Engineering

Introduction

We hope to construct two kinds of modified E. coli BL21 strains, enzyme secretor and TPA collector. Enzyme secretor bacteria express and secrete working enzymes that can efficiently degrade PET to TPA and EG for the degradation of polyethylene terephthalate (PET) in domestic waste water. Another modified E. coli expressing TPA transporter and TPA specific promoter induced fluorescent protein eGFP to achieve the preliminary enrichment and detection of the degradation product TPA in E. coli.

Period 1: Intracellular expression of turboPETase

1.1 Objective: The turboPETase sequence was integrated into the pBAD plasmid vector, which could be precisely induced by arabinose, and 6xHis-tag was added to purify and detect the expressed turboPETase in subsequent experiments.

1.2 Practice: The plasmid was transformed into E. coli BL21 strain, and turboPETase was expressed in large amount under arabinose induction. The purified enzyme was isolated and purified to explore the activity and degradation ability of the enzyme under various conditions, in order to find the most suitable reaction conditions, and evaluate the degradation efficiency under natural conditions.

1.3 Conclusion: A series of enzyme activity tests were carried out using purified turboPETase. Our experimental results showed that the most suitable condition for the enzyme was 70 degrees Celsius and pH=8. There was no significant difference in the degradation or accumulation of substrate BHET and intermediate MHET at different temperatures, while the degradation or accumulation of product TPA was significantly different with different temperatures.

(1) Although the engineered strain expressed a large number of functional enzymes normally, the procedures of bacteria lysis, cytoplasm separation and purification were very complicated, which were not convenient to provide functional enzymes to environmental samples at a lower cost. Therefore, we hope to secrete turboPETase by adding signal peptides.

(2) By analyzing the changes of each component, it can be inferred that although the existing turboPETase has a strong degradation effect on the substrate, a large amount of intermediate product MHET has been accumulated in the reaction, which is not conducive to the reaction. We hope to add MHETase to degradate MHET and facilitate the degradation.

Period 2: Construction of the PETase secretion plasmid

1.1 Objective: To construct a plasmid to achieve the secretion of our enzymes and to explore the signal peptide element with the best secretion effect on turboPETase, pET28a plasmid was used as the backbone of PV, and the T7 promoter with efficient expression ability was used to expand the expression efficiency of enzymes.

1.2 Design plasmid structure: According to literature review, we use four sec-denpending signal peptides (LamB, PelB, OmpA, MalE) for secretion, and add an enhancer element B1 (MERACVAV) that can greatly enhance the function of the signal peptide to improve the secretion efficiency.

According to the above, the structure of T7 promoter-B1 Enhancer-signal peptide-PETase plasmid was used.

1.3 Practice: We used homologous recombination method to construct turboPETase secretory functional plasmids mentioned above. In the process of designing primers according to different signal peptides, we hope to achieve simple and low-cost access to other fixed components for four or more signal peptides, so we use the reusable "Plug" concept -- connecting homology arms in the design.

1.3.1 Enhancer elements (24bp) were introduced into the 3 'end of the PV backbone by PCR amplification primer design. The 5 '-end sequence (20bp) of the PV backbone was introduced into the 3' -end primer of turboPETase as a homology arm, and the pET28a PV backbone was preliminarily connected by the above design. The "-(Plug-5 ') Turbopetase-PV-enhancer (Plug-3 ')-" linear linker was formed. 20bp at the Enhancer3 'end was selected as Plug-3', and 20bp at the turboPETase 5'end was selected as Plug-5'. Through the design of primers, the interface sequences Plug-3 'and Plug-5' were introduced at both ends of the four signal peptide sequences to realize the homologous connection of different signal peptides and the linear linker of the previous step to form a circular plasmid.

1.3.2 Due to the short fragments of the four signal peptides, in order to achieve the lowest cost and save the time of component synthesis, we can obtain short fragment elements by PCR by designing specific primers with length of 59bp or less.

Taking OmpA as an example, the forward and reverse primers Ompa-F and Ompa-R could bind each other, and the OmpA sequence with a length of 63bp was obtained by PCR, and the Plug-3 '(20bp) and Plug-5' (20bp) were introduced at both ends.

OmpA-F：CGCGCGTGCGTGGCGGTGATGAAAAAGACCGCAATTGCCATTGCAGTTGCACTGGCAGG
OmpA-R：CGCTGATACGGATTGCTTGCCTGTGCAACGGTTGCAAAACCTGCCAGTGCAACTGCAAT

1.4 Conclusion:

(1) Among the four signal peptides, OmpA and PelB were more effective than the other two, so we decided to use OmpA signal peptide as the signal peptide for subsequent turboPETase secretion.

(2) Although the homologous recombination method is a common method in laboratories, a standardized homology arm design was used in construction process, which simplified the homology arm design to a certain extent. A standardized homology-arm design is particularly well suited to large numbers of repeated attempts at a replaceable element (e.g., large-scale exploration of different signal peptides or large-scale validation of mutation-inducing genetic material).

Period 3: Construction of the MHETase secretion plasmid

1.1 Objective: To construct a plasmid to realize the co-secretion function of turboPETase and MHETase, and to use pET28a plasmid as PV backbone.

1.2.1 Practice: The normal linked OmpA-turboPETase and PelB-turboPETase secretion plasmids were used as the new plasmid backbone, and the designed primers were used to linearly PCR the plasmid. The designed primers were used to introduce a homology arm with the PV backbone at the 3 'end of the synthetic sequence MHETase, and a homology arm with the 3' end of the synthetic sequence Amcut-RBS or PelB-RBS at the 5 'end of the synthetic sequence MHETase. Design primers were used to introduce the homology arm of the PV skeleton at the 5 'end of the Amcut-RBS or PelB-RBS element.

1.2.2 Conclusion: During the construction and sequencing, a large number of single colony sequencing results showed that the construction failed and the MHETase did not connect the plasmid. We suspected that the new sequence was not introduced on the PV backbone during the first primer design, which led to the linear plasmid re-connecting itself to restore the loop.

1.3.1 Second practice: We tried to redesign the primers to introduce heterologous sequences on the PV backbone to prevent its own ligation, designed the homology arm at the PV backbone (10bp), and the 3 'end of MHETase (10bp) or the 5' end of Signal Peptide-RBS (10bp), and once again constructed the plasmid by homologous recombination.

1.3.2 Conclusion: Sequencing still showed that MHETase was not connected, and even PETase shed the PV skeleton. We speculated that an RBS sequence was added to the 5'end of MHETase, which was the same as the 5' end RBS sequence of turboPETase on the original turboPetase-PV skeleton. Therefore, the homologous fragments within each fragment were duplicated, resulting in high failure rate at the homologous recombination stage. It is also possible that a new fragment is inserted on the basis of the original plasmid, and at this time, it is impossible to determine whether the new recombinant fragment forms a circular plasmid, so the antibiotic selection is used to exclude the failed recombination results, resulting in a high sequencing failure rate.

1.3.3 Further optimization or adjustment: RBS with different sequences can be assigned to the front end of the two working enzymes, or different restriction sites can be added to each RBS to destroy the homology between the two RBS sequences. Or we can use enzyme digestion and enzyme-linked method, insertinf the SignalPeptide2-MHETase fragment into the SignalPeptide1-PETase-PV. However, due to the limitation of time and effort, this kind of optimization has not been implemented.

1.4 Iteration: Instead of constructing new plasmid, we try to combine two plasmid into our bacterial. We constructed a pET21a plasmid backbone (resistance AmpR) with SignalPeptide2-MHETase, and co-double-transformed into E. coli BL21 strain with the original turboPETase secretion plasmid (resistance KanR). And we maintain two plasmids functioning through two different antibiotic pressure.

1.4.1 Practice: Through the design of PCR primers on the backbone, we introduced the homology arm (20bp) of the 3 'end sequence of PV backbone and the homology arm (20bp) of the 5' end of MHETase to the 5 'end of the Enhancer-SignalPeptide element. The 5 '-end sequence (20bp) of the PV backbone was introduced into the 3' -end primer of MHETase as a homology arm, and the target circular plasmid was formed by homologous recombination ligation of the above elements.

Introduction:

We hope to construct a kind of engineered C. elegans which could express TPA transport system on its intestinal cell membrane so that it could enrich TPA after ingesting engineered E. coli, achieving the effect of TPA's secondary enrichment.

Period 1: Construction of TPA transporter plasmid

1. We designed a plasmid that expresses the TPA transport system within the intestinal tract of C.elegans. The basic components(TpiA and TpiB and TphC) are the same as the design of E. coli .However, since the expression system is quite different between C.elegans and , the signal peptides are also different. Here we use gbb-1 signal peptide to express TpiA, glr-2 signal peptide to express TpiB and dsl-1 signal peptide to express TphC, the standard of signal peptide selection is based on the number of transmembrane times of the protein structure. Besides, in order to avoid the misfolding of the functional protein, SL2 linker is used between different functional protein sequences. The detailed design of our plasmid is shown as follow.

2. Utilizing homologous recombination techniques, we engineered homologous arms on the primers and employed the highly efficient C116 homologous recombination enzyme to simultaneously recombine four fragments.

3. The vector was linearized, and PCR was performed to obtain the insertion fragments with homologous arms. After gel verification, we conducted gel recovery, followed by homologous recombination and transformation of competent DH5α cells. The resulting colonies were plated, picked, and cultured before plasmid extraction. PCR validation confirmed the presence of the desired bands, which were subsequently sent for sequencing.

Period 2: Improvement of TPA transporter plasmid

Upon comparing the company's sequencing results, we discovered a deletion in the tpiA gene. Upon investigation, we found that the linker sequence we used for ligation was SL2, which was employed twice. This resulted in the TPIA sequence being excluded from integration into the plasmid due to homologous recombination occurring between the two SL2 sequences. The issue was resolved by relocating the TPIA gene to the front of tpiB for homologous recombination.

Ultimately, we successfully obtained a complete plasmid shown in figure 8, containing the transport system.