequence.

Primers Sequences:

  • ModF: 5' GAAATTAATACGACTCACTATAGGGTGTCTGCCGTGGACTTAGTGCT 3'
  • ModR: 5' ATGGCACAACGACTTGGTAGG 3'

To optimize the annealing temperature, five different temperatures were investigated in a gradient: 55/59,2/65,5/67,6/70°C.

Primers stock solutions (100 µM) were diluted 500x to a final concentration of 200 nM:

  • First dilution (25x): 1 µl + 1 µl (primers) + 23 µl (water)
  • Second dilution (20x): 1 µl (primer mix) + 19 µl (PCR reaction mix)

DNA Template: DNA isolated from Krakow liquid cultures – sample K3.2, with a concentration of 62,4 ng/µl (concentrated in the SHERLOCK lab).

Table 26. PCR Samples Composition. Reaction Volume = 20 µl

PCR Reagent Volume [µl]
DNA template 1
PCR Mix A&A Biotechnology 10
Primer mix 1
Water 8

Table 27. PCR Reaction Conditions

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 98 30
Denaturation 98 10
Annealing 55/59,2/65,5/67,6/70 60
Elongation 72 5
Final Elongation 72 300

Number of cycles: 32

Gel Electrophoresis of the PCR Product

Electrophoresis was performed in 2% agar gel, at 85 V for 45 minutes. 10 µl of each PCR product were added to the wells. Two distinct DNA standards were used: GeneRuler 1 kb DNA Ladder and O'GeneRuler DNA Ladder Mix.


Figure 28. DNA Electrophoresis – Results.

  • 1 – O'GeneRuler DNA Ladder Mix
  • 2 – 55°C
  • 3 – 59,2°C
  • 4 – 65,5°C
  • 5 – 67,6°C
  • 6 – 70°C
  • 7 – GeneRuler 1 kb DNA Ladder Mix
Conclusions

No specific product was obtained in the performed PCR. The shadows visible below 100 bp are primer dimers. The reaction conditions require optimization.

Sea Salt Experiment – Observations

The cultures on a 12-well plate with three different sea salt concentrations were examined under the microscope. No significant changes were observed at concentrations of 2.5 g/L and 5 g/L. However, at a concentration of 10 g/L, morphological changes were noted—small, oval cysts transformed into larger, more rounded cells. Movement of some of the cells was also observed.


Figure 29. 12-well Plate. Sea Salt Concentration – 10 g/L. Microscopic Image.

Gradient PCR with Galluzzi Primers Containing T7 Promoter Sequence – Modified Reaction Conditions

Purpose: Second attempt to introduce the T7 promoter sequence into the ITS2 sequence from the Prymnesium parvum genome. The PCR conditions were modified and adjusted to the Taq polymerase that was used.

Primers sequences:

  • ModF: 5' GAAATTAATACGACTCACTATAGGGTGTCTGCCGTGGACTTAGTGCT 3'
  • ModR: 5' ATGGCACAACGACTTGGTAGG 3'

Primers stock solutions (100 uM) were diluted 500x to the final concentration of 200 nM. First dilution (25x): 1 µl + 1 µl (primers) + 23 µl (water). Second dilution (20x): 1 µl (primer mix) + 19 µl (PCR reaction mix).

DNA template: coming from liquid cultures set up 13/05, concentrated in the SHERLOCK lab: sample K3.2 (62.4 ng/µl).

In order to save the DNA template, reaction volume was reduced to 10 µl.

Table 28. PCR Samples Composition. Reaction Volume = 10 µl

PCR reagent Volume [µl]
DNA template 0.5
PCR Mix (A&A Biotechnology) 5
Primer mix 0.5
Water 4

Table 29. PCR Reaction Conditions

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 95 120
Denaturation 95 20
Annealing 55/59.2/65.5/67.6/70 60
Elongation 72 30
Final Elongation 72 300

Number of cycles: 30

Gel Electrophoresis of the PCR Product

Electrophoresis was performed in 2% agar gel, at the 85 V voltage for 45 min. 5 µl of each PCR product were added to wells of the gel. Two distinct DNA standards were used: GeneRuler 1kB DNA Ladder and O'GeneRuler DNA Ladder Mix.


Figure 30. DNA Electrophoresis of the PCR Product – Results.

  • 1 – O'GeneRuler DNA Ladder mix
  • 2 – 55°C
  • 3 – 59.2°C
  • 4 – 65.5°C
  • 5 – 67.6°C
  • 6 – 70°C
  • 7 – GeneRuler 1kB DNA Ladder Mix
Conclusion

Rows 2, 3, 4 contain a slight trace of the specific product. There is no sign of the product in rows 5 and 6. The signal may be weak because of the small amount of DNA template and fewer PCR cycles.

DNA Isolation – New Method

Purpose: Checking the efficiency of a new DNA isolation method that utilises the Monarch Genomic DNA Purification Kit (NEB).

The isolation protocol is available on the Experiments page under the Algal DNA isolation with NEB isolation kit protocol.

1.5 ml of liquid cultures NOW 5 and BOW 2 (cultures that had previously given specific products in PCR with Galluzzi primers) were centrifuged (13,500 rpm, 10 min). The supernatants were disposed of and the pellets were utilised for DNA isolation, following the manufacturer's protocol.

The steps followed were:

  1. 10 µl of proteinase K and 200 µl of Lysis Buffer were added to each sample and mixed by vortexing.
  2. The samples were incubated at 56°C with shaking (1400 rpm) for 1 hour.
  3. 400 µl of Binding Buffer was added to each sample and mixed by vortexing for 10 seconds.
  4. The mix from step 3 was transferred to a Purification Column, previously inserted into a collection tube.
  5. The samples were centrifuged twice: first for 3 minutes at 1000 g so that DNA binds to the columns, and second for 1 minute at 13,500 g to clear the membrane. The flow-through was discarded.
  6. 500 µl of Wash Buffer was added to the columns. Caps were closed and the samples were inverted a few times so that the wash buffer reached the cap. The samples were centrifuged for 1 minute at 13,500 g. The flow-through was discarded.
  7. Step 6 was repeated.
  8. The columns were placed in 1.5 ml collection tubes. 50 µl of preheated water was added, and the samples were incubated at room temperature for 1 minute.
  9. The samples were centrifuged for 1 minute at 13,500 g in order to elute the isolated DNA.

Note: Steps including RNase addition, described in the manual, were skipped, as they are not necessary for this experiment.

Table 30. Concentration of the DNA Isolated with a Monarch Kit

Sample Name DNA Concentration [ng/µl] A260/A280 A260/A230
NOW 5 16 1.68 1.34
BOW 2 24.1 1.79 1.56

01.07 - 07.07

Increasing the Concentration of DNA Isolated 27/05

After the DNA isolation with the QIAwave Blood and Tissue Kit (27/05), three DNA samples of 400 µl remained that required concentration increase: NOW 5.1, 2W, and BOW 1.

This protocol is also available on the Experiments page under the Increasing the DNA concentration protocol.

The concentration of isolated DNA was increased according to the following protocol:

  1. 1/10 volume of sodium acetate (pH=5.5) was added to the samples.
  2. Isopropanol equivalent to the volume of the sample was added, and the samples were mixed by gentle rotating.
  3. The samples were centrifuged at maximum speed for 10 minutes.
  4. The samples were washed twice with ethanol (with 5 minutes centrifugation in between and gentle rotation to mix them).
  5. Pellets were suspended in 15 µl of water, and the concentration was measured.

Table 31. Concentration of the Isolated DNA

Sample Name Concentration [ng/µl] A260/A280 A260/A230
NOW 5.1 31.5 1.57 0.88
BOW 1 39.3 1.62 0.88
2W 16.6 1.88 0.01

Note: Significant contamination of the samples with organic compounds.

PCR with Galluzzi Primers on DNA Isolated on 27/05 and 27/06

Purpose: Verification of the presence of Prymnesium parvum's ITS2 sequence in DNA samples isolated with the Monarch isolation kit (NOW 5 and BOW 2) and the newly concentrated DNA samples (NOW 5.1, BOW 1, 2W). Galluzzi primers were used for this purpose.

The PCR protocol is also available on the Experiments page under the PCR reaction on DNA isolated from algae cultures protocol.

DNA Samples Used as Template:

  • NOW 5.1: 31.5 ng/µl
  • 2W: 16.6 ng/µl
  • BOW 1: 39.3 ng/µl
  • NOW 5: 16 ng/µl
  • BOW 2: 24.1 ng/µl

Primers Sequences:

  • GalF: 5' TGTCTGCCGTGGACTTAGTGCT 3'
  • GalR: 5' ATGGCACAACGACTTGGTAGG 3'

Primers stock solutions (100 uM) were diluted 500x to the final concentration of 200 nM.

  • First dilution (25x): 1 µl + 1 µl (primers) + 23 µl (water)
  • Second dilution (20x): 2.5 µl (primer mix) + 47.5 µl (PCR reaction mix)

Table 32. PCR Samples Composition. Reaction Volume = 50 µl

PCR Reagent Volume [µl]
DNA Template 3
PCR Mix (A&A Biotechnology) 25
Primers Mix 2.5
Water 19.5

Table 33. PCR Reaction Conditions Based on the PCR Mix Manufacturer’s Instruction (A&A Biotechnology)

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 95 60
Denaturation 95 15
Annealing 67 60
Elongation 72 15
Final Elongation 72 300

Number of Cycles: 30

DNA Electrophoresis of the PCR Product

Electrophoresis was performed in 2% agar gel, at the 85 V voltage for 45 minutes. 5 µl of each PCR product were added to wells of the gel. Two distinct DNA standards were used: GeneRuler 1kB DNA Ladder and O'GeneRuler DNA Ladder Mix (SM033).


Figure 31. Gel Electrophoresis of the PCR Products – Results.

  • 1 – GeneRuler 1kB DNA Ladder
  • 2 – Negative control (water)
  • 3 – BOW 2
  • 4 – NOW 5
  • 5 – NOW 5.1
  • 6 – 2W
  • 7 – BOW 1
  • 8 – O'GeneRuler DNA Ladder Mix (SM033)
Conclusion

Three specific products of the right length were received for the samples BOW 2, NOW 5.1, and BOW 1. Samples NOW 5.1 and BOW 1 were tested with Galluzzi primers for the first time, and the presence of the ITS2 sequence was confirmed.

08.07 - 14.07

Microscopic Observation – Liquid and Plate Cultures
Plate Cultures

Except for the 1W plate culture, no changes in algae growth were observed on the plates. None of the microorganisms observed were morphologically similar to Prymnesium parvum.

Liquid Cultures

Hardly any differences in the growth and quantity of algae have been observed since the last microscopic evaluation. Very few cells morphologically resembled Prymnesium parvum. However, another change in general morphology of the culture occurred – algal cells became round, and small, oval cells were no longer visible. Figure 32 shows the microscopic image of 1BW11 liquid culture, where the changes are most visible.


Figure 32. 1BW11 Liquid Culture – Microscopic Image.

Algal DNA Isolation

Purpose: Verification of Prymnesium parvum genome presence in newly created liquid cultures after the passage.

The isolation protocol is also available on the Experiments page under the Algal DNA Isolation with QIAwave DNA Blood and Tissue Kit protocol.

Samples of 2 ml were taken from the liquid cultures 2W11, 1BW11, 2W1D (culture from Darkness), and the high-volume culture. The samples were centrifuged (5 min, 14 000 rpm). DNA was isolated in the same manner as described 16/05. Elution was performed twice, with 200 µl of AE buffer each time. As a result, 4 DNA samples of 400 µl were received. The concentration of the isolated DNA was measured with a NanoDrop spectrophotometer.

Table 34. Concentration of the isolated DNA.

Sample name DNA concentration [ng/µl] A260/A280
High-volume culture 11,3 1,41
2W1D 9,9 1,26
2W11 9,4 1,15
1BW11 11,2 1,12

PCR of the Isolated DNA and Colony PCR

Purpose: Identification of the ITS2 sequence that is placed in the Prymnesium parvum genome and is specific to this species. The sequence length is 132 bp.

The PCR protocol is also available on the Experiments page under the PCR Reaction on DNA Isolated from Algae Cultures Protocol.

Colony PCR of the sample taken from the high-volume culture was performed simultaneously. Sample preparation for the colony PCR included:

  • Taking 2 ml sample from the high-volume culture
  • Centrifugation of the sample (2 min, 14 000 rpm)
  • Washing the sample with ultra-pure water
  • Adding the sample directly to the PCR reaction mixture

Primers for the PCR reaction were the same as used by Galluzzi et al. [1].

  • GalF: 5' TGTCTGCCGTGGACTTAGTGCT 3'
  • GalR 5' ATGGCACAACGACTTGGTAGG 3'

Initial concentration of the primers was 100 µM. They were diluted twice, first by 10x and then by 50x, to the final concentration of 200 nM.

Table 35. PCR Samples Composition. Reaction volume = 20 µl

PCR Reagent Volume [µl]
DNA template 9,2
PCR Mix (A&A Biotechnology) 10
Primer FOR 0,4
Primer REV 0,4

Table 36. PCR Reaction Conditions (source description - 16/05)

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 98 30
Denaturation 98 10
Annealing 67 60
Elongation 72 5
Final Elongation 72 300

Number of cycles: 40

DNA Electrophoresis of the PCR Product

Electrophoresis was performed in 2% agar gel at 85 V for 45 min. 10 µl of each PCR product were added to the wells of the gel. Two distinct DNA standards were used: GeneRuler 1kB DNA Ladder and O'GeneRuler DNA Ladder Mix.


Figure 33. Gel Electrophoresis of the PCR Product – Results.

  • 1 – O'GeneRuler DNA Ladder Mix
  • 2 – high-volume culture
  • 3 – 2W1D
  • 4 – 1BW11
  • 5 – 2W11
  • 6 – colony PCR
  • 7 – O'GeneRuler 1 kB DNA Ladder Mix
Conclusion

The specific PCR product of the correct length was observed only in row 3, which refers to the 2W1D culture. The other rows either contain unspecific products or no products at all. Based on these results, it can be concluded that the 2W1D culture (the one growing in darkness) contains the ITS2 sequence from the Prymnesium parvum genome.

Oder Water Environmental Samples Collected in July

Six environmental samples of Oder water were collected from the Czernica lake.


Figure 34. Environmental sample collection site of L1, L2, and L3


Figure 35. Environmental sample collection site of L4


Figure 36. Environmental sample collection site of L5


Figure 37. Environmental sample collection site of L6

Liquid Cultures from the July Oder Water Samples

This protocol is also available on the Experiments page under the Setting up liquid algal cultures protocol.

Six liquid algae cultures were prepared from the collected Oder water samples. The samples were centrifuged for 5 minutes at 2000 rpm and the sediment was suspended in 10 ml of F/2 medium prepared from Szczecin ingredients.

The cultures were named L1, L2, L3, L4, L5, L6 from the Polish word for “July” – “lipiec”.

Algal DNA Isolation

Purposes:

  • DNA template supply for the SHERLOCK lab experiments
  • Obtaining algal DNA directly from Oder water samples

The isolation protocol is available on the Experiments page under the Algal DNA isolation with NEB isolation kit protocol.

DNA was isolated from the liquid cultures NOW 5.1, BOW 2, Szczecin/F2 Szczecin, and from Oder water samples L1, L4, L6.

Liquid cultures were centrifuged (13 500 rpm, 5 min). The supernatants were disposed of and the pellets were utilized for DNA isolation with the Monarch Genomic DNA Purification Kit (NEB) following the modified manufacturer's protocol, which was described in detail on 27/06. DNA was eluted with 50 µl of pure water.

Table 37. Concentration of the isolated DNA

Sample name DNA concentration [ng/µl] A260/A280 A260/A230
Szczecin/F2 Szczecin 7,3 1,71 1,08
BOW 2 71,4 1,51 0,66
NOW 5.1 19,0 1,69 1,20
L1 80,6 1,52 0,62
L4 27,5 1,56 0,65
L6 6,6 1,63 0,76

PCR on the isolated DNA

Purpose: Verification of the Prymnesium parvum ITS2 sequence in newly isolated DNA samples. Galluzi primers were used.

The PCR protocol is also available on the Experiments page under the PCR reaction on DNA isolated from algae cultures protocol.

Primers for the PCR reaction were the same as used by Galluzzi et. al. [1]:

  • FOR primer: 5' TGTCTGCCGTGGACTTAGTGCT 3'
  • REV primer: 5' ATGGCACAACGACTTGGTAGG 3'

Initial concentration of the primers was 100 µM. They were diluted twice, firstly 10x and then 50x, to the proper final concentration of 200 nM.

Newly isolated DNA samples used as the template:

  • Szczecin/F2 Szczecin
  • BOW 2
  • NOW 5.1
  • L1
  • L4
  • L6

Table 38. PCR samples composition. Reaction volume = 10 µl

PCR reagent Volume [µl]
DNA template 2
PCR Mix (A&A Biotechnology) 5
Primer mix 0,5
Water 2,5

Table 39. PCR reaction conditions (source description - 16/05)

Reaction step Temperature [°C] Time [s]
Pre-denaturation 98 30
Denaturation 98 10
Annealing 67 60
Elongation 72 5
Final elongation 72 300

Number of cycles: 40

DNA electrophoresis of the PCR product will be performed in a few days (described 17/07 in this notebook).

15.07 - 21.07

Algae culture – consultation

After consulting with Paweł Brzezowski, a staff member from the Department of Biochemistry and Plant Physiology JU, attention was drawn to two aspects:

  • Concentrations of the stock solutions used for F/2 medium preparation. The concentration of each stock was ten times lower than intended because of a calculation error during the initial medium preparation.
  • Appropriate pH of F/2 medium. So far, the pH of the newly prepared portions of F/2 medium has not been monitored. This oversight is due to lack of expertise in algae culture.
Conclusions after the consultation

Taking these two factors into account, algae growth in all cultures prepared so far was not optimal due to disturbances in the F/2 medium composition and its pH. A hypothesis was made that these stressful conditions could trigger the observed algal morphological change and contribute to growth slowdown.

New stock solutions for F/2 medium

The concentrations of stock solutions were recalculated and corrected. New stock solutions were prepared in the same final quantities as described on 10/05 (Table 1).

F/2 Medium Preparation (Corrected Version)

The medium preparation protocol is also available on the Experiments page under the F/2 medium preparation protocol.

The F/2 medium was prepared by using newly made 100x concentrated stocks. Total medium volume: 400 ml, which contains:

  • 4 ml of each of 9 stocks (36 ml in total)
  • 364 ml of distilled water
  • 6.4 g of sea salt (16 g/L)
  • 1320 µl of NaOH to optimise pH of the medium (from pH=5.12 to pH=7.9)

According to the literature data, the pH of the F/2 medium should be approximately 8. The pH of the medium was measured with a pH metre.

After mixing all the ingredients, the medium was sterilised in a microwave autoclave.

Algal Cell Passage

Newly prepared F/2 medium was used to perform this passage. The passage was carried out in the same manner as described on 03/06. Cultures NOW 31 and NOW 81 were coloured green and were not passaged. As a result, new liquid cultures were made:

  • 1W111
  • 2W111
  • 1BW111
  • NOW 411
  • NOW 511
  • NOW 5.111
  • BOW 111
  • BOW 211

Attempt of Setting up a Pure Prymnesium parvum Culture

Purpose: Isolating single Prymnesium parvum colonies from algae liquid cultures. Such colonies can give a start to a pure Prymnesium parvum laboratory culture.

5 ml of NOW 5 liquid culture was collected to a 15 ml Falcon tube and a series of centrifugation steps were performed. Table 40 shows the centrifugation conditions that were utilised. After each centrifugation, the supernatants were transferred into new tubes for another centrifugation. The pellets were suspended in 500 µl of F/2 medium, appropriately diluted, and then transferred into previously prepared 1% agar plates containing the F/2 medium. The plates were left in the culture room with a 14 h/10 h light/dark cycle.

Table 40. Centrifugation Conditions

Centrifugation RCF Time [min] Pellets Dilutions Temperature [°C]
1. 100 3 10­⁶ / 10⁹ 4
2. 500 3 10­¹ / 10³ 4
3. 1000 3 10­¹ / 10³ 4
4. 3000 3 10­¹ / 10³ 4

Algal DNA Isolation – In-field Method

Purpose: Evaluation of a fast DNA isolation method that could prospectively be performed in field conditions, simplifying the workflow required for the SHERLOCK assay. The method was originally described by Zou et al. [4].

The isolation protocol is also available on the Experiments page under the DNA isolation - in-field method protocol.

Two buffers required for this isolation method were prepared in a volume of 50 ml: a lysis buffer and a wash buffer.

  • Lysis buffer:
    • 25 mM NaCl
    • 2.5 mM EDTA
    • 0.05% SDS
    • 20 mM Tris (pH=8.0)
    • Water
  • Wash buffer:
    • 10 mM Tris (pH=8.0)
    • 0.1% Tween 20%
    • Water

Three different isolation sticks were used:

  • Citotest swab sticks (C)
  • Aptaca swab sticks (A)
  • Whatman’s paper cut into 2 mm strips (W), impregnated with wax

To perform this isolation method, two steel ball bearings were used. A 500 µl aliquot of the liquid culture was added to a 2 ml Eppendorf tube containing 500 µl of lysis buffer. Two ball bearings were then added, and the tube was shaken for 8 seconds. The isolation stick was dipped into the mixture three times, followed by dipping the stick three times into another Eppendorf tube containing 1.75 ml of wash buffer. The material was then transferred to the previously prepared PCR mix in a PCR tube.

The isolated DNA was directly transferred to the PCR reaction mixture. Table 41 shows the mixture composition.

Table 41. PCR Samples Composition. Reaction Volume = 20 ul

PCR Reagent Volume [µl]
PCR Mix (A&A Biotechnology) 10
Primer mix 1
Water 9

Table 42. PCR Reaction Conditions

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 98 30
Denaturation 98 10
Annealing 67 60
Elongation 72 5
Final Elongation 72 300

Number of cycles: 30

DNA electrophoresis of the PCR product will be performed the next day after the PCR. (Described 17/07 in this notebook).

DNA Electrophoresis – Multiple PCR Products

Purpose: The PCR products from the following reactions were subjected to electrophoresis:

  • PCR products from the DNA isolated from July Oder water samples (11/07)
  • PCR products from the field DNA isolation (16/07)
  • PCR products from the reaction performed on the KAC product (17/07)


Figure 38. Gel electrophoresis of PCR products – results.

Legend:

  • 1 – O'GeneRuler DNA Ladder Mix
  • 2 – Szczecin/F2 Szczecin
  • 3 – BOW 2
  • 4 – NOW 5.1
  • 5 – L1
  • 6 – L4
  • 7 – L6
  • 8 – mistake
  • 9 – mistake
  • 10 – KAC
  • 11 – NC (NOW 5.1 using Citotest stick)
  • 12 – NA (NOW 5.1 using Aptaca stick)
  • 13 – NW (NOW 5.1 using Whatman stick)
  • 14 – MC (BOW 2 using Citotest stick)
  • 15 – MA
  • 16 – MW
  • 17 – LC
  • 18 – LA
  • 19 – LW
  • 20 – O'GeneRuler 1 kb DNA Ladder Mix
Conclusions

Clear stripes are visible in rows 2-7, referring to the specific PCR product of the correct length, indicating that the DNA isolated on 11/07 contains the Prymnesium parvum genome.

The KAC product contains the Prymnesium parvum ITS2 sequence (row 10).

No specific product was obtained from any of the samples following field DNA isolation. However, it can be concluded that the Whatman stick is the most efficient, as primer dimers are visible, suggesting that the Whatman stick does not absorb the PCR reagents as much as the other tested sticks [11-19].

Cultures on Agar Medium – Prymnesium Parvum Pure Culture Attempt

The agar F/2 medium was prepared in the same manner as described 10/05:

  • Total medium volume: 400 ml
  • Agar: 4 g
  • Sea salt: 1,2 g

5 ml of the NOW 5.1 liquid culture was centrifuged (100 g, 5 min), and the supernatant was separated. The pellet was diluted in F/2 medium to concentrations of 106 and 109 and spread on agar plates. The supernatant was then centrifuged (500 g, 5 min), the supernatant was separated again, and the pellet was diluted in F/2 medium to concentrations of 101 and 103 and spread on agar plates.

The process was repeated twice more:

  • Centrifugation at 1000 g for 5 min: pellet diluted to 101 and 103 and spread on plates
  • Centrifugation at 3000 g for 5 min: pellet diluted to 101 and 103 and spread on plates

The plates were secured with parafilm and left in the growth chamber with a 14 h/10 h light/dark cycle.

22.07 - 28.07

Algal DNA Isolation – In-Field Method, Second Attempt

Purpose: Evaluation of a fast DNA isolation method that could prospectively be performed in field conditions, simplifying the workflow required for the SHERLOCK assay. The method was originally described by Zou et. al. [4]. In this second attempt, the isolation method was slightly modified.

Selected Cultures Based on Macroscopic Observation:

  • NOW 5.1
  • Szczecin
  • L1
  • L4

The isolation protocol is also available on the Experiments page under the DNA Isolation - In-Field Method Protocol.

The isolation was performed using previously prepared lysis and wash buffers in the same manner as described on 16/07. In addition to Whatman paper dipsticks, two other types of sticks were tested, sourced from different COVID tests purchased at a pharmacy. These sticks were labeled as "A" and "C" for this experiment.

After washing the DNA with the wash buffer, the stick was dipped into 15 µl of water for DNA elution. The eluted DNA was then transferred into the PCR reaction mix.

PCR After the In-Field Isolation

The isolated DNA was eluted into water and then transferred into the tube containing the PCR reaction mix, which included Galluzzi primers.

The PCR protocol is also available on the Experiments page under the PCR Reaction on DNA Isolated from Algae Cultures Protocol.

Table 45: PCR Samples Composition. Reaction volume = 20 µl

PCR Reagent Volume [µl]
Water with the isolated DNA 9
PCR Mix (A&A Biotechnology) 10
Primer Mix 1

Table 46: PCR Reaction Conditions Based on Manufacturer's Instructions (A&A Biotechnology)

Reaction Step Temperature [°C] Time [s]
Pre-denaturation 95 60
Denaturation 95 15
Annealing 67 60
Elongation 72 15
Final Elongation 72 300

Number of Cycles: 30

DNA Electrophoresis of the PCR Product

Electrophoresis was performed in a 2% agar gel at 85 V for 45 minutes. 5 µl of each PCR product was added to the wells of the gel. Two distinct DNA standards were used: GeneRuler 1 kB DNA Ladder and O'GeneRuler DNA Ladder Mix (SM033).


Figure 39. Gel Electrophoresis of the PCR Product – Results.

Conclusions

No specific product was received in any of the rows. The visible stripes are primer dimers. The reaction should be repeated.

29.07 - 04.08

Disposal of Algae Cultures

Purpose: The main goal of the project has been successfully achieved, so there is no longer a need to supply additional DNA templates for the SHERLOCK lab. Consequently, most of the algae cultures can be disposed of.

The following liquid cultures were transferred to the Department of Biochemistry and Plant Physiology JU for further scientific research: 2W111, NOW 511, NOW 5.111, BOW 111, BOW 211, Szczecin, Szczecin F/2, and Szczecin.

The remaining liquid cultures and all plate cultures were disposed of according to the protocol available on the Experiments page under the Algae Liquid Culture Disposal Protocol.

Prymnesium parvum Pure Culture Attempt – Summary

Summary: Due to limited access to the laboratory, the goal of establishing a pure culture of Prymnesium parvum could not be achieved. However, the best-maintained cultures, along with the knowledge and experience gained during the work in the Alga Lab, remain available for future iGEM teams.

In-field DNA Isolation – Summary

Summary: Limited laboratory access prevented further work on achieving successful in-field DNA isolation, and as a result, this goal was not met. Nonetheless, an important insight has been acquired that remains at the disposal of future iGEM teams working on the in-field isolation of DNA from Prymnesium parvum or similar harmful species. A potentially valuable method has been identified and needs further investigation.

Resources
  • Galluzzi, L., Bertozzini, E., Penna, A., Perini, F., Pigalarga, A., Graneli, E. and Magnani, M. (2008), Detection and quantification of Prymnesium parvum (Haptophyceae) by real-time PCR. Letters in Applied Microbiology, 46: 261-266.
  • White, T.J., T. Bruns, S. Lee, and J.W. Taylor. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 In: PCR Protocols: A Guide to Methods and Applications, eds. Innis, M.A., D.H. Gelfand, J.J. Sninsky, and T.J. White. Academic Press, Inc., New York.
  • Binzer, S.B., Svenssen, D.K., Daugbjerg, N., Alves-de-Souza, C., Pinto, E., Hansen, P.J., Larsen, T.O., Varga, E. (2019). A-, B- and C-type prymnesins are clade specific compounds and chemotaxonomic markers in Prymnesium parvum. Harmful Algae. 81: 10-17.
  • Zou, Y., Mason, M.G., Wang, Y., Wee, E., Turni, C., Blackall, P.J., et al. (2017). Nucleic acid purification from plants, animals, and microbes in under 30 seconds. PLOS Biology, 15(11): e2003916.
  • Raport Kończący Prace Zespołu ds. Sytuacji w Odrze. Instytut Ochrony Środowiska - Państwowy Instytut Badawczy. https://ios.edu.pl/wp-content/uploads/2022/12/raport-konczacy-prace-zespolu-ds-sytuacji-w-odrze-2.pdf

Dry Lab



PrymChip Lab


12.2023

The primary goal of the PrymChip Lab was to design and build a portable microfluidic device for conducting in the field SHERLOCK reaction and fluorescence detection.

We began a collaboration with the Garage of Complexity, part of the Faculty of Physics, Astronomy, and Applied Computer Science at Jagiellonian University. Through this partnership, we gained access to two Prusa i3 MK3 3D printers, which use Fused Deposition Modelling (FDM) technology. Professor Jakub Mielczarek introduced us to 3D printing software, including TinkerCAD and PrusaSlicer, and trained us in the operation of the printers. Since then, we have supplemented our learning by exploring various YouTube videos and websites to deepen our knowledge of design and 3D printing with filaments.

Most useful websites:

Most useful YouTube channels:

01.2024

We began designing a microfluidic system (Figure 2) based on the pe3Dish technology, which enables the creation of continuous perfusion 3D cell cultures equipped with channels that mimic vascular systems, as illustrated in Figure 1 (designed in part by Professor Jakub Mielczarek).


Figure 1. Photo of the pe3Dish (source: https://pe3dish.com/).


Figure 2. Primary microfluidic system (designed in Noteshelf).

The first model was designed in TinkerCAD as a square chamber with inlets and outlets for different fluids (Figure 3A). The second model followed a similar design but was adapted to fit the bottom of a 90 mm diameter plastic Petri dish, with thicker holders for the tubes as the thinner ones easily got damaged and fell off (Figure 3B).


Figure 3A. Primary microfluidic chamber based on pe3Dish system. Model 1.


Figure 3B. Primary microfluidic chamber based on pe3Dish system. Model 2.

Both models were printed using white PLA filament (Prusament PLA Pristine White). The 3D printing parameters were based on the previous experience of colleagues with this specific filament. Detailed 3D printing parameters are available in the files named Model_1_print and Model_2_print, while the models themselves can be found as STL files under Model_1_stl and Model_2_stl.

Photos of the successfully printed models are shown in Figure 4.



Figure 4. Primary microfluidic chambers based on the pe3Dish system. Printed Model 2 with and without the tubes.

02.2024

After considering the small volumes of SHERLOCK assay reagents required for the reaction, the decision was made to abandon the use of tubes for incorporating fluids into the reaction chamber.

Figure 5. Model 2 with tubes.


The approach shifted toward designing a 3D-printed device with a smaller reaction chamber, aimed at detecting fluorescence without the need for using tubes. The detection system was based on a device described in the paper “Machine Learning-Driven and Smartphone-Based Fluorescence Detection for CRISPR Diagnostic of SARS-CoV-2”. A simple schematic of the final device, including its electronic components, is shown in Figure 6.

After conducting research on designing an LED circuit, the necessary parts were ordered. Additionally, the PLA filaments were replaced with PETG filaments in four colors reflecting the iGEM JU-Krakow logo, along with a transparent filament for the reaction chamber. This change was made because PETG is more suitable for environmental applications, whereas PLA is biodegradable and less durable for such purposes.

Used filaments are listed below:

  • Jet Black PETG (Prusa PETG, source: X)
  • Mango Yellow PETG (Prusa PETG, source: X)
  • Purple PETG (Polymaker PolyLite PETG, source: X)
  • Transparent PETG (Devil Design PETG, source: X)


Figure 6. A simple schematic of how the PrymChip is designed to function.

The LEDs emit blue light that excites the fluorescence substrate appended to the reporter which results in green fluorescence light that goes through a green filter, then is focused by a lens and captured using a smartphone's camera.

The primary 3D model of the device, now called the PrymChip, is shown in Figure 7. It consists of two boxes:

  • One for the excitation and detection of green fluorescence.
  • The other for storing spare parts and reagents required for the SHERLOCK reaction.


Figure 7. Primary 3D model of the PrymChip, designed in TinkerCAD.

03.2024

The initial design of the box consisted of three boxes without lids, printed within the recommended temperature range for the filaments. The results were unsatisfactory, so it was decided to print temperature towers for each filament to determine the optimal printing temperatures.


Figure 8. Primary design of the three boxes.

The LEDs and battery were connected to verify the functionality of the electronic circuit. As shown in the photo below, the circuit operated correctly and did not require any further adjustments.


Figure 9. Electronic circuit.

04.2024

To determine the optimal printing parameters for PETG filaments, temperature towers were printed with each filament. These towers indicate the best temperature settings for each type of filament and are shown in Figure 10.


Figure 10. Temperature towers of PETG filaments.

Improved designs for the black and yellow boxes were prepared, as illustrated in Figure 11.


Figure 11. Models of the black and the yellow box.

Chambers for the reaction were designed to fit a 14 mm round cover slip. These chambers were tested for leakage and fluorescence. The chamber with the thinner bottom was found to leak. It was also found that the transparent PETG filament emitted a green fluorescent signal. Consequently, the PETG lid was replaced with a lid cut from a hairspray bottle, which was sized to fit properly into the black box.


Figure 12. Green signal emitted by a transparent PETG filament.


Figure 13. Lid from a hairspray bottle.


Figure 14. Designs of the 3D printed reaction chambers.

05.2024

Covers for the boxes were designed to fit snugly using a sliding mechanism. The black cover required some modifications to ensure a proper fit, while the yellow lid fit well. Additionally, colorblind-friendly symbols were added as markings on each box. Concave and convex symbols were printed at different heights to determine the most effective design. A height of 1.5 mm and a convex shape were selected for each box.


Figure 15. Lids for the black and the yellow box.


Figure 16. Colorblind-friendly symbols with different heights (convex and concave).

06.2024

An improved cover for the black box was designed to fit the green filter and the selected lens (Figure 17). Additionally, a cover for the reaction chamber was created to securely hold a glass slide on top and facilitate the removal of liquid from inside the chamber (Figure 17).


Figure 17. Lid for the detection box and a cover for a reaction chamber.

07.2024

Since the prototype of the device was ready, it was decided to start the tests with fluorescein.

Fluorescein from the Fluorescence Measurement Kit was used to prepare different concentrations of the fluorescein. Fluorescein was centrifuged in a table-top minifuge. It was then dissolved in 1 ml of PBS. Different concentrations of fluorescein were prepared, starting from 100 μM down to 0.8 μM. The next concentrations were prepared by serial 2x-dilution. This was done by transferring 250 μl of the higher concentration to a new Eppendorf and adding 250 μl of PBS. Samples were mixed and transferred with a pipette to a detection chamber.

The PrymChip was turned on, and a photo of the fluorescence was taken 5 seconds after turning on the LED lights. The solution was then transferred back to the Eppendorf and diluted 2 times. The chamber was washed with distilled water and wiped with tissue paper after each photo. Resulting photos from different concentrations are shown below. They were used for further analysis in Python, which is described in detail in the “Software” section. Photos were taken using a chamber with and without the glass holder, with 3 different phones, as indicated in the description of each set of photos.


Figure 18. Photos from the PrymChip – fluorescein testing.

By the naked eye, the green signal was visible at a concentration of 6.25 µM. The software was able to detect signals from the highest concentration down to 6.25 µM. Concentrations of 3.13 µM and lower appeared as a black image. Using a stronger light to excite the fluorescence signal may improve the detection and yield better results.

As tests using fluorescein fared auspiciously, we decided to conduct tests using the fluorescent reporter used in the SHERLOCK Lab.

The RNase Control Reagent was tested as follows: 40 µL of RNaseAlert™ substrate (from RNaseAlert™ Lab Test Kit v2, Invitrogen) was added to 397.5 µL of distilled H₂O. This solution was then diluted twice, resulting in concentrations ranging from 1 µM to 0.008 µM. To each concentration, 62.5 µL of RNase was added, and the mixture was transferred to the detection chamber. The PrymChip was activated, and a photo of the fluorescence was taken 5 seconds after turning on the LED lights. After each photo was taken, the chamber was washed with distilled water and wiped with tissue paper. The resulting photo for the highest concentration is shown below. No signal was visible in the photos, indicating that the light source was not strong enough to excite the fluorescence, and perhaps the wavelength was not appropriate for the alert testing.


Figure 19. Photos from the PrymChip – RNase alert testing.

08.2024

A purple box was designed and printed based on the known dimensions of the parts it would contain (Figure 20). Additionally, new covers for the boxes were printed, each featuring a symbol to aid recognition for colorblind individuals (Figure 20). A customizable holder for an Eppendorf tube was also printed and can be attached with glue inside the purple box (Figure 20). Additional ideas for removable parts are shown in Figure 21.


Figure 20. Models of lids and a purple box.


Figure 21. Removable parts that can be printed for the tool box. (A) Eppendorf holder 1. (B) Eppendorf holder 2. (C) Syringe holder. Sources: Eppendorf holder 1, Eppendorf holder 2, Syringe holder.

09.2024

After adding additional symbols to the boxes' lids, the phone became unstable and required extra support to remain in place. Movable supports were designed to match the height of the box. The design of these supports is shown in Figure 22. The printed support is depicted in Figure X, and the support attached to the box is shown in Figure X. The addition of the supports did not affect the visibility of the chamber through the phone camera.


Figure 22. Supports printed for the smartphone. (A) Design of the support. (B) Printed supports. (C) Supports attached to the PrymChip.

Genome Lab / Bioinformatics


The bioinformatics support was conducted in "when-needed" manner and it does not follow a single workflow or protocol.
For this reason this section might appear less structured that previous sections, please treat it as supplementary to main project goals.

Main research topics:

  • ITS1-5.8S-ITS2 fragment analysis
  • Genome from Gdańsk quality assessment
  • PCR results analysis (KAC39 emergence from GAL-PCR)
  • PCR 2 results analysis (failed KAC39-PCR sequencing)
  • RPA primer design/optimization
  • Continuous support / literature search (White 1990, ODER1 etc.)

10-11.2023

A-, B-, and C-type prymnesins as chemotaxonomic markers in Prymnesium parvum is a main paper discussed in this section.

Key Research Questions:
  • Are ITS sequences related to prymnesin types?
  • Can ITS sequences be used to differentiate subtypes of Prymnesium?
  • Are the 5.8S regions more conserved than ITS regions?
  • Can the ITS1-5.8S-ITS2 fragment be used for crRNA design?
Are ITS sequences related to the type of prymnesin?

ITS (Internal Transcribed Spacer) sequences are often used in phylogenetic studies to differentiate between species or strains within a species, as they vary even between closely related organisms. Different strains/clades, differentiated by their ITS sequences, produce different types of prymnesins, making ITS sequences indirectly correlated with prymnesin production.

Can ITS sequences be used to differentiate subtypes of Prymnesium?

To explore this, the ITS1-5.8S-ITS2 fragment of various Prymnesium subtypes was analyzed in MEGA11 software using the MUSCLE algorithm. There are 26 strains of prymnesium described in the paper. After aligning them with the “DNA” option, the MUSCLE algorithm and these, default options:


Figure 1. Default MUSCLE setting used in MEGA.


Results were obtained:



Figure 2. Alignment of 26 Prymnesium strains with type B ITS1 highlighted in yellow.


Figure 2 enlarged. Alignment of type B ITS1 end fragment.

On the left text box you can see 26 prymnesium strains, as described in the paper with the type annotated (A, B or C).
On the right there are colourful sequences after alignment, the fragment shown is the transition from the ITS1 to the 5.8S rRNA.
Yellow box is the end of the ITS1 sequence of type B prymnesium derived from Prymnesium parvum partial ITS1, 5.8S rRNA gene and partial ITS2, isolate KAC39 GenBank: AM690999.1 (older annotation, I later switched to the KJ756812.1). I used the sequences from this position because the 26 prymnesium strains were not annotated and I wanted to know exactly what is the sequence of ITS1 etc.

All the 6 yellow highlighted sequences are of type B — this results shows that it is possible to distinguish type B prymnesium from the rest using even the short fragment of ITS1 sequence.
Here the custom sequence:

>short ITS1 end fragment from Prymnesium AM690999.1
CGGTCGTTGAGGATCCCCCTCGTCGTGCCCCTGCGCGTTGCGCTCTCGGGCACGCAAGAATTGTTGAA

was used.
Furthermore, based on the map from the paper:


Figure 3. Location origins for 26 strains described in A-, B-, and C-type prymnesins.

All the Prymnesium strains from countries neighbouring Poland are of type B - so we can suspect that the Prymnesium from the Oder river is also of type B

Further, very short fragment was analysed:


Figure 4. Short fragment analysis for type B ITS1.

And similarly, for the ITS2 sequence:


Figure 5. Alignment of type B ITS2 sequence (short fragment).

This shows that it is possible to design crRNA within the ITS2 sequence, similarly to the ITS1-5.8S from the figures above. It is important to note that using 5.8S-ITS2 transition fragment might not be desirable because the beginning of the ITS2 sequence is identical for all the strains and would not be able do distinguish between the strains:


Figure 6. Alignment of 26 prymnesium strains with yellow highlight showing 5.8S-ITS2 sequence frament.

The above analysis shows that different areas of ITS1-5.8S-ITS2 can be selected as a potential target for crRNA to specifically detect type B prymnesium. Since we are interested in type B prymnesium the analysis didn’t involve finding sequences specific for type A / type C.

Are 5.8S more and ITS less conservative?

Here is shown the transition area from ITS1 to 5.8S showing visible change in the level of similarity, suggesting high level of 5.8S stability and high level of ITS1 variability:


Figure 7. Alignment of 26 prymnesium strains displaying variability change between ITS1 and 5.8S sequences.

ITS2 follows a similar trend.

Can we use the ITS1-5.8S-ITS2 cluster to design crRNA?

The variability observed in ITS sequences supports the feasibility of designing crRNA specific to type B Prymnesium.

Extra Topics:

We also explored whether the ITS1-5.8S-ITS2 cluster can differentiate Prymnesium parvum from other algae found in the Oder river.


Figure 8. Alignment of Prymnesium parvum and other algae species in the Oder river (5.8S area).

Even in more conserved 5.8S region the sequences have few identities (marked with *) suggesting high variability between algae-similar species in the Oder river. There should be no problem using crRNA to specifically detect only Prymnesium.

Are the Galluzzi primers specific to all subtypes of Prymnesium?

Analysis of Galluzzi primers shows that the forward primer (GalF) is specific to type B, while the reverse primer (GalR) is specific to all subtypes. Thus, the primer set is specific only for type B Prymnesium.


Figure 9. Alignment of 26 Prymnesium parvum strains with GalF primer highlighted.


Figure 10. Alignment of 26 Prymnesium parvum strains with GalR primer highlighted.

This analysis demonstrates the potential for using ITS sequences in detecting and differentiating Prymnesium subtypes, particularly type B, in environmental samples.

11-12.2023

We received a big genome file with a lot of contings and no additional explanation. The primary goal is to find our ITS1-5.8S-ITS2 fragment. My approach was to use BLAST to search through the sequences looking for our query (ITS1-5.8S-ITS2 fragment). I tried to use the typical web BLAST, but the file was way too big and fragmenting it to contigs resulted in getting too many files. Ctrl + F is a bad idea since whitespaces/mismatches will render the search unsuccessful. You can install BLAST on your PC and omit most of the limitations. I built a local BLAST database from the Gdańsk genome file. The query was ITS1-5.8S-ITS2 sequence.

Here are the results:


Figure 11. Local BLAST search results from within the genome from Grańsk using ITS1-5.8S-ITS2 as a query.

Even though it seems something was found, we can immediately see that the length of a match is only ~119bp. The expected length of a ITS1-5.8S-ITS2 type B fragment is 672bp. The percentage of identities is also worrying – we used the query from type B prymnesium so the strain from the Oder river might have some unexpected mutations, but 91% identities is alarming.


We really want precision here and can’t rely on low-quality data. We could theoretically use any type B prymnesium from the database but any unexpected change in the strain from the Oder river could render our crRNAs useless. To further investigate the worrying blast results I took the sequences marked as somewhat similar to the query and used them in the traditional web-blast.


Figure 12. One of the top local BLAST results used in a web-BLAST search.

And obtained results:


Figure 13. Results from using local BLAST top-scoring sequences in a web-BLAST search.

  • This sequence is therefore not specific to Prymnesium.
  • It could as well be the fragment from different algae.

Using different BLAST “hits” from the previous local BLAST search gives similar results.

As a final test I performed BUSCO analysis:


Figure 14. BUSCO results showcasing genome assembly quality.

BUSCO is an algorithm that checks the quality of the genome assembly.

Here we can see that only 59% of highly conserved sequences (sequences we really expect to see in the genome) are present. Additionally, 11% of sequences that should not be fragmented are fragmented.

This is not the worst result but combined with the previous BLAST analysis does not give us any confidence in using this genome.

05.2024

Based on sequencing results on Galluzzi primers, online nucleotide BLAST was performed for forward and reverse sequencing products.

PCR product_primerF
TAGCCTAYAGCTCGAGCGTCGCCTGAGGGCAGCGTTGCACGGGAGGATCCTCGGATCTGACGTGTGCCGACGTGCTAGTAGGCCGCCTACCAAGTCGTTGTGCCAAYGGCTTGTCTCGGCCAAA
                                    
PCR product_primerR
TGTCTGCCGTGGACTTAGTGCTGCGCCAGATCAAGGCTCGAGCGTCGCCTGAGGGCAGCGTTGCACGGGAGGATCCTCGGATCTGACGKGCCGACGCWWTCTG
                                    

Megablast with default setting for primerF:


Figure 15. Representation* of BLAST results from sequencing product from F_primer.

*This screenshot was not done at the time of the original analysis, it presents the results obtained the same way on 18.08.2024 so some sequences present here were not publicly available at the time of the original analysis.

Both search results pointed at the presence of a couple high-score results. Top results included Prymnesium strains:

  • KAC39 type B
  • UIO223 type B
  • ARC140 type B
  • SAG18.97 type B
  • K0374 type B
  • K0081 type B

All of these strains are from: A-, B- and C-type prymnesins are clade specific compounds and chemotaxonomic markers in Prymnesium parvum, and all produce type-B prymnesins. All are European strains apart from ARC140. KAC39 comes from a Norwegian sample, and SAG18.97 comes from a German sample, hence they come from countries close to Poland. KAC39 is identical to SAG19.97 (in terms of available nucleotide sequences).

The consensus sequence FOR FOR_PRIMER that gives the highest score in BLAST is:

seq from primer_F
GCTCGAGCGTCGCCTGAGGGCAGCGTTGCACGGGAGGATCCTCGGATCTGACGTGTGCCGACGTGCTAGTAGGCCGCCTACCAAGTCGTTGTGCCA
                                    

And that sequence is identical in all 6 strains of prymnesium as shown below:


Figure 16. Alignment of 6 type B prymnesium with PCR product sequence highlighted in yellow.

Additionally, all the 6 type B Prymnesium strains mentioned above and shown in the BLAST result have IDENTICAL SEQUENCE ALONG THE WHOLE ENTRY. All the 672 nucleotides are the same. Looking only at the available ITS1-5.8S-ITS2 fragment, the 6 strains are identical. It is therefore impossible to determine which strain we currently have, and from the point of sequence, it does not matter since all type B prymnesium are identical when it comes to the ITS1-5.8S-ITS2 fragment available in the database.


We still need to be careful with further analysis, because there is no guarantee that our Prymnesium from the Oder river doesn't have some surprising changes in that fragment.

Megablast with default setting for primerR:


Figure 17. Representation of BLAST results from sequencing product from R_primer.

Same situation here with sequences:

  • KAC39 type B
  • UIO223 type B
  • ARC140 type B
  • SAG18.97 type B
  • K0374 type B
  • K0081 type B
seq from primer R
TGTCTGCCGTGGACTTAGTGCTGCGCCAGATCAAGGCTCGAGCGTCGCCTGAGGGCAGCGTTGCACGGGAGGATCCTCGGATCTGACGKG--CCGACG
                                    

This time there are two gaps present — it might be the result of lower sequencing quality along the end and beginning of the sequence. Also, there is a "K" nucleotide, so I propose to keep only the solid sequence:

TGTCTGCCGTGGACTTAGTGCTGCGCCAGATCAAGGCTCGAGCGTCGCCTGAGGGCAGCGTTGCACGGGAGGATCCTCGGATCTGACG
                                    

The entire joined forward and reverse consensus is therefore:

sequencing result full
TGTCTGCCGTGGACTTAGTGCTGCGCCAGATCAAGGCTCGAGCGTCGCCTGAGGGCAGCGTTGCACGGGAGGATCCTCGGATCTGACGTGTGCCGACGTGCTAGTAGGCCGCCTACCAAGTCGTTGTGCCA
                                    
SUMMARY

BLAST analysis on both products confirmed that we have a type B prymnesium, as all top results are type B prymnesium. We cannot determine which strain we have because our product perfectly matches all 6 strains of type B prymnesium. All 6 strains of type B prymnesium (ITS1-5.8S-ITS2 fragment) are identical. We choose to continue with the KAC39 sequence.

Within the KAC39, our PCR product consensus was marked with green letters (see below). KAC39 sequence was downloaded and annotated according to the KJ756812.1 [Prymnesium parvum strain CCAP 946/6] as this was the most recent annotated file about prymnesium parvum at the time.

There are differences in what sequence is considered ITS and what is not (GenBank: AM690999.1 is an old KAC39 sequence and provides a different annotation). I don't know if this is the most valid way of annotating the sequence – I assumed the name of a given fragment is not critically important for us and annotated the KAC39 in a rough way. Below is the resulting KAC39 file with annotation and consensus PCR product sequence marked in green, displayed in SnapGene.


Figure 18. KAC39 sequence with consensus (forward and reverse PCR products) sequence marked in green.

After agreeing upon KAC39 being the representation of our sequence, we designed PCR primers at the beginning and the end of the KAC39 sequence.

KAC39 forward

ATCATTACCGGTCTTTCCACCCAC

KAC39 reverse

GAGTCCAATGGTGCGCGC

We had some problems with the PCR that led me to further investigate the availability of primers for PCR/RPA. Please see the “White 1990 paper section” for further information.

When I was investigating problems with the KAC39 primers, I found the White 1990 paper describing many sequences for amplifying the ribosomal regions. That's where we found the ITS1 – ITS4 sequence that was originally used to obtain the KAC39 sequence in the A-, B- and C-type prymnesins are clade specific… paper.

Alt F

This forward primer is designed to specifically detect Prymnesium parvum genomic DNA in an RPA (Recombinase Polymerase Amplification) reaction. It binds to the ITS2 region. "Alt" is an acronym for alternative - the primer was designed in the Primer-BLAST online tool using directions from TwistAmp® DNA Amplification Kits Assay Design Manual [1].

Biology and usage

The 5.8S rRNA is part of the large ribosomal subunit in eukaryotes, along with 28S and 5S rRNAs, and is encoded within a ribosomal cistron that also includes 18S and 28S rRNAs. The 5.8S rRNA, along with its associated ITS regions, is used in phylogenetic studies to differentiate species due to the high variability of the ITS regions between species [2].

Sequence source and design

This sequence was designed by our team using the KAC39 sequence fragment [3], with the goal to obtain alternative primers to those from the “Establishment of methods for rapid detection of Prymnesium parvum by recombinase polymerase amplification combined with a lateral flow dipstick” paper. As mentioned previously, the TwistAmp® DNA Amplification Kits Assay Design Manual was used to obtain optimal parameters, and Primer-BLAST was used to obtain sequences and ensure specificity.

Alt R

This reverse primer is designed to specifically detect Prymnesium parvum genomic DNA in an RPA reaction. It binds to the end of a 5.8S rRNA region. "Alt" is an acronym for alternative - the primer was designed in the Primer-BLAST online tool using directions from TwistAmp® DNA Amplification Kits Assay Design Manual [1].

Biology and usage

The 5.8S rRNA is part of the large ribosomal subunit in eukaryotes, along with 28S and 5S rRNAs, and is encoded within a ribosomal cistron that also includes 18S and 28S rRNAs. The 5.8S rRNA, along with its associated ITS regions, is used in phylogenetic studies to differentiate species due to the high variability of the ITS regions between species [2].

Sequence source and design

This sequence was designed by our team using the KAC39 sequence fragment [3], with the goal to obtain alternative primers to those from the “Establishment of methods for rapid detection of Prymnesium parvum by recombinase polymerase amplification combined with a lateral flow dipstick” paper. As mentioned previously, the TwistAmp® DNA Amplification Kits Assay Design Manual was used to obtain optimal parameters, and Primer-BLAST was used to obtain sequences and ensure specificity.

Mod F

This sequence was introduced by the team of Luo et al. [4] and is designed for ITS sequencing of P. parvum.

Biology and usage

The 5.8S rRNA is part of the large ribosomal subunit in eukaryotes, along with 28S and 5S rRNAs, and is encoded within a ribosomal cistron that also includes 18S and 28S rRNAs. The 5.8S rRNA, along with its associated ITS regions, is used in phylogenetic studies to differentiate species due to the high variability of the ITS regions between species [2].

Sequence source and design

Mod F is an unmodified PR-RPA-4-F primer from the paper mentioned above [4]. PR-RPA-4-F/R were selected as the optimum primers for RPA reactions by the authors.

Mod R

This sequence was introduced by the team of Luo et al. [4] and is designed for ITS sequencing of P. parvum. Unlike the forward primer, the Mod R was modified to better align with our sequence.

Biology and usage

The 5.8S rRNA is part of the large ribosomal subunit in eukaryotes, along with 28S and 5S rRNAs, and is encoded within a ribosomal cistron that also includes 18S and 28S rRNAs. The 5.8S rRNA, along with its associated ITS regions, is used in phylogenetic studies to differentiate species due to the high variability of the ITS regions between species [2].

Sequence source and design

Mod R is a modified version of the PR-RPA-4-R primer from the paper mentioned above [4]. PR-RPA-4-F/R were selected as the optimum primers for RPA reactions by the authors. Because the original PR-RPA-4-R primer had a mismatch of "A" instead of "G" (with corresponding "C" on the second strand), we decided to modify this single nucleotide to achieve full identity with our KAC39 sequence fragment. The modification is as shown below, with the PR-RPA-4-R being the original sequence from the paper and the PR-RPA-4-R-mod referring to the Mod R sequence described here:


Figure 20. Original and modified PR-RPA-4 reverse primers.

Resources
  • [1] TwistAmp® DNA Amplification Kits Assay Design Manual
  • [2] Akhoundi, M., Downing, T., Votýpka, J., et al. (2017). Leishmania infections: Molecular targets and diagnosis. Molecular Aspects of Medicine, 57, 1-29. https://doi.org/10.1016/j.mam.2016.11.012
  • [3] Prymnesium parvum strain KAC39 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence GenBank: MK091113.1
  • [4] Luo, N., Huang, H., & Jiang, H. (2022). Establishment of methods for rapid detection of Prymnesium parvum by recombinase polymerase amplification combined with a lateral flow dipstick. Frontiers in Marine Science, 9. https://doi.org/10.3389/fmars.2022.1032847

Primer Table

Table 1: Primers/crRNAs used in the project.

Primer set/crRNA Target Prymnesium type For sequence (without T7 promoter etc.) For sequence (with T7 promoter etc.) Rev sequence (without T7 promoter etc.)
ModF & ModR 5.8S & ITS2 type B GAATCATCGAACTTTTGAACGCAACTGG GTAGGCGGCCTACTAGCACGTCGGCACA
ModF & AltR 5.8S & ITS2 type B GAATCATCGAACTTTTGAACGCAACTGG GTACCGGTGGGCGGAAACGCGACGACCTA
ModF & GalR 5.8S & ITS2 all types GAATCATCGAACTTTTGAACGCAACTGG GGCACAACGACTTGGTAGG
AltF & AltR 5.8S & ITS2 type B CTTCCAGGTTCCGCCTGGGAGCATGTTTCTTC GTACCGGTGGGCGGAAACGCGACGACCTA
AltF & ModR 5.8S & ITS2 type B CTTCCAGGTTCCGCCTGGGAGCATGTTTCTTC GTAGGCGGCCTACTAGCACGTCGGCACA
AltF & GalR 5.8S & ITS2 all types CTTCCAGGTTCCGCCTGGGAGCATGTTTCTTC GGCACAACGACTTGGTAGG
GalF & GalR ITS2 & ITS2 type B TGTCTGCCGTGGACTTAGTGCT GGCACAACGACTTGGTAGG
GalF & ModR ITS2 & ITS2 type B TGTCTGCCGTGGACTTAGTGCT GTAGGCGGCCTACTAGCACGTCGGCACA
GalF & AltR ITS2 & ITS2 type B TGTCTGCCGTGGACTTAGTGCT GTACCGGTGGGCGGAAACGCGACGACCTA
prymcrRNA1 ITS2 type A and B GCGCCAGATCAAGGCTCGAGCGTCGCCTG -
prymcrRNA2 ITS2 type A , B and some C GAGGGCAGCGTTGCACGGGAGGATCCTCG -
KAC39F & KAC39R ITS1 & ITS2 type A, B and some C ATCATTACCGGTCTTTCCACCCAC GAGTCCAATGGTGCGCGC
ModF 5.8S all types GAATCATCGAACTTTTGAACGCAACTGG GAAATTAATACGACTCACTATAGGGGAATCATCGAACTTTTGAACGCAACTGG -
ModR ITS2 type B - GTAGGCGGCCTACTAGCACGTCGGCACA
AltF 5.8S all types CTTCCAGGTTCCGCCTGGGAGCATGTTTCTTC GAAATTAATACGACTCACTATAGGGCTTCCAGGTTCCGCCTGGGAGCATGTTTCTTC -
AltR ITS2 type B - GTACCGGTGGGCGGAAACGCGACGACCTA
GalF ITS2 type B TGTCTGCCGTGGACTTAGTGCT GAAATTAATACGACTCACTATAGGGTGTCTGCCGTGGACTTAGTGCT -
GalR ITS2 all types - GGCACAACGACTTGGTAGG
KAC39F ITS1 all types ATCATTACCGGTCTTTCCACCCAC GAAATTAATACGACTCACTATAGGGATCATTACCGGTCTTTCCACCCAC -
KAC39R ITS2 type A, B and some C - GAGTCCAATGGTGCGCGC
ItsF 18S - TCCGTAGGTGAACCTGCGG GAAATTAATACGACTCACTATAGGGTCCGTAGGTGAACCTGCGG -
ItsR 28S - - TCCTCCGCTTAGTGATATGC

06-07.2024

A huge portion of my time from June to July 2024 was used for visualization of our wet-lab results. I performed some data preparation and visualization using Plotly (Python library). The Plotly library allows for the implementation of interactive plots, as well as saving the file as HTML, so that we can use it on our web page.

This was our second sequencing effort. This time we used sequencing products from KAC39 PCR primers. Using discontinuous BLAST (for less similar sequences) gave this result:


Figure 19. BLAST results from sequencing product from F_primer.

Lots of low-quality nucleotides, lots of mismatches. This is probably a distorted KAC39 sequence. In our case, single nucleotides matter.

08.2024

When I was rerunning the BLAST search on previous PCR products (PCR on Galluzzi primers) I received an additional result: Prymnesium parvum strain ODER1 chromosome 20 [CP154518.1]. The ODER1 references the Oder river, which is of interest to us.

The ODER1 sequence was added to the NCBI database on 06.07.2024, so we unfortunately could not make use of it earlier (although the assembly date points to December 2023). The article accompanying the data is: “The haplotype-resolved Prymnesium parvum (type B) microalga genome reveals the genetic basis of its fish-killing toxins.”

KAC39 is identical in 100% with the ODER1 sequence, which reassures us that our previous analyses were on the basis of merit.

Key Findings from the ODER1 Paper

  • Sequencing of genomic and chloroplast DNA
  • Prymnesium from the Oder river is a diploid
  • Type B genomes are bigger than type A genomes because of repeated regions.
  • There is a deletion in a PKS gene that explains differences between toxins of type A and type B.
  • K0081 from Denmark is the strain most closely related to Prymnesium from the Oder river.
  • Haptonema is used to attach to the prey.

ITS Copies Analysis

How many copies of ITS does the ODER1 strain hold?

Since this information isn’t available in the ODER1 paper, I will perform an analysis to try to determine the number of ITS sequences in the genome.

It is important to note that the article states:

“As a standard, samples from the Oder catastrophe (n = 80) in summer 2022 were counted microscopically (10 x 100) to calculate the correlation factor between qPCR-amplicon copy number of a DNA marker (Internal Transcribed Spacer 2: ITS2) and Prymnesium cell counts.”
“Cell equivalents were calculated from the ITS2 copy number (R^2 = 0.87).”

That means they found a correlation between ITS2 copy number and the number of cells. Unfortunately, the precise calculation is not disclosed.

First step: Check if the ITS sequence is present in more than one chromosome.

I copied the ITS1 sequence from the KAC39 sequence:

> KAC39 ITS1
ATCATTACCGGTCTTTCCACCCACACCAGTGCGTACCACTCGTCCCTTTGGGTCCGTCGGTGCTCGCATCGGCGGCTCATCTGTGCTCTTGCTTGAGCTGGCGCTCCGCGCGCCAGATCGGGCGGGACGCAGGCACTGTGTCCCGGACACAGCCACATCTCCTCCTCGGCCCTCGCCGGTCGTTGAGGATCCCCCTCGTCGTGCCCCTGCGCGTTGCGCTCTCGGGCACGCAAGAATTGTTGAA

I used it for an online BLAST search limiting organisms to Prymnesium parvum. As expected, ODER1 was among the top-scoring results—only the entry from chromosome 20 was present, suggesting that the ITS1 sequence is only present on chromosome 20.

Surprisingly, the number of hits to that sequence was 8 for haplotype CP154518.1 and 4 for haplotype CP154552.1. It is important to note that the matches to the ODER1 sequence were almost entirely 100% identity matches of the entire ITS1 fragment length, suggesting perfect multiplication of the ITS1 sequence.

Second step: I performed the same search for the 5.8S sequence:

> KAC39 5.8S rRNA
ACACACAACTCTTGTCGATGGATATCTTGGCTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAATGCGAATTGCAGAATTCAGTGAATCATCGAACTTTTGAACGCAACTGGCGCTTCCAGGTTCCGCCTGGGAGCATGTTTCTTCGAGTGGC

Same results were obtained for the 5.8S sequence: 8 hits for CP154518.1 and 4 for CP154552.1, with 100% identities.

Final step: The last fragment is the ITS2 sequence:

> KAC39 ITS2
GCCTCCACCCGCCTGGGCGTGCGCCTCGCGCGCACATCCGATCGTGTCTGCCGTGGACTTAGTGCTGCGCCAGATCAAGGCTCGAGCGTCGCCTGAGGGCAGCGTTGCACGGGAGGATCCTCGGATCTGACGTGTGCCGACGTGCTAGTAGGCCGCCTACCAAGTCGTTGTGCCATCGAACGCTGCGATCTCAACCGACGCGGGGACTCGAGGACCTAGGTCGTCGCGTTTCCGCCCACCGGTACGCCTCGCGCGCACCATTGGACTC

Same results here: 100% identities, 8 and 4 matches.

Back to top button