Experimental Design
In this project, we employed synthetic biology techniques to modify Zymomonas mobilis by introducing specific exogenous genes involved in the 3-hydroxybutyrate (3-HB) synthesis pathway. This enabled the production of 3-HB within the Zymomonas mobilis. Subsequently, a series of metabolic engineering modifications were implemented to enhance 3-HB production, including amplifying gene copy numbers, substituting strong promoters, optimizing cofactor supply, incorporating heterologous ethanol utilization pathways, and improving product secretion. Ultimately, these alterations resulted in further enhancements in 3-HB production. Meanwhile, we introduced expression plasmids pTZ32a containing GLP-1 (glucagon-like peptide-1) and ACEi (angiotensin-converting enzyme inhibitor) into motile fermentative bacteria to facilitate the production of therapeutic peptides with bioactive properties. By synergistically harnessing the biosynthesis of fructooligosaccharides and oligosaccharides from Zymomonas mobilis, our objective is to achieve dual effects of glycemic control and blood pressure reduction (Figure 1).
In each part, our approach is to initially validate the functionality of each component individually before amalgamating them to evaluate their collective efficacy. Please refer to the protocols section for precise reaction conditions employed in each step of our experimental design.
Figure 1 Experiment design
To ensure the experimental accuracy, we have implemented the following strategies:
Sequence Verification - Following plasmid construction, members validate its sequence accuracy through Sanger sequencing.
Repeated Experiments - During each experimental session, members conduct multiple replicates or parallel experiments for each experimental group to ensure result consistency.
Genome simplification of Zymomonas mobilis
The project employs an efficient genome-wide iterative and continuous editing strategy called GW-ICE to eliminate four endogenous plasmids, namely pZM32, pZM36, pZM33, and pZM39 in the strain. This approach harnesses the bacteria's own restriction-modification (R-M), CRISPR/Cas, toxin-antitoxin (T-A) systems, and natural plasmids as effective gene editing tools.
In this system, each gene editing plasmid contains two guide RNAs (gRNAs) that can simultaneously target antibiotic resistance genes of the target plasmid and chromosomal genes. As a result, it only necessitates continuous transformation of editing plasmids into the target host cells without relying on counter-selectable markers. Furthermore, a T-A system-based strategy has been developed in the laboratory for rapid screening and cloning vector construction to enhance efficiency in preventing loss of editing plasmids. By employing this method successfully eliminated four endogenous plasmids in Zymomonas mobilis and generated a plasmid-free mutant strain named ZMNPΔhypo which exhibits improved transformation efficiency following continuous genome editing (Figure 2).
The obtained ZMNP strain reduces genomic complexity and energy consumption while possessing desirable traits such as high transformation efficiency and enhanced tolerance to inhibitors.
Figure 2 Process to obtain the mutant strain ZMNPΔhypo with four native plasmids cured and seven genes encoding hypothetical proteins knocked out after seven continuous rounds of genome editing.
Metabolic engineering of Zymomonas mobilis to synthesize 3-HB
Vector selection
Optimization of plasmid selection for 3-HB production strains
1.By selecting or modifying plasmids with varying copy numbers, the copy number of target genes can be manipulated, thereby influencing the expression of target proteins and the production of desired products. To optimize metabolic pathway engineering, such as the 2,3-BDO pathway, we designed and constructed a minimal shuttle vector called pEZ15Asp (pEZ).
2.In order to introduce exogenous EUP pathway, we employed a modified carrier known as pEZ39p.
Recombinant strains construction
Figure 3 Schematic diagram of plasmid design for 3-HB production strain
1. Test for 3-HB tolerance of Zymomonas mobilis
Z. mobilis exhibits a remarkable tolerance to 3-HB concentrations of up to 30 g/L, highlighting its potential for high-yield production of this compound (Figure 4).
Figure 4 Test for 3-HB tolerance of Zymomonas mobilis
2. Introduction of an exogenous 3-HB synthesis pathway into Zymomonas mobilis
Initially, we devised a genetic engineering strategy based on the RBS-10 sequence (CCATAATCTAGAGAAAGTAAGCAC) to introduce the coding genes of three exogenous enzymes involved in 3-HB synthesis: thiolase (PhaA), acetoacetyl-CoA reductase (PhaB), and thioesterase (FadM, YciA, TesB). Specifically, we constructed a T1AB operon by assembling the tesB, phaA, and phaB genes and integrated it into the pEZ15Asp plasmid. The gene expression was regulated by Ptet inducible promoter. To enhance the efficiency of plasmid electrotransformation, demethylated Escherichia coli trans110 competent cells were used for transformation followed by PCR verification and cultivation to obtain the desired pEZ-PtT1 plasmids. Similarly, pEZ-PtY and pEZ-PtF plasmids were obtained using identical methods. Subsequently, these three plasmids were individually electroporated into ZMNPΔ0038 competent cells to generate strains NP-PtT1, NP-PtY, and NP-PtF capable of producing 3-HB (Figure 5).
Figure 5 Introduction of an exogenous 3-HB synthesis pathway into Zymomonas mobilis
3. Replace strong promoter and high-intensity RBS
The plasmid was reverse-amplified prior to the pEZ-PtT1 promoter, and then assembled with the Pgap promoter (amplified using ZM4 as the DNA template) through Gibson Assembly to generate the pEZ-PgT1 plasmid. The target strain NP-PgT1 was obtained by electroporating the pEZ-PgT1 plasmid into competent cells of ZMNPΔ0038. By substituting the RBS-10 sequence in the pEZ-PtT1 plasmid with RBS-10K (ATCACAGGGTCTAGAAGGAGGTCGAA), we obtained pEZ-PtT1'. The T1AB 'operon was acquired by concatenating tesB, phaA, and phaB genes with an RBS-10K sequence, Ptet-T1AB' operon was then obtained through overlap PCR amplification of Ptet promoter and T1AB 'operon. The Ptet-T1AB' operon was integrated into the pEZ15Asp plasmid to construct a recombinant plasmid named pEZ-PtT1'. Finally, this recombinant plasmid was electrically transferred into competent cells of ZMNPΔ0038 resulting in strains designated as NP-PtT1' (Figure 6).
Figure 6 Replace strong promoter and high-intensity RBS
4. Amplification of the TAB operon copy number
The pL2R-PgT1 editing plasmid was constructed using the CRISPR-Cas technique, and the ZMO1650 locus on the genome of ZMNPΔ0038 strain was replaced with the Ptet-T1AB' operon to generate NPTΔ1 strain. Subsequently, the recombinant plasmid pEZ-PtT1 was introduced to obtain a 3-HB multi-copy NPTΔ1-PTT1 strain (Figure 7).
Figure 7 Amplification of the TAB operon copy number
5. Overexpressing cofactor related genes
The overexpression of the Z. mobilis endogenous zwf gene (ZMO0367) has been demonstrated to enhance the biosynthesis of NADPH-dependent metabolites, thereby providing a potential strategy for increasing 3-HB production. In this study, we employed overlap PCR to get the zwf-T1AB operon and successfully constructed the recombinant plasmid pEZ-PtZT1 using the Ptet promoter. Subsequently, this plasmid was transformed into the strain NPTΔ1 to generate strain NPTΔ1-PtZT1 (Figure 8).
Figure 8 Overexpressing cofactor related genes
6.Construction of penicillin-binding protein (PBPs) deficient strains
The absence of penicillin-binding proteins (PBPs) in Zymomonas mobilis can disrupt the normal synthesis of peptidoglycan, thereby affecting membrane structure and resulting in an elevated concentration of glucosamine in Z. mobilis mutants. This increased glucosamine concentration leads to enhanced permeability of the outer membrane, facilitating improved exocellular secretion of intracellular substances. Using the CRISPR-Cas technique, plasmids pL2R-0959 and pL2R-1089 were constructed to facilitate gene knockout at positions ZMO0959 and ZMO1089 in Zymomonas mobilis ZMNPΔ0038. Consequently, defective strains NPΔ0959 and NPΔ1089 were generated. Subsequently, recombinant plasmid PtZT1 was introduced into NPΔ0959 and NPΔ1089 through electroporation to obtain strains NPΔ0959-PtZT1 and NPΔ1089-PtZT1 (Figure 9).
Figure 9 Construction of penicillin-binding protein (PBPs) deficient strains
7.Introduction of exogenous ethanol utilization pathways
Introducing the exogenous EUP pathway can enhance the acetyl-CoA supply. Therefore, we connected ada and adh2 genes with RBS-10K sequence. Sequentially, the pEZ39p-PeEUP plasmid, which was constructed with an EUP operon driven by the Peno promoter in the shuttle vector pEZ39p, was transferred into NPTΔ1-PtZT1 competent cells to generate the target strain NPTΔ1-PtZT1EUP (Figure 10).
Figure 10 Introduction of exogenous ethanol utilization pathways
8.Optimization the engineering strain through effective strategy combinations
Several strategies, including manipulation of the zwf gene, overexpression of the zwf gene, introduction of the ethanol utilization pathway, and knockout of ZMO1089, were combined to enhance 3-HB production. Starting with strain NPTΔ1 where ZMO1089 was knocked out to obtain strain NPTΔ2, CRISPR-Cas technology was employed to construct editing plasmid pL2R-EUP. This plasmid integrated the EUP promoter into the ZMO1094 locus in strain NPTΔ2, resulting in strain NPTΔ3. Subsequently, plasmid pEZ-PtZT1 was transformed into strain NPTΔ3 to generate NPTΔ3-PtZT1. To further modify this strain, competent cells of NPTΔ3-PtZT1 were introduced with plasmid pEZ39p-PeEUP through electroporation, leading to the creation of strain NPTΔ3-PtZT1EUP (Figure 11).
Figure 11 Optimization the engineering strain through effective strategy combinations
Results and analysis
1.Construction, testing of heterologous 3-HB production strains and screening of the thioesterase
Under tetracycline induction, the expression of Thioesterase TesB in Z.mobilis resulted in the highest yield of 3-HB (425.67±2.89 mg/L). Consequently, Thioesterase TesB was selected for subsequent strain transformation.
2.Replace the inducible promoter of 3-HB strain with a strong promoter and replace the high-intensity RBS
(1)By substituting the strong promoter, the production of 3-HB was reduced to 232.67±2.51 mg/L.
(2)Substituting RBS10K resulted in a decrease in 3-HB production to 405.333±28.989 mg/L (Figure 12).
Therefore, the utilization of inducible promoters and RBS10 was continued for subsequent strain modification.
Figure 12 the production of ethanol and 3-HB in strong promoter expression strain NP-PgT1、High-strength RBS expression strain NP-PtT1’
3.Construction and evaluation of multi-copy strains for the 3-HB pathway
The production of 3-HB was increased to 533.00±4.36 mg/L by amplifying the gene related to the 3-HB pathway.
4.Construction and testing of cofactor enhanced strains
The overexpression of the cofactor-related gene (zwf) resulted in a significant increase in 3-HB production, reaching 685.67±10.69 mg/L.
5.The 3-HB strains lacks penicillin-binding proteins (PBPs) that promote the secretion of 3-HB
The production of 3-HB increased to 723.33±9.71 mg/L following the elimination of penicillin-binding protein in the 3-HB strain (Figure 13).
Figure 13 the production of ethanol and 3-HB in PBPs deficient strains NPΔ0959-PtZT1、NPΔ1089-PtZT1
6.Introducing exogenous ethanol utilization to increase the supply of acetyl-coA
The implementation of the exogenous ethanol utilization pathway (EUP) resulted in a significant enhancement in 3-HB production, with the yield reaching 1114.33±26.50 mg/L.
7.Optimization of culture medium enhances 3-HB production
The yield of 3-HB was enhanced to 1323±22.61 mg/L under a carbon-to-nitrogen ratio of 50/5 (Figure 14).
Figure 14 the production of ethanol and 3-HB in NPTΔ1-PtZT1EUP in different C/N ratio
8.Construction and testing of effective strategy combination strains
The highest 3-HB yield achieved in this study was 1525±72.16 mg/L, which resulted from the effective implementation of strategic approaches and optimal medium conditions (Figure 15).
Figure 15 the production of ethanol and 3-HB in strain NPTΔ3-PtZT1EUP(a) in different C/N ratio
Expression of hypoglycemic peptides and antihypertensive peptides
The Zymomonas mobilis chassis was employed in our project to genomically integrate the T7 RNA polymerase gene, thereby introducing the T7 expression system and constructing the ZM4-T7 and ZMNP-T7 strains.
Vector selection
Plasmid selection of expression strains
Integrate the T7 RNA polymerase gene into the genome and insert it into the modified expression plasmid pTZ32a. Replace the f1 sequence on the pET32a vector with zymo_replication and express it in Zymomonas mobilis, including the T7 expression system.
Recombinant strains construction
Utilizing Zymomonas mobilis as the host cells, we integrated the T7RNA polymerase gene into the genome and introduced the T7 expression system. Considering that peptides with hypoglycemic and hypohypertensive effects are susceptible to degradation during fermentation in Zymomonas mobilis or upon exposure to gastric juices, we reconstructed a pH sensor by employing the lactose operon and P170 systems from Lactococcus lactis. The rcfB promoter was utilized for acidity sensing, where in under pH < 5.5 conditions, downstream inhibitory protein LacⅠ is expressed, leading to binding with operon O1/O2 and subsequent inhibition of downstream gene expression. To ensure proper protein expression, therapeutic peptides were fused with 6×His tags forming fusion proteins which were incorporated into cleavable self-assembled cSAT system, then it has been inserted into modified expression vector pTZ32a. Using the T7 expression system, the 4×GLP-1/5×LV therapeutic activity peptide was expressed as tandem repeats in Zymomonas mobilis. We also incorporated the extracellular display protein INP upstream of the fusion protein gene sequence, and constructed polymers consisting of tandem repeats of 4×GLP-1 and 5×LV to facilitate direct secretion of the active polypeptide in the human gut. These polymers can be degraded into active polypeptide monomers by enterokinase. To encapsulate probiotics, we will employ chitosan and sodium alginate as effective biofilms using a layered electrostatic self-assembly strategy. The resulting coated bacteria are expected to exhibit resistance against acidic conditions in the stomach, successfully navigating through various obstacles from the stomach and duodenum to reach the small and large intestine where they exert their effects. When the environmental pH exceeds 5.5, inhibition of the rcfB promoter occurs, resulting in degradation of the LACR protein and subsequent release of its inhibitory effect. GLP-1 is expressed and secreted into the extracellular space as hypoglycemic peptides, where it is released and binds to GLP-1 receptors on β-islet cells through blood transport, thereby activating downstream cAMP signaling pathway to stimulate insulin production. In the case of antihypertensive peptides: angiotensin-converting enzyme (ACE) catalyzes the conversion of angiotensin I to angiotensin II; ACE inhibitor LV recognizes and inhibits ACE activity, leading to vasodilation and reduction in blood pressure (Figure 16,17).
Figure 16 Plasmid map
Figure 17 Construction of therapeutic strains of hypoglycemic and hypohypertensive peptide
Results and analysis
Analysis of strain of hypoglycemic and hypohypertensive peptides
1.The production of GLP-1 peptides by the BL21 (DE3) strain
The constructed strain was verified by PCR method (Figure 18).
Figure 18
The constructed strain was verified through Sanger sequencing.
Figure 19
The sequencing results indicate that the constructed strain is correct (Figure 19).
Results of protein expression
Figure 20
Due to the excessive disorder in the gel map, where proteins of different sizes were present in almost every interval (Figure 20), we conducted a purification process for it.
Figure 21
By using imidazole solutions with different concentration gradients for elution, no impurities were observed when eluted with a 50mM imidazole concentration, the protein size is approximately 90kDa (Figure 21).
2.The roduction of the 4GLP-1-5LV therapeutic peptides by the Escherichia coli Nissle 1917 (DE3) strain
(1)The constructed strain was verified by PCR method (Figure 22).
Figure 22
(2)The constructed strain was verified through Sanger sequencing (Fiure 23,24).
Fiure 23 primer: PT7-SEQ-F
Figure 24 primer: T7-ter
The sequencing results indicate that the constructed strain is correct.
Results of protein expression
Figure 25
Figure 26
Figure 27
The target protein has a size of 24.97 kDa, in addition to the TrxA tag of 11.8 kDa, resulting in a total size of 36.77 kDa. The SDS-PAGE gel shows a protein band approximately at 45 kDa, and there is no significant difference between the control group before and after induction (Figure 25,26,27).
3.The production of 4GLP-1-5LV peptides by the ZMNP strain
(1)The constructed strain was verified by PCR method (Figure28).
Figure 28
(2)The constructed strain was verified through Sanger sequencing(Figure 29)
Figure 29
(3)The sequencing results indicate that the constructed strain is correct.
Results of protein expression(Figure 30, 31).
Figuer 30 empty vector
Figuer 31 pTZ32a/pTZ28a-4GLP-1-5LV
4.The production of 4GLP-1-5LV peptides by the ZM4 strain
(1)The constructed strain was verified by PCR method (Figure 32).
Figure 32
(2)The constructed strain was verified through Sanger sequencing (Figure 33).
Figure 33 primer: PT7-SEQ-F/T7-ter
(3)Results of protein expression(figure 34, 35)
Figure 34 empty vector
Figure 35 pTZ32a/pTZ28a-4GLP-1-5LV
Results of protein expression
Safety switch
The members have identified a mechanism of glucose starvation-induced suicide, which is based on the disparities between the human body and its natural environment. In response to the environmental glucose deficiency, glucose starvation triggers an overexpression of the autolysase gene (acmA) through T-αcrp promoter activation, ultimately leading to bacterial autolysis and subsequent demise (Figure 36).
Figure 36 The design of Safety switch