Protocols

Workflow Summary

---

Expression & Purification

Overnight Bacterial Cultures

This general protocol is used to prepare 10 mL cultures of BL21 or DH5α E. coli for innoculating expression cultures or isolating plasmid DNA, respectively.

Ingredient	Amount per reaction
LB media 8g LB per 400mL water	10mL
Antibiotic	0.5-1mg

Method:

1. Prepare 10 mL LB broth (8 g LB per 400 mL water) in a 50 mL falcon tube for each plasmid that needs to be amplified.
2. Set up a sterile working area by spraying down the bench with 100% ethanol and working below the updraft of a Bunsen burner on blue flame.
3. Add an appropriate concentration of the antibiotic relevant to your construct (e.g. kanamycin for plasmids with kanR gene). Typical working concentrations for common antibiotics are 50-100 ug/mL.
4. Use a pipette to scrape the surface of a bacterial glycerol stock or bacterial plate colony and transfer the pipette tip into the falcon tube. If using liquid bacterial mixtures, such as after transformation, transfer 1 mL into the falcon tube.
5. Incubate at 37°C overnight with shaking.
6. Harvest the cell pellet by centrifuging at 11,000 g for 5 min and aspirating the supernatant.

---

R Body Expression (Standard)

This protocol was used to express all R bodies, whether wildtype or modified, except those constructs used for amber codon suppression where a non-canonical amino acid must be incorporated. Refer below for the amber suppression protocol.

Ingredient	Amount per reaction
Tryptone phosphate medium (TPM) per litre: 20g tryptone 15g yeast extract 8g NaCl 2g NaH2PO4 1g KH2PO4 MQW up to 1L volume	1 L
LB broth 20g LB 1L MQW	1L
BL21 culture	-
Antibiotic	50-100 mg
1M IPTG	1mL

Method:

1. Prepare an overnight BL21 culture (refer to ‘Overnight bacterial culture’ protocol) that contains the desired Reb plasmid (e.g. Reb1 for wildtype).
2. Prepare 1 L of LB broth or 1 L of TPM in large bacterial expression conical flasks. We typically used LB broth but TPM broth gives greater albeit slower growth.
3. Cover the lid with foil, tape it down with autoclave tape and autoclave the medium in the conical flasks.
4. Measure the OD₆₀₀ of each overnight culture. Calculate the amount of each culture that must be transferred into the 1 L of expression medium to start growth at OD₆₀₀ of 0.05.
5. Transfer calculated volume of overnight culture into each expression medium.
6. Add an appropriate antibiotic to each flask. 50-100 μg/mL is a standard working concentration.
7. Incubate at 37°C and shaking at 110 rpm until OD = 0.2 – 0.6 (0.4 is optimal).
8. Induce with 1 mM IPTG (final concentration) for 18 hr at 37°C.
9. After expression, transfer the culture into large centrifuge bottles. Spin down at 4000 g for 20 min.
10. Aspirate the supernatant.
11. Resuspend the harvested pellets and aliquot into falcon tubes. These can be frozen or used for purification.

---

R body expression (amber codon suppression)

This protocol is an altered version of the standard R body expression protocol to allow for non-canonical amino acid incorporation. The key difference is the conditions used for expression induction. We used this to express TAG-RebA and TAG-RebB R bodies and a pCDF RFP amber codon (red fluorescent protein) plasmid. The latter was used in preliminary tests to optimise expression conditions. Please note the pCDF RFP amber plasmid is not available commercially and was kindly given to us by the Mackay and Matthews lab. We are happy to provide the plasmid sequence data upon request.

Ingredient	Amount per reaction
Tryptone phosphate medium (TPM) per litre: 20g tryptone 15g yeast extract 8g NaCl 2g NaH2PO4 1g KH2PO4 MQW up to 1L volume	1 L
LB broth 20g LB 1L MQW	1L
Antibiotic	50-100 mg
1M IPTG	1mL
20% (w/v) arabinose stock	10mL
p-azido-L-phenylalanine	0.0412g

Method:

1. Prepare an overnight BL21 culture (refer to ‘Overnight bacterial culture’ protocol) that is cotransformed with a pEVOL_AzF plasmid and one of TAG-RebA, TAG-RebB or amber codon pCDF RFP plasmids.
2. Prepare 1 L of LB broth or 1 L of TPM in large bacterial expression conical flasks. We typically used LB broth but TPM broth gives greater albeit slower growth.
3. Cover the lid with foil, tape it down with autoclave tape and autoclave the medium in the conical flasks.
4. Measure the OD₆₀₀ of each overnight culture. Calculate the amount of each culture that must be transferred into the 1 L of expression medium to start growth at OD₆₀₀ of 0.05.
5. Transfer calculated volume of overnight culture into each expression medium.
6. Add an appropriate antibiotic to each flask. 50-100 μg/mL is a standard working concentration.
7. Incubate at 37°C and shaking at 110 rpm until OD = 0.2 – 0.6 (0.4 is optimal).
8. Induce with 0.2 mM IPTG (final concentration), 0.2 %(w/v) arabinose and 0.2 mM p-azido-L-phenylalanine for 18 hr at 37°C.
9. After expression, transfer the culture into large centrifuge bottles. Spin down at 4000 g for 20 min.
10. Aspirate the supernatant.
11. Resuspend the harvested pellets and aliquot into falcon tubes. These can be frozen or used for purification.

---

R body purification

Ingredient	Amount per reaction
Bacterial pellet	5mL
Incubation buffer 25mM Tris pH 7.5 100mM NaCl	2mL
Lysozyme	200μg
1M MgCl2	20μL
1M CaCl2	20μL
DNase (10mg/mL)	30μL
10% w/v SDS	200μL
1% w/v Triton X-100	2mL
Storage buffer 25mM Tris pH 7.5 100mM NaCl 15% glycerol	2mL

Method:

1. For every 5 mL of bacterial pellet (see previous protocol), thaw and resuspend in 2 mL incubation buffer.
2. Add lysozyme to a final concentration of 100 μg/mL and incubate on a shaker at 37°C overnight.
3. Adjust buffer to contain 10 mM MgCl₂ and 10 mM CaCl₂.
4. Add DNase to a final concentration of 150 μg/mL and incubate on a shaker at 37°C overnight.
5. Adjust buffer to contain 1% w/v SDS and incubate on a shaker at 37°C for 10 minutes.
6. Centrifuge at 11,000 g for 5 min to pellet R bodies.
7. Wash pellet by resuspending with 2 mL 1% w/v Triton X-100. Repeat washing step two more times.
8. Resuspend in 2 mL incubation buffer.
9. Repeat steps 2-8 once more.

For comparison, Polka et al. (2016) purification protocol:

1. Flash-freeze cell pellet in liquid nitrogen, then thaw.
2. Resuspend cells in 10 mL 25 mM Tris pH 7.5, 100 mM NaCl, and 2 mM EDTA.
3. Add lysozyme to a concentration of approximately 17 μg/mL, and cells were incubated at 37 °C for 1 h
4. Adjust the buffer to contain 10 mM MgCl₂, 10 mM CaCl₂, and approximately 15 μg/mL DNase. Shaking incubate at 37 °C for 20 min.
5. Adjust buffer to contain 1% SDS, mix manually for a couple minutes.
6. Spin the cells down at 4000 rpm for 20 min to pellet the R bodies.
7. Wash the R body pellet three times by resuspension in water, followed by spins, as above.

---

GGG-mNeonGreen expression

We needed GGG-mNeonGreen for our sortase conjugation strategy, so we expressed it (this protocol) and purified it (next protocol).

Ingredients	Amount per protocol
LB broth, per litre: 10g peptone 5g yeast extract 5g NaCl Top up to 1L with MQW	1L
IPTG	1M
Spectinomycin	50mg/mL

Method:

1. Prepare an overnight BL21 culture (refer to ‘Overnight bacterial culture’ protocol) that contains the pCDFDuet-1_His_TEV_GGG_mNeon plasmid.
2. Prepare 1 L of LB broth in large bacterial expression conical flasks (fill only to 20% of the flask’s volume). Autoclave the media to sterilize.
3. Measure the OD₆₀₀ of each overnight culture. Calculate the amount of each culture that must be transferred into the 1 L of expression medium to start growth at OD₆₀₀ of 0.05.
4. Transfer calculated volume of overnight culture into each expression medium.
5. Add spectinomycin (50 µg/mL) to the 1 L expression flask.
6. Incubate at 37°C and shaking at 150 rpm until OD = 0.6-1.0 (0.6 is optimal).
7. Induce with IPTG (1 mM) and allow to incubate for 18 hr at 37°C while shaking.
8. After expression, transfer the culture into large centrifuge bottles. Spin down at 5000 g for 15 min.
9. Pour off the supernatant.
10. Resuspend the harvested pellets and aliquot into falcon tubes. These can be frozen or used for purification.

---

mNeonGreen-GGG purification

Ingredient	Amount per protocol
Buffer A (Lysis buffer): 50 mM Tris-HCl, pH 7.5 300 mM NaCl 10 mM Imidazole 1 mM MgCl2 1x complete EDTA-free protease inhibitor 10 µg/mL DNase 1 mM PMSF	100 mL
Buffer B (Wash buffer): 50 mM Tris-HCl, pH 7.5 300 mM NaCl 20 mM Imidazole	100 mL
SEC buffer: 25 mM Tris-HCl, pH 7.5 150 mM NaCl	1.5 L
0.1% (v/v) Tween 20	30 mL
Ni-NTA agarose resin	5 mL of a 50% slurry
SuperTEV protease	1 mg
10 kDa MWCO amicon ultra-centrifugal filter	1
HiLoad 16/600 Superdex 75 pg column	1

Method:

1. Prepare all the buffers listed above. Ensure that protease inhibitor, DNase and PMSF are all added fresh, immediately before use.
2. Resuspend the bacterial pellet from a 1 L expression culture in 25 mL of lysis buffer.
3. Lyse the bacterial cells by microtip-probe sonication (6 cycles, 50% duty cycle at max microtip amplitude for 40 seconds, with 1 minute rests on ice in between cycles), ensuring that the mixture is always kept cold in an ice bath.
4. Clarify the lysate by centrifugation at 15,000 g, 4°C for 30 minutes.
5. During the clarification, equilibrate 5 mL of Ni-NTA agarose resin (50% slurry) with 10 column volumes (1 CV = bead volume = 2.5 mL) of lysis buffer 3 times.
6. After clarification has finished, collect the supernatant - this is the clarified lysate.
7. Combine the clarified lysate with the equilibrated Ni-NTA agarose resin and allow protein to bind for 2 hours, rotating at 4°C to ensure that the resin remains suspended.
8. Remove the liquid phase by filtration.
9. Wash the resin with 10 column volumes of wash buffer 4 times.
10. Wash the resin with 10 column volumes of SEC buffer 3 times.
11. Add ~5 mg SuperTEV protease to begin cleavage. Incubate overnight at 4°C while rotating to ensure that the resin remains suspended.
12. Equilibrate a HiLoad 16/600 Superdex 75 pg column with SEC buffer.
13. Collect the liquid phase by filtration.
14. Mix the resin with 1 column volume of SEC buffer and allow to incubate for 5 minutes, ensuring the resin remains suspended.
15. Collect the liquid phase by filtration.
16. Measure the concentration of eluted protein by UV-Vis nanodrop spectrophotometry. Repeat the elution steps (14-16) until most of the protein has been removed from the resin (this should take ~4-5 washes).
17. Block a 10 kDa MWCO amicon ultracentrifugal filter with 0.1% Tween 20, and equilibrate with SEC buffer.
18. Concentrate the protein sample with a pre-equilibrated 10 kDa MWCO amicon ultracentrifugal filter to <5 mL.
19. Apply the concentrated protein to a HiLoad 16/600 Superdex 75 pg column for purification by size exclusion chromatography on an FPLC system.
20. Analyse the fractions by SDS-PAGE and combine the desired fractions of purified mNeonGreen.
21. Concentrate the protein with a pre-blocked, pre-equilibrated 10 kDa MWCO amicon ultracentrifugal filter.
22. Measure the concentration of protein by UV-Vis nanodrop spectrophotometry and continue concentrating until the protein sample has reached a concentration of > 500 µM.
23. Aliquot the protein sample and snap-freeze with liquid nitrogen.

---

Sortase A expression

We needed sortase to catalyse the sortase conjugation strategy, so we expressed it (this protocol) and purified it (next protocol).

Ingredients	Amount per protocol
LB broth, per litre: 10g peptone 5g yeast extract 5g NaCl Top up to 1L with MQW	1L
IPTG (1M stock)	0.4 mmol (400 µL)
Kanamycin (50 mg/mL stock)	50 mg (1 mL)

Method:

1. Prepare an overnight BL21 culture (refer to ‘Overnight bacterial culture’ protocol) that contains the pCDFDuet-1_His_TEV_GGG_mNeon plasmid.
2. Prepare 1 L of LB broth in large bacterial expression conical flasks (fill only to 20% of the flask’s volume). Autoclave the media to sterilize.
3. Measure the OD₆₀₀ of each overnight culture. Calculate the amount of each culture that must be transferred into the 1 L of expression medium to start growth at OD₆₀₀ of 0.05.
4. Transfer calculated volume of overnight culture into each expression medium.
5. Add kanamycin (50 µg/mL) to the 1 L expression flask.
6. Incubate at 37°C and shaking at 150 rpm until OD = 0.6-0.8 (0.6 is optimal).
7. Adjust the temperature to 30°C and induce with IPTG (0.4 mM).
8. Allow to express for 3 hr at 30°C while shaking.
9. After expression, transfer the culture into large centrifuge bottles. Spin down at 5000 g for 15 min.
10. Pour off the supernatant.
11. Transfer the pellets to falcon tubes and snap freeze in liquid nitrogen.

---

Sortase A purification

Ingredients	Amount per reaction
Buffer A (Lysis buffer): 50 mM Tris-HCl, pH 7.5 300 mM NaCl 10 mM Imidazole 1 mM MgCl2 1x complete EDTA-free protease inhibitor 10 µg/mL DNase 1 mM PMSF	100 mL
Buffer B (Wash buffer): 50 mM Tris-HCl, pH 7.5 300 mM NaCl 20 mM Imidazole	100 mL
Buffer C (Elution buffer): 50 mM Tris-HCl, pH 7.5 300 mM NaCl 500 mM Imidazole	~20 mL
SEC buffer: 25 mM Tris-HCl, pH 7.5 150 mM NaCl	1.5 L
0.1% (v/v) Tween 20	30 mL
Ni-NTA agarose resin	5 mL of a 50% slurry
3 kDa MWCO amicon ultra-centrifugal filter	1
HiLoad 16/600 Superdex 75 pg column	1

Method:

1. Prepare all the buffers listed above. Ensure that protease inhibitor, DNase and PMSF are all added fresh, immediately before use.
2. Resuspend the bacterial pellet from a 1 L expression culture in 25 mL of lysis buffer.
3. Lyse the bacterial cells by microtip-probe sonication (6 cycles, 50% duty cycle at max microtip amplitude for 40 seconds, with 1 minute rests on ice in between cycles), ensuring that the mixture is always kept cold in an ice bath.
4. Clarify the lysate by centrifugation at 15,000 g, 4°C for 30 minutes.
5. During the clarification, equilibrate 5 mL of Ni-NTA agarose resin (50% slurry) with 10 column volumes (1 CV = bead volume = 2.5 mL) of lysis buffer 3 times.
6. After clarification has finished, collect the supernatant - this is the clarified lysate.
7. Combine the clarified lysate with the equilibrated Ni-NTA agarose resin and allow protein to bind for 2 hours, rotating at 4°C to ensure that the resin remains suspended.
8. Remove the liquid phase by filtration.
9. Wash the resin with 10 column volumes of wash buffer 4 times.
10. Mix the resin with 1 column volume of elution buffer and allow to incubate for 5 minutes, ensuring the resin remains suspended.
11. Collect the liquid phase by filtration.
12. Measure the concentration of eluted protein by UV-Vis nanodrop spectrophotometry. Repeat the elution steps (10-12) until most of the protein has been removed from the resin (this should take ~8-10 elutions).
13. Dialyse against at least 1 L of SEC buffer overnight at 4°C - ensure that the imidazole concentration is reduced to below 10 mM.
14. Equilibrate a HiLoad 16/600 Superdex 75 pg column with SEC buffer.
15. Block a 10 kDa MWCO amicon ultracentrifugal filter with 0.1% Tween 20, and equilibrate with SEC buffer.
16. Harvest the dialysis solution and concentrate the protein with a pre-equilibrated 10 kDa MWCO amicon ultracentrifugal filter to <5 mL.
17. Apply the concentrated protein to a HiLoad 16/600 Superdex 75 pg column for purification by size exclusion chromatography on an FPLC system.
18. Analyse the fractions by SDS-PAGE and combine the desired fractions of purified mNeonGreen.
19. Concentrate the protein with a pre-blocked, pre-equilibrated 10 kDa MWCO amicon ultracentrifugal filter.
20. Measure the concentration of protein by UV-Vis nanodrop spectrophotometry and continue concentrating until the protein sample has reached a concentration of > 500 µM.
21. Aliquot the protein sample and snap-freeze with liquid nitrogen.

---

Genetic Assembly

Overlap extension PCR

We used overlap extension PCR to generate plasmids with modified RebA or RebB genes with conjugation handles. We used the same technique to prepare mNeonGreen-GGG: the oligoglycine tract allows it to serve as a substrate for sortase conjugation to R bodies. Please note the template plasmid for mNeonGreen-GGG was a pCDFDuet backbone with mNeonGreen-TEV-6xHis cloned in (the 6xHis enables Ni-NTA purification and TEV allows the 6xHis to be scarlessly removed). This plasmid has been in use by the USYD Lau Lab and kindly provided to our team. We are happy to provide the sequence upon request.

Ingredient	Amount per reaction
5x Phusion buffer 50mM Tris-HVl (pH 8.8) 250mM KCl 12.5mM MgSO4 0.5% Triton X-100 1 mg/mL BSA	10 μL
dNTPs	4 μL
Template (50 ng/µL)	25 ng
Phusion enzyme (2000 U/μL)	0.5 μL
Forward primer (10 µM)	2.5 μL
Reverse primer (10 µM)	2.5 μL

Method:

1. For any one construct four primers need to be prepared. The principle of their design is shown in Figure 2. A table of our primers is provided in Table 1.
2. Dilute primers in MQW to create 10 mM stock solutions.
3. Two separate PCR reactions are needed to generate a short fragment and a long fragment. For each PCR reaction, prepare the reaction mixture according to Table 1.
4. Load the reaction mixture into the thermocycler and run the reaction as shown in Table 2.

Table 1. Primers used for genetic assembly of various Reb constructs.

Sequence (5' to 3')1	Name
CGGAAGAGGCATAAATTCCG	Fwd_kanR
CGGAATTTATGCCTCTTCCG	Rev_kanR
ggtggaggaggtagttgtTAATGCTTATTTCGATATGCTAAAATAATGC	Fwd_Cys-C RebB
acaactacctcctccaccACCATTTTTAGCGGCTTTAATAAC	Rev_Cys-C RebB
tgtggtggaggaggtagtAGTAATGTAAATTCACAAATTACAGATTCAG	Fwd_Cys-N RebB
actacctcctccaccacaCATTTTTTATTCCTTACTTTGTCTGGG	Rev_Cys-N RebB
tgtggtggaggaggtagtGCGACTACTACTTCTACTGCTG	Fwd_ Cys-N RebA
actacctcctccaccacaCATTTTGAGCTCCTTGTTTTG	Rev_Cys-N RebA
ggtggaggaggtagttgtTAAGTATTAAAAATAGATTATTTATAAAACACCGTAAG	Fwd_Cys-C RebA
acaactacctcctccaccTGCTTTATCAACGCCAAGC	Rev_Cys-C RebA
ctcccagaaacaggaTAATGCTTATTTCGATATGCTAAAATAATGC	Fwd_RebB-LPETG
tcctgtttctgggagACCATTTTTAGCGGCTTTAATAAC	Rev_RebB-LPETG
ctcccagaaacaggaTAAGTATTAAAAATAGATTATTTATAAAACACCGTAAG	Fwd_RebA-LPETG
tcctgtttctgggagTGCTTTATCAACGCCAAGC	Rev_RebA-LPETG
TAAATTAACCTAGGCTGCTGCCAC	Fwd_GGG-mNeonGreen_long fragment
ttggaagtacaggttctcGTGATGATGATGGTGGTGCATTGTATATC	Rev_GGG-mNeonGreen_long fragment
gagaacctgtacttccaaggaGGAGGTTCAGTCTCCAAGGGAG	Fwd_GGG-mNeonGreen_short fragment
gcagcctaggttaatttaCTTATACAGTTCGTCCATGCCCATTAC	Rev_GGG-mNeonGreen_short fragment
tagggcgggggtggaagtGCGACTACTACTTCTACTGCTG	Fwd_TAG-RebA
acttccacccccgccctaCATTTTGAGCTCCTTGTTTTG	Rev_TAG-RebA
tagggcgggggtggaagtAGTAATGTAAATTCACAAATTACAGATTCAG	Fwd_TAG-RebB
acttccacccccgccctaCATTTTTTATTCCTTACTTTGTCTGGG	Rev_TAG-RebB
Combination	Fragment
Fwd_Cys-C RebB + Rev_kanR	Cys-C RebB short fragment
Rev_Cys-C RebB + Fwd_kanR	Cys-C RebB long fragment
Fwd_Cys-N RebB + Rev_kanR	Cys-N RebB short fragment
Rev_Cys-N RebB + Fwd_kanR	Cys-N RebB long fragment
Fwd_ Cys-N RebA + Rev_kanR	Cys-N RebA short fragment
Rev_Cys-N RebA + Fwd_kanR	Cys-N RebA long fragment
Fwd_Cys-C RebA + Rev_kanR	Cys-C RebA short fragment
Rev_Cys-C RebA + Fwd_kanR	Cys-C RebA long fragment
Fwd_RebB-LPETG + Rev_kanR	RebB-LPETG short fragment
Rev_RebB-LPETG + Fwd_kanR	RebB-LPETG long fragment
Fwd_RebA-LPETG + Rev_kanR	RebA-LPETG short fragment
Rev_RebA-LPETG + Fwd_kanR	RebA-LPETG long fragment
Fwd_GGG-mNeonGreen_long fragment + Rev_GGG-mNeonGreen_long fragment	mNeonGreen long fragment
Fwd_GGG-mNeonGreen_short fragment + Rev_GGG-mNeonGreen_short fragment	mNeonGreen short fragment
Fwd_TAG-RebA + Rev_kanR	TAG-RebA short fragment
Rev_TAG-RebA + Fwd_kanR	TAG-RebA long fragment
Fwd_TAG-RebB + Rev_kanR	TAG-RebB short fragment
Rev_TAG-RebB + Fwd_kanR	TAG-RebB long fragment

¹Overhanging sequences are shown in lowercase

Table 2. Preparation of overlap PCR reaction.

Reagent	Quantity	Comment
5x Phusion buffer	10 μL	-
Deoxynucleotide triphosphates (dNTPs)	4 μL	-
Template	25 ng	We used Reb1 as a template for all overlap extension PCRs. pCDFDuet mNeonGreen-TEV-6xHis was used to as a template for generating the mNeonGreen-GGG construct.
Forward primer	2.5 μL	From 10 mM stock solution. Ensure one primer has an overhang and the other does not.
Reverse primer	2.5 μL	From 10 mM stock solution. Ensure one primer has an overhang and the other does not.
Phusion enzyme	0.5 μL	Keep on ice and add last.
DMSO	0-10 %(w/v)	Varying DMSO concentrations can help troubleshoot PCR.
MQW	Up to 50 μL	-

Table 3. Thermocycler conditions for overlap PCR reaction.

Step	Time (mm:ss)	Temperature (°C)	Repeats
Initial denaturation	02:00	98.0	1
Denaturation	00:20	98.0	35
Annealing	00:20	Tm	35
Extension	Fragment length rounded up to the nearest kbp ÷ 1000 × 00:30 sec	72.0	35
Final extension	2 × cycle extension time	72.0	1
Hold	-	4.0	-

NB: Extension temperature can also be adjusted up to 5°C higher or lower than calculated primer T_m to troubleshoot PCR.

---

DNA gel electrophoresis

This protocol describes DNA gel electrophoresis for DNA samples. We used this protocol to visualise PCR results and/or to separate DNA bands for PCR cleanup (next protocol).

Ingredient	Amount per reaction
Loading dye	2 μL per DNA sample
Agarose	0.1 g per 10 mL TAE buffer
TAE buffer 40 mM Tris-HCl 20 mM acetic acid 1 mM EDTA	50mL or 70mL for gel
HydraGreenTM Safe DNA Dye	0.3 μL per 10 mL of TAE buffer
New England Biolabs 1 kB DNA Ladder	7 μL

Method:

1. In a Schott bottle or conical flask prepare 1 %(w/v) agarose solution in fresh 1x TAE buffer by microwaving it until boiling. The solution should now appear clear. Use 50 mL TAE for an analytical gel and 70 mL TAE for a purification gel (for PCR cleanup).

NB: use heat-resistant gloves to remove the solution from the microwave for safety. The solution boils readily so microwaving at 10 second intervals prevents it from unexpectedly evaporating.

2. Add 0.3 μL of HydraGreen gel dye per 10 mL of agarose solution and swirl thoroughly.
3. Place rubber stoppers at the ends of the gel tray and slot gel combs into the tray (if using two combs make sure they are evenly spaced).

NB: choose the size of your wells carefully. If you are running a PCR

4. Pour the agarose mixture into the gel tray and remove all bubbles using a pipette tip.
5. Allow to cool until solid (20-30 min).
6. After ensuring that the gel has set, remove the rubber stoppers from the tray, and place the gel and the tray into the larger electrophoresis chamber.

NB: make sure you check the direction in which the gel is running (cathode to anode) or your samples will run off the gel!

7. Pour enough fresh or recycled 1x TAE buffer into the chamber to cover the gel entirely.
8. Remove the comb from the gel slowly and carefully to preserve the integrity of the wells.
9. For each DNA sample to be analysed, mix with loading dye at a 5:2 ratio, respectively.
10. Load 7 μL of DNA ladder (we used New England Biolabs 1 kB DNA Ladder) at the beginning of a row of wells.
11. Load samples carefully into the remaining wells.
12. Run the gel at 110V, 400mA. As our samples were 3000-5000 bp, we ran the gel for 30 minutes, however, other sample sizes may need different running times.
13. After the running time has elapsed, remove the gel.
14. If simply imaging an analytic gel, place in a UV gel visualizer (we used BioRad GelDoc system). If running a gel for PCR cleanup, refer to the next protocol.

---

PCR product gel cleanup

Every PCR reaction that is used for Gibson assembly needs to be cleaned from salts, enzymes, primers, incorrectly amplified products and other contaminants. Our team found that standard PCR gel cleanup (as opposed to non-gel methods) was essential for an efficient Gibson assembly reaction.

Ingredients	Amount per protocol
Isolate II PCR and Gel Cleanup Kit	1

Method:

1. The PCR product should be separated by DNA gel electrophoresis using a 70 mL gel (refer to previous protocol).
2. Remove the gel and place it under a blue light transilluminator to visualise PCR bands.

NB: we recommend keeping the gel in the gel tray to prevent the scalpel from damaging the transilluminator. We also advise against using a UV transilluminator as UV light drastically degrades the quality of DNA.

3. Use a scalpel to carefully excise a DNA band. Use forceps to remove the gel slice and transfer it to an Eppendorf tube. Measure the mass of the agarose slice. Repeat for all other bands.
4. We used the Isolate II PCR and Gel Kit for all subsequent steps. Add 200 μL Binding Buffer CB per 100 mg of agarose gel.
5. Incubate sample at 50°C for 5–10 min, vortexing sample briefly every 2–3 min until gel slice is completely dissolved.
6. Place Isolate II PCR and Gel Column in a 2 mL collection tube and load sample.
7. Centrifuge 30 sec at 11000 g and discard flow-through. If there are replicates of the same sample, repeat this step to gather all the DNA onto one silica membrane (which results in a more concentrated sample downstream). Reuse collection tube for the next step.
8. Add 700 μL Wash Buffer CW to Isolate II PCR and Gel Column. Centrifuge 30 sec at 11000 g. Discard flow-through and place column back into collection tube.
9. Repeat washing step to minimize chaotropic salt carry-over.
10. Dry the silica membrane by centrifuging 1 min at 11000 g, to remove residual ethanol.
11. Place Isolate II PCR and Gel Column in a 1.5 mL microcentrifuge tube.
12. Add 15-30 μL Elution Buffer C directly onto silica membrane. Incubate at room temperature for 1 min. Centrifuge 1 min at 11,000 x g. Discard the column.
13. Quantify the concentration of DNA on a NanoDrop. It is preferable to blank with Elution Buffer C and not MQW.

---

DpnI digestion

DpnI is a restriction enzyme that digests hemimethylated DNA. When applied to a PCR product this reduces background template contamination during later transformation steps, as the bacterial plasmid is hemimethylated but synthetic DNA produced during PCR is not.

Ingredients	Amount per reaction
DpnI enzyme	0.5 μL
10x CutSmart buffer	1.3 μL

Method:

1. In a PCR tube mix 10 μL of cleaned PCR product, 1.3 μL of 10x CutSmart buffer, 1.2 μL of MQW, 0.5 μL of DpnI (10 U/μL).
2. Place in thermocycler. Incubate at 37°C for 90 min, 80°C for 20 min (to denature the enzyme) and then hold at 4°C as desired.
3. Be aware that the concentration of PCR product has been diluted by 10/13 after a DpnI digest (due to the additional reagents added).

---

Gibson assembly

All constructs were generated via Gibson assembly once long and short fragments had been generated by overlap extension PCR, subjected to PCR gel cleanup and DpnI digested.

Ingredients	Amount per reaction
2x Gibson mastermix: 0.05 U/μL Phusion polymerase 0.025 U/μL T5 exonuclease 1 U/μL Taq DNA ligase 100 mM Tris-HCl (pH 7.5) 10 mM MgCl2 0.2 mM dNTPs 10 mM DTT 5% (w/v) PEG-8000 1 mM NAD+	5 μL
Long fragment	50 ng
Short fragment	3:1 molar ratio to long fragment

Method:

1. Protocols ‘PCR product gel cleanup’ and ‘DpnI digestion’ must be performed on both long and short fragment prior to Step 2.
2. Use the DNA concentration measured after PCR product cleanup and the 10/13 dilution factor of the DpnI reaction to calculate the present concentration of long and short fragment PCR product.
3. Calculate the volume required to obtain 50 ng of long fragment. Transfer this volume into a PCR tube.
4. The short fragment must be loaded at a 3:1 molar ratio to the long fragment. Use the length of both fragments, and the concentration of the short fragment (accounting for DpnI digest dilution), to calculate the volume of short fragment solution required. Transfer this volume into a PCR tube.
5. Add 5 μL of Gibson mix. Top up to 10 uL using MQW.
6. Place in thermocycler and run the reaction at 50°C for 60 min. Hold at 4°C.

NB: in various protocols the long fragment may sometimes be referred to as ‘backbone’ and the short fragment may sometimes be referred to as ‘insert’. We prefer long and short fragment terminology. Also note that adjusting the short fragment to long fragment ratio can help troubleshoot the reaction.

---

Transformation into DH5α E. coli or BL21 E. coli

This protocol can be used to transform Gibson constructs into DH5α E. coli for amplification. Alternatively, an amplified (and purified) plasmid can be transformed into BL21 strains which are specialised for protein expression. In our experience, this protocol cannot be used to cotransform plasmids for amber codon suppression: please refer to the next protocol for further information.

Ingredients	Amount per protocol
BL21 cell aliquot	50 μL
Transformation buffer (TFB): 100 mM MnCl2 60mM KCH3COO 200mM KCl 20mM CaCl2 30% (w/v) glycerol pH 6.1	50 μL
Plasmid DNA	50 ng
LB media	250 μL
LB-agar antibiotic plate	1

Method:

1. Collect a 50 μL aliquot of DH5α (or BL21) cells and allow to thaw on ice.

NB: for TAG-RebA and TAG-RebB constructs, we found that successful transformations absolutely required One Shot™ TOP10 Chemically Competent E. coli from ThermoFisher. We tried transforming up to 400 ng of DNA into DH5α without success.

2. Under sterile conditions, add 50 μL of TFB to each aliquot of cells.
3. Add 50 ng of Gibson construct (or other plasmid) into the aliquot.
4. Let the aliquot rest on ice for 30min.
5. Heat shock the cells by putting the tubes in the 42°C heat block for 45 sec and then return them to ice. During this step the cells should take in plasmid DNA.
6. Under sterile conditions (blue flame for updraft and bench sprayed with ethanol) add 250 μL of LB media to the cells
7. Incubate aliquot at 37°C for 1h to recover.
8. Bacteria are plated to select for successful transformants. Under sterile conditions, transfer the transformant culture onto an appropriate plate and spread using streak beads or a plastic spreader.
9. Incubate at 37°C overnight.
10. If colonies grow (typically within 1 day), they can be used for an overnight bacterial culture (to either amplify DNA or prepare for protein expression).

---

Cotransformation for amber codon suppression

This protocol is used to transform two plasmids simultaneously into BL21 cells for protein expression. We used this protocol to cotransform pEVOL_AzF with TAG-RebA, TAG-RebB or pCDF RFP amber plasmid. The key difference is the greater quantity of plasmid and requirement for commercial chemically competent cells.

Ingredients	Amount per protocol
BL21(DE3) Competent Cells, ThermoFisher	50 μL
Transformation buffer (TFB): 100 mM MnCl2 60mM KCH3COO 200mM KCl 20mM CaCl2 30% (w/v) glycerol pH 6.1	50 μL
Plasmid DNA	200 ng
LB media	250 μL
LB-agar antibiotic plate	1

Method:

1. Collect a 50 μL aliquot of BL21(DE3) Competent Cells from ThermoFisher.

NB: Once again, in-house BL21 stocks were simply not sufficiently competent for this transformation step.

2. Under sterile conditions, add 50 μL of TFB to each aliquot of cells.
3. Add 200 ng of each plasmid to the aliquot.
4. Let the aliquot rest on ice for 30min.
5. Heat shock the cells by putting the tubes in the 42°C heat block for 45 sec and then return them to ice. During this step the cells should take in plasmid DNA.
6. Under sterile conditions (blue flame for updraft and bench sprayed with ethanol) add 250 μL of LB media to the cells
7. Incubate aliquot at 37°C for 1h to recover.
8. Bacteria are plated to select for successful transformants. Under sterile conditions, transfer the transformant culture onto an appropriate plate and spread using streak beads or a plastic spreader.

NB: for cotransformants, use plates with two antibiotics. For instance, both streptomycin and chloramphenicol were added to our LB-agar plates when working with pEVOL-AzF and TAG-RebA/B cotransformants.

9. Incubate at 37°C overnight.
10. If colonies grow (typically within 1 day), they can be used for an overnight bacterial culture.

---

Plating

LB-agar antibiotic plates are used to grow bacterial colonies under antibiotic selection pressure. These colonies can be used to prepare overnight bacterial cultures.

Ingredients	Amount per protocol
LB-agar 15 g/L agar 20 g/L LB	10mL per plate
Antibiotics	0.5-1mg

Method:

1. Prepare desired quantity of LB-agar (15 g/L agar and 20 g/L LB and heat to dissolve)
2. Allow to cool below 50°C (being able to hold it for 10 sec without pain is a good rule of thumb).
3. Pour off desired quantity of LB-agar and add an appropriate antibiotic concentration (50-100 μg/mL is standard).
4. Under sterile conditions, pour 10 mL of antibiotic LB-agar into a Petri dish and allow to set.
5. Provided no antibiotic has been added to the LB-agar prepared in step 1, it can be stored and re-melted for future use.

---

Isolating amplified plasmids

This protocol prepares concentrated plasmid DNA for a variety of downstream applications, including transformation, sequencing, PCR, and other.

Ingredients	Amount per protocol
Isolate II Plasmid MiniKit	1
Overnight culture	10 mL

Method:

1. Our team used the Isolate II Plasmid MiniKit, which contains all the necessary buffers and reagents.
2. Prepare and harvest a 10 mL overnight culture as outlined in the ‘Overnight bacterial cultures’ protocol.
3. Lyse cells by adding 250 μL of resuspension buffer P1 and resuspending the cell pellet by vortexing or pipetting up and down. Transfer the resuspended sample into a 1.5 mL Eppendorf tube.
4. Add 250 μL of lysis buffer P2 and mix gently by inverting tube 6-8 times. Incubate at room temperature for up to 5 min or until lysate appears clear.
5. Add 300 μL neutralization buffer P3 and mix thoroughly by inverting tube 6-8 times.
6. Clarify lysate by centrifuging for 5 min at 11,000 g at room temperature.
7. Place spin column in 2 mL collection tube. Pipette 750 μL of clarified sample supernatant onto column. Centrifuge for 1 min at 11,000 g and discard flow-through.
8. If more than 750 μL of clarified lysate was collected in step 6, repeat this step using the spin column to concentrate DNA on the silica membrane.
9. Wash silica membrane by adding 600 μL of wash buffer PW2 and centrifuge for 1 min and 11,000 g. Discard flow-through and reuse collection tube.

NB: always ensure that ethanol has been added to wash buffer PW2. This is a common mistake and will result in loss of DNA sample as it does not precipitate.

10. Dry silica membrane by centrifuging for 2 min at 11,000 g to remove any residual ethanol.
11. Elute DNA by adding 50 μL MilliQ Water (MQW; do not use the elution buffer, especially if you are sending DNA for sequencing; if you did use EB, use a PCR cleanup kit to change the buffer but you will lose yield) directly onto the center of the silica membrane. Centrifuge for 1 min at 11,000 g.
12. Measure [plasmid DNA] on the NanoDrop. Expected yields for easy downstream application are 80-100 ng/μL but vary immensely depending on plasmid copy number.

---

Bioconjugation

Thiol-maleimide conjugation

This protocol was used to attach maleimide-functionalised cargo, such as sulfo-Cy5 maleimide or aldoxorubicin, to cysteine-modified R bodies, N RebB and C RebB.

Ingredient	Amount per reaction
Labelling buffer: 20 mM HEPES, pH 7.5 10 mM TCEP	100 µL
Maleimide-functionalised cargo (10 mM stock)	12.5 µL
R bodies	40 µL

Method:

1. Degas labelling buffer.
2. Prepare a 10 mM stock solution of maleimide-functionalised cargo in appropriate solvent such as DMSO.
3. Prepare 100 µL of R body solution resuspended in labelling buffer (refer to Figure 3).
4. Add 12.5 µL of dissolved maleimide-functionalised cargo and incubate overnight, rotating at room temperature.
5. Wash 3x with 1 mL MQW by repeatedly spinning the solution down at 12000 g for 5 min and then aspirating supernatant. If using dye, the supernatant should be clear after washing.

NB: when working with dyes, always keep tubes wrapped in foil and the lights off. There is also no exact measurement for how much R body to use, as to the best of our knowledge no assay exists that can characterise R body concentrations, nor do we know whether dehydrating them entirely (for mass measurements) preserves their function. Figure 3 indicates the approximate size of pellet used in this reaction. In the future, a precise protocol will need to be developed for therapeutic implementation.

---

Copper-catalysed azide-alkyne huisgen cycloaddition (CuAAC)

This reaction stably conjugates an azide and alkyne functional group. We used this protocol to conjugate sulfo-Cy5 alkyne to the azide group of the AzF amino acid in TAG-RebA and TAG-RebB. We also used this protocol to conjugate sulfo-Cy5 azide to the alkyne group of 5-ethynylpicolinaldehyde in the 2-PCA protocol.

Ingredient	Amount per reaction
CuSO4 (10 mM stock)	1 µL
Sodium ascorbate (50 mM aqueous stock)	1 µL
Tris-hydroxypropyltriazolylmethylamine, THPTA (10 mM stock)	2 µL
Azide- or alkyne-functionalised cargo (10 mM stock)	15 µL
R bodies	40 µL

Method:

1. Mix CuSO₄ stock solution with THPTA stock solution in a 1:2 molar ratio. Allow to complex for 10 min at room temperature then degas with nitrogen.
2. Degas 50 mM sodium ascorbate stock solution with nitrogen.
3. Prepare a 10 mM stock solution of azide- or alkyne-functionalised cargo in degassed solvent like DMSO.
4. Prepare 100 µL of R body solution resuspended in degassed MQW (refer to Figure 3 above).
5. Add 1 µL of degassed CuSO₄ solution (final concentration 100 µM) and mix.
6. Add 15 µL of dissolved azide- or alkyne-functionalised cargo (final concentration 1.5 mM) and mix.
7. Add 1 µL degassed sodium ascorbate solution (final concentration 500 µM) and mix.
8. Incubate overnight, rotating at room temperature.
9. Wash 3x with 1 mL MQW by repeatedly spinning the solution down at 12000 g for 5 min and then aspirating supernatant.

---

Sortase A ligation

This enzymatic ligation is performed between a C-terminal LPETG motif and N-terminus oligoglycine motif. We ligated RebA-LPETG or RebB-LPETG R bodies to GGG-mNeonGreen.

Ingredient	Amount per reaction
GGG-mNeonGreen (770 µM stock)	50 µL
Sortase (500 µM stock)	2 µL
10x sortase buffer: 500 mM Tris-HCl, pH 7.5 1.5 M NaCl 100 mM CaCl2 1 mM NiSO4	10 µL
R bodies	40 µL

Method:

1. Pellet R bodies as described in Figure 3. Aspirate the supernant but do not resuspend yet.
2. Add GGG-mNeonGreen, sortase, 10x sortase buffer and then resuspend R bodies into the mixture.
3. Rotate for 1 h at room temperature then continue rotating at 4°C overnight.
4. Wash 3x with 1 mL MQW by repeatedly spinning the solution down at 12000 g for 5 min and then aspirating supernatant

---

2-pyridinecarboxyaldehyde (2-PCA) conjugation

We used this click chemistry reaction which functionalises the N-terminus of RebA and RebB monomers with an alkyne group. This allowed us to use CuAAC to ligate a sulfo-Cy5 azide onto R bodies.

Ingredient	Amount per reaction
HEPES (20 mM, pH 7.5)	100 µL
5-ethynylpicolinaldehyde (100 mM stock)	1 µL
R bodies	40 µL
20 %(v/v) ethanol	5 mL

Method:

1. Prepare a 100 mM stock solution of 5-ethynylpicolinaldehyde in DMSO.
2. Prepare 100 µL of R body solution resuspended HEPES buffer (20 mM, pH 7.5; refer to Figure 3 for R body pellet size).
3. Add 1 µL of 5-ethynylpicolinaldehyde.
4. Incubate overnight at 37°C with shaking.
5. Wash 3x with 1 mL MQW by repeatedly spinning the solution down at 12000 g for 5 min and then aspirating supernatant. If conjugating with sulfo-Cy5 azide, an additional 5x washes with 1 mL 20% ethanol will be required.
6. For further conjugation onto the alkyne group provided by 5-ethynylpicolinaldehyde, refer to the CuAAC protocol above.

---

Protein gels

Ingredient	Amount per protocol
Bolt Bis-Tris 4-12% gel	1
NuPAGE MES SDS running buffer	~200 mL
Mark12 unstained standard	5 µL
NuPAGE LDS sample buffer	Gel dependent
Protein gel samples	Gel dependent

Method:

1. Mix protein samples with 1x LDS and boil at 90°C to denature all proteins.
2. Load samples into a Bolt Bis-Tris 4-12% gel in 1x MES-SDS buffer along with 5 μL Mark12 unstained standard.
3. Apply an electric current to the gel at 165 V for 35 min.
4. For Coomassie-staining, wash gels with water and then incubate in Coomassie Brilliant Blue G-250 for 30 min – 1 h.
5. After staining, wash gels with water again and image with a GS-900TM Calibrated Densitometer (Bio-Rad).

---

In Vitro Application

Testing R body endocytosis in suspension culture

This protocol was used to assess whether R bodies are taken up into EXPI293 cells by endocytosis. Both RebA-LPETGGG-mNeonGreen and aldoxorubicin-Cys-N RebB have been used by us in this protocol. It is generalisable to all R body constructs.

Ingredient	Amount per protocol
EXPI293 cell culture	1 mL per well
R body pellet	500 µL
100% ethanol	6 mL
EXPI293 expression medium	500 µL
0.4% (w/v) trypan blue dye	10 µL

Method:

1. Conduct all steps in a Biosafety Cabinet II (BSCII) for sterility.
2. Sterilise the BSCII by incubation under a UV lamp for 30 minutes. Wipe down all surfaces with 80% ethanol. Sterilise any materials that entire the BSCII with 80% ethanol.
3. Prepare an EXPI293 cell culture with a density of 1x10⁶ cells/mL and passage number < 30.
4. Wash 500 µL of a R body pellet (e.g. conjugated RebA-LPETGGG-mNeonGreen) three times in 1 mL MQW by spinning at 12000 g for 5 min, aspirating supernatant and adding fresh MQW.
5. Under sterile conditions, transfer the washed R body pellet into an autoclaved Eppendorf tube. Resuspend and wash 6x in 1 mL 100% ethanol. After the last spin, remove supernatant and resuspend pellet in 500 µL of EXPI293 expression medium.
6. Pipette 1 mL of the EXPI293 cell culture into each well of a sterile 12-well tissue culture plate.
7. Incubate for the desired length of time (our assays lasted 24 and 48 hours respectively) in a CO2 incubator on a shaking platform (37°C, 5% CO2, 100% humidity, shaker set to 150 rpm).
8. Once incubation is finished, take 10 µL of suspension culture and mix with 10 µL 0.4% (w/v) trypan blue dye. The sample is ready for imaging.

NB: trypan blue dye is used to differentially stain apoptotic and live cells. However, we found that it was useful for quenching fluorescence in solution around cells thus improve contrast for intracellular contents. If fluorescence intensity in extracellular medium is of interest, trypan blue should not be used.

Cell maintenance

Make sure you take care of your cell cultures!

Ingredient	Amount per protocol
EXPI293 expression medium	Passage dependent
EXPI293 cell culture	Passage dependent
0.4% (w/v) trypan blue dye	10 µL

Method:

1. Conduct all steps in a Biosafety Cabinet II (BSCII) for sterility.
2. Sterilise the BSCII by incubation under a UV lamp for 30 minutes. Wipe down all surfaces with 80% ethanol. Sterilise any materials that entire the BSCII with 80% ethanol.
3. Pre-warm EXPI293 expression media in a 37°C water bath.
4. Take a 10 µL sample of an EXPI293 cell culture. Mix with 10 µL of 0.4% (w/v) trypan blue for imaging.
5. Count the cells with a haemocytometer and calculate the cell culture density.
6. Maintain the culture between densities of 0.25 million cells/mL and 2 million cells/mL. These cells should double in density approximately every 24 hours, so the cultures will need to be passaged every 3 days. The culture volume should be 1/5 of the conical flask, leaving 4/5 as air.
7. When a passage is required, calculate the appropriate dilution to be made. E.g, a 25 mL culture at density 2 million cells/mL should be diluted 1:8 times. Transfer 3.1 mL of the cell culture to a fresh conical flask. Mix with 21.9 mL of pre-warmed EXPI293 expression medium.
8. Incubate the cell culture in a CO₂ incubator on a shaking platform (37°C, 5% CO₂, 100% humidity, shaker set to 150 rpm).