Overview
In our project, we have developed a biosensor using aptamer to detect Shigella dysenteriae, Escherichia coli, and Salmonella typhimurium in refrigerators. The experimental protocals are shown as follows.
Obtain the relevant sequences information for this project
By querying databases, plasmid sequences, and literature references, we obtained the related sequences information as follows:
1. AmilGFP gene sequence：
ATGTCTTATTCAAAGCATGGCATCGTACAAGAAATGAAGACGAAATACCATATGGAAGGCAGTGTCAATGGCCATGAA TTTACGATCGAAGGTGTAGGAACTGGGTACCCTTACGAAGGGAAACAGATGTCCGAATTAGTGATCATCAAGCCTGCG GGAAAACCCCTTCCATTCTCCTTTGCATACTGTCATCAGTCTTTCAATATGGAAACCGTTGCTTCACAAAGTACCCGGCA GACATGCCTGACTATTTCAAGCAAGCATTCCCAGATGGAATGTCATATGAAAGGTCATTTCTATTTGAGGATGGAGCAG TTGCTACAGCCAGCTGGAACATTCGTCTCGAAGGAAATTGCTTCATCCACAAATCCATCTTTCATGGCGTAAACTTTCC CGCTGATGGACCCGTAATGAAAAAGAAGACAATTGACTGGGATAAGTCCTTCGAAAAAATGACTGTGTCTAAAGAGG TGCTAAGAGGTGACGTGACTATGTTTCTTATGCTCGAAGGAGGTGGTTCTCACAGATGCCAATTTCACTCCACTTACAA AACAGAGAAGCCGGTCACACTGCCCCCGAATCATGTCGTAGAACATCAAATTGTGAGGACCGACCTTGGCCAAAGTG TGCAAAAGGCTTTACAGTCAAGCTGGAAGCACATGCCGCGGCTCATGTTAACCCTTTGAAGGTTAAATAATAA
2. mRFP gene sequence：
ATGTCAGTGATTAAGCAGGTAATGAAGACCAAGTTGCACCTTGAGGGCACTGTCAATGGCCATGATTTTACGATCGA GGAAAATGACAGTCACCAAAGGCGCGCCTCTGCCGTTTTCCGTTCATATTCTTACACCTAGCCACATGTATGGAAGC AAACCGTTTAATAAGTATCCAGCGGATATCCCAGACTACCACAAACAGTCTTTTCCCGAAGGTATGTCTTGGGAGCG GTCGATGATTTTTGAAGATGGTGGCGTATGCACCGCCAGTAATCACTCCAGCATAAACTTGCAAGAGAACTGTTTCAT CTATGATGTTAAATTTCATGGTGTGAACCTGCCTCCGGATGGGCCCGTAATGCAAAAAACCATTGCTGGATGGGAGC CGAGCGTGGAAACACTGTACGTGCGTGACGGGATGTTAAAAAGTGACACTGCAATGGTTTTTAAACTGAAAGGAGG CGGTCATCATCGTGTTGATTTCAAAACGACGTATAAAGCCAAAAAACCTGTCAAGCTGCCAGAATTTCATTTCGTTGA ACATCGCCTGGAACTGACCAAACACGATAAAGATTTCACAACTTGGGACCAGCAGGAGGCAGCCGAAGGCCATTT CTCACCGCTGCCGAAGGCTCTCCCATAATAA
3. amilCP gene sequence：
ATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGTCAGGCACGGTCAATGGACACTACTTTGAGGTCGAA GGCGATGGAAAAGGTAAGCCCTACGAGGGGGAGCAGACGGTAAAGCTCACTGTCACCAAGGGCGGACCTCTGCCA TTTGCTTGGGATATTTTATCACCACAGTGTCAGTACGGAAGCATACCATTCACCAAGTACCCTGAAGACATCCCTGACT ATGTAAAGCAGTCATTCCCGGAGGGCTATACATGGGAGAGGATCATGAACTTTGAAGATGGTGCAGTGTGTACTGTCA GCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACCATGTCAAGTTCTCTGGTTTGAACTTTCCTCCCAATGGACCT GTCATGCAGAGAAGACACAGGGCTGGGAACCCAACACTGAGCGTCTCTTTGCACGAGATGGAATGCTGCTAGGAAA CAACATTTATGGCTCTGAAGTTAGAAGGAGGCGGTCACTATTTGTGTGAATTTAAAACTACTTACAAGGCAAAGAAGT GAACCTGTGAAGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAATCACAACAAGGATTACACTTCG GTTGAGCAGTGATTTCCATTGCACGCAAACCTGTGGTCGCCTAATAA
4. The aptamer sequence of Shigella dysenteriae:
CGGAACUAGCGUUUAAAUGCCAGGACUGAAGUAGGCAGGG
5. The aptamer sequence of Escherichia coli:
AUACCAGCUUAUUCAAUUGCACGAAUUUGCUGUGUUUUUGGGGGGGUCGGGGAGUAUAAGAUAGUAAGUG
CAAUCU
6. The aptamer sequence of Salmonella typhimurium:
UCACUGUUAUCCGAUAGCAGCGCGGGAUGA
7.The lacZ gene sequence is from NC_000913.3:c366305-363231 Escherichia coli str. K-12 substr. MG1655.
Return to index
PCR protocol
The reaction components are assembled in the PCR protocol as described below. The final volume should be 20 µL.
1. All reagents are thawed on ice.
2. Assemble reaction mix into 20 µL volume in a thin walled 0.2 mL PCR tubes as follow:
8 uL ddH2O
1 µL DNA Template
0.5 uL Primer F
0.5 uL Primer R
10 uL 2x Taq mixture
3. Prepare negative control reaction without template DNA. Prepare positive control reaction with template of known size and appropriate primers.
4. Gently mix by tapping tube. Briefly centrifuge to settle tube contents.
5. Put the tube into a PCR instrument.
6. Set up the following PCR program: initial denaturing at 94°C for 4 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min, plus a final extension at 72°C for 10 min.
7. Check the PCR product by agarose gel electrophoresis.
Return to index
Gel Electrophoresis
1. Prepare 100mL 1xTAE buffer with 1 g agarose, and boil it three times, shake completely, and waiting for cool.
2. Pour the agarose gel into gel tray, assemble gel pouring apparatus by inserting gate into slots.
3. Allow agarose to cool, place the gel in the apparatus rig with the wells facing the negative end (black-colored).
4. Fill the rig with 1x TAE buffer.
5. Load 8 μL of DNA maker into lane.
6. Mix 1 μL of 10x loading buffer with 5 μL DNA sample, load them into lane.
7. Run at 100 V for 30 min.;
8. Use the Gel imaging system to check the gel;and take a picture.
9. Deal with the gel carefully as medical waste.
Return to index
The Competent Cell Preparation
1. Streak the E. coli stock on a LB-agar plate. Incubate the plate at 37°C overnight.
2. Pick a single well-isolated colony and inoculate it into 3 mL of LB broth solution. Incubate it at 37°C overnight (more than 16 h) with shaking at 220 rpm.
3. Transfer 250 uL of the saturated overnight solution to a sterile 50 mL polypropylene tube containing 25 mL of LB medium. Incubate the E. coli at 37°C with shaking at 220 rpm until OD600 reaching 0.6. This usually takes 2.5 h. Check the OD every 30 min after 1 h to avoid overgrowth.
4. When the medium reaches an OD600 of 0.6, chill the tube on the ice for 30 min and then centrifuge at 8000 rpm for 1 min at 4°C, discard the supernatant.
5. Re-suspend the E. coli in 2.5 mL of ice-cold TSS solution with gentle swirling. Incubate on ice for 10 min. Aliquot in 50 uL per tube. Now the competent cells are ready to be transformed.
Note: Transformation and Storage Solution (TSS) contains LB medium 85% 8.5 mL, PEG (wt/vol, Mw 8000) 10% 1.0 g, DMSO (vol/vol) 5% 500 μL, and MgCl2 (pH 6.5) 50 mM 500 μL.
Return to index
Plasmid Transforming and Pick monoclonal
1. Thaw TSS cells on ice.
2. Add 5 uL Synthetic plasmid DNA in TSS cells, pipette gently to mix.
3. Incubate it on ice for 30 min with occasional mixing.
4. Heat shock at 42°C for 90 sec.
5. After heat shock, put it on ice for 2 min, add 0.8 mL LB medium into the cells.
6. Shake and incubate at 37°C for 60 min at 120 rpm.
7. Take out 100 uL medium and spread them on the appropriate agar plates with certain antibiotic.
8. Incubate the plates at 37°C overnight.
9. Pick monoclonal into certain antibiotic LB medium, and incubate the medium at 37°C overnight.
Return to index
Plasmid Isolation Protocol
1. The bacteria that contained target plasmid were cultivated at 37°C overnight.
2. Take out 1,500 uL solution of cultivated bacteria to a 2mL micro-centrifuge tube. The tube was centrifuged at 12,000 rpm for 1 min at room temperature, and then the supernatant was discarded. In this tube, repeating these steps three times to increase the concentration of the bacteria.
3. Add 250 uL Solution I buffer to suspend the precipitation. Complete suspension is vital for obtaining good plasmid yield by vortexing or pipetting up and down.
4. Add 250 uL Solution II buffer, mix gently upside down 4-6 times to make a cleared lysate. A 2-3 min incubation at room temperature may be necessary. However, this step should not be more than 5 min, and avoid vigorous mixing as doing so will shear chromosomal DNA and lower plasmid purity.
5. Add 350 uL Solution III buffer, mix gently and fully upside down 6-8 times, centrifuge the tubes at 12,000 rpm for 10 min at room temperature.
6. Put a HiBind DNA Mini Column into a 2 mL Collection Tube.
7. The supernatant in step 4 is transferred to the Mini Column, and centrifuged at 12,000 rpm for 1 min, the filtrate is discarded.
8. Put the Column back into the Collection Tube, add 500 uL HBC Buffer, centrifuge at 12,000 rpm for 1 min, the filtrate is discarded.
9. Put the Column back into the Collection Tube, add 700 uL Washing buffer, centrifuge at 12,000 rpm for 1 min, the filtrate is discarded. Repeat the washing step once.
10. Put the Column back into the Collection Tube and centrifuge at 12,000 rpm for 2 min.
11. Put the Column into a new 1.5 mL micro-centrifuge tube and leave it for 2 min at room temperature. Then add 50 uL ddH2O to the center of the Column matrix, and leave it at room temperature for 1 min. Centrifuge at 12,000 rpm for 1 min. Discard the HiBind DNA Mini Column.
12. Measure concentration of extracted plasmid DNA by nanodrop 1000, and store plasmid DNA at -20°C.
Return to index
Plasmid DNA Restriction endonuclease Digestion
DNA for downstream applications is usually digested with restriction endonucleases. Type II restriction enzymes are the most widely used in molecular biology application.
The reaction volume are carried out in 20 µL.
1. Add components to a clean tube in the order as follow:
1 µL DNA (1 µg/µL)
2 µL 10x buffer
1 µL each restriction enzyme (EcoR1 and HindⅢ)
15 µL ddH2O
2. Mix gently and fully, and incubate the tube at certain temperature (37°C) for 1 h.
3. Stop the reaction by heat inactivation (65°C for 15 min).
4. The digested DNA is ready for use in research applications.
Return to index
Preparation of mutant Engineering E.coli by homologous recombination
1. Design knock-out primers according to the sequence of knock-out target gene, lacZ, and replace kanamycin gene for screening. The primers were designed as follows.
Forward primer: 5’ATGACCATGATTACGGATTCACTGGCCGTCGTG TAGGCTGGAGCTGCTTC3’
Reverse primer: 5’TTATTTTTGACACCAGACCAACTGGTAATGATGG GAATTAGCCATGGTCC3’
2. The PCR system was prepared, and the pET-28a plasmid was used as the template to amplify kanamycin gene with the homologous arm primers.
3. After the PCR reaction, the gene fragment with a size of about 1.6 Kb was identified by electrophoresis.
4. The PCR product was purified and obtained the homologous arm fragment containing kanamycin gene.
5. The homologous arm linear fragment obtained above was mixed with competent cells of E. coli BL21 (DE3), transfected by heat shock method at 42°C, and then the bacterial solution was coated on LB plates containing kanamycin resistance to obtain BL21DlacZ mutant engineering strain.
6. To further verify the kanamycin resistant BL21 mutant strain with lacZ gene deletion, colony PCR method was used to confirm it. The lacZ primers are as follows: lacZ-F: 5’ ATGACCATGATTACGGATTCACTGG3’ and lacZ-R: 5’ TTATTTTTGACACCAGACCAACTGG3’. The PCR protocol refers to the above.
Return to index
Purification of His/S-tagged protein
All the procedures were performed at 4 °C or on ice unless otherwise specified.
1). 10 mL BL21 cells transformed with a pET-28a-lacZ were cultured at 30°C until an OD660 of approx. 0.8.
2). Add IPTG to the culture (final 0.67 mM IPTG)
3). Cultivate at 30 °C for 2 h.
4). Collect cells in 5 mL tube, centrifuge at 5,000 rpm at 15 min.
5). Suspend cells in 5 mL of TBS, transfer the content to 1.5 mL tube.
6). Collect cells at 10,000 rpm at 1 min. The supernatant was discarded.
7). Add 500 µL of ice-cold lysis buffer to the cell pellet.
8). Sonicate cell (4°C).
9). Clarify lysate by centrifugation at to 10,000 rpm at 10 min.
10). After centrifugation, save 20 µL of supernatant for SDS-PAGE sample.
11). Transfer supernatant to the 1.5mL tube containing pre-balanced resin bead gel.
12). Shake gently (4°C) for 30 min.
13). Centrifuge the tube 1,200 rpm for 30 sec. The supernatant was discarded.
14). Wash resin bead gel with washing buffer, Centrifuge the tube 1,200 rpm for 30 sec. The supernatant was discarded. Repeat it once.
15). Elute the protein 3 time with 20 µL of elution buffer. It is ready to prepare the SDS-PAGE sample.
Return to index
SDS Gel Electrophoresis
1). Make up 30 mL of running gel by adding components to a clean glass in the order as follow:
12.3 mL H2O
7.5 mL 1.5 M Tris-HCl, pH 8.8
0.15 mL 20% (w/v) SDS
9.9 mL Acrylamide/Bis-acrylamide(30%/0.8% w/v)
0.15 mL 10% (w/v) ammonium persulfate (APS)
0.02 mL TEMED
2). Mix the ingredients mentioned above.
3). Pour the solution quickly into a gel casting form, and leave about 2 centimeters below the bottom of the comb for the stacking gel. Then layer the top of the gel with water very carefully. Wait for about 30 min for the gel to polymerize completely.
4). While waiting, mix the reagents for the stacking gel (4% Acrylamide) by adding components to a clean glass in the order as follow:
3.075 mL H2O
1.25 mL 0.5 M Tris-HCl, pH 6.8
0.025 mL 20% (w/v) SDS
0.67 mL Acrylamide/Bis-acrylamide (30%/0.8% w/v)
0.025 mL 10% (w/v) ammonium persulfate (APS)
0.005 ml TEMED
5). Mix the ingredients mentioned above.
6). Remove the water on the top of running gel, and pour the stacking gel on top of the running gel. Insert the combs by trying not to produce bubbles stuck underneath and allow another 0.5 - 1 h for complete polymerization.
7). Prepare samples: mix the protein 4:1 with the loading buffer. Heat the sample by Boiling for 5-10 min.
8). Run gel. Clamp the gel and fill both buffer chambers with gel running buffer. Pipet the sample and molecular weight standard marker into the gel. Attach the power leads and run the gel until the blue dye reaches the bottom.
9). Visualize the proteins using Coomassie Brilliant Blue.
Return to index
Preparation of E. coli BL21DLacZ cell lysate extract
1. Choose the single colonies of the engineered bacteria constructed above and inoculate them in 5 ml LB medium, and culture them overnight at 37°C at 220 rpm in a shaker.
2. The next day, the medium above was transferred to 300 mL of 2 × YTPG medium, and cultured at 37°C on a shaker at 220 rpm.
3. When the OD600 value of the bacterial concentration grows at the later logarithmic period, the bacteria are collected. Centrifuge 10000 g for 1 min and remove the supernatant.
4. Suspend the bacteria with the precooled S30 buffer, mix well with a shaker, and mix at 4°C and 8000 g for 7 min and remove the supernatant. This step is repeated 3 times, and all traces of the supernatant is finally discarded.
5. Add 1 mL precooled S30 buffer to every 1 g of bacteria and mix well.
6. Cells were crushed with a ultrasonic cell breaker, turn on for 2S, turn off for 2S, the total time is 15 min, and the temperature alarm is set at 40°C.
7. Centrifuge the tube at 4°C, 12000 g for 20 min and take the supernatant into a new tube, freeze it in liquid nitrogen, and store it in the refrigerator at -80°C. Ready for use as the lysate extract.
Note: 2 × YTPG medium:22 mM potassium dihydrogen phosphate, 40 mM dipotassium hydrogen phosphate, 100 mM glucose, 16 g/L tryptone, 10 g/L yeast extract, 5 g/L sodium chloride. S30 Buffer: 10 mM Tris-acetate (pH8.2), 14 mM magnesium acetate, 60 mM potassium glutamate, 2 mM DTT.
Return to index
Construction of cell-free system
1. Prepare 11 mixtures in advance: 9 mM magnesium acetate, 90 mM potassium glutamate, 80 mM ammonium acetate, 57 mM HEPES-KOH, 0.171 mg/mL tRNA, 0.034 mg/mL folic acid, 2 mM dithiothreitol, 1 mM putrescine, 1.5 mM spermidine, 4 mM oxalic acid, 33 mM sodium pyruvate.
2. Prepare cell-free reaction system (15 µL): 6 µL 11 mixtures, 1.2 mM ATP, 0.86 mM GTP, CTP and UTP, 5% (V/V) PEG-8000, 0.1 mM phosphoenolpyruvate （PEP）, 0.27 U/µL RNase inhibitor, 2 mM 20 kinds of amino acids, 25% (V/V) E. coli BL21DLacZ cell lysate extract, 5% (V/V) 20 mg/mL X-gal chromogenic substrate.
3. Add 5 nM pET-28a-aptamer-lacZ toehold switch plasmid.
4. Incubate at 37°C for 1 h, and record the color change of the solution.
Note: use colored protein as indicator, add corresponding toehold switch plasmid, and do not add X-gal substrate.
Return to index
Preparation of hydrogel cell-free system
1. Prepare 0.25% (w/v) initiator standard solution. Take 20 mL PBS and add it to a brown bottle containing 0.05g LithiumPhenyl (2,4,6-trimethylbenzoyl) phosphinate (LAP); Heat and dissolve in a 45°C water bath for 15 min, oscillating several times during this period.
2. Prepare Gelatin Methacryloyl (GelMA) solution (GelMA concentration of 5% (w/v)). Take the required mass of GelMA and place it in a centrifuge tube; Take the initiator standard solution mentioned above and add it to the centrifuge tube, shake it to fully lubricate GeIMA; Dissolve in a 65°C water bath and avoid light for 30 min, oscillating several times during this period until completely dissolved; Centrifuge to remove bubbles from the solution (3000 rpm. 2 min); Immediately use 0.22 um sterile needle filter to sterilize GelMA solution.
3. Preparation of cell-free hydrogel. Take a cell-free system and suspend it in GelMA solution preheated at 37°C to prepare a cell-free system suspension; Inject it into the 24 hole plate (300-500 uL/hole) of the orifice plate, irradiate the gel with 405 nm light source for 10-30 sec, and adjust the gel strength through the light time and intensity.
Return to index