Experiments

Principle:

We decide to use homologous recombination to knockout the target genes. It has been known for a long time that many bacteriophages encode their own homologous recombination. After referring to many gene knockout articles, we decide to use lamada Red system which has been shown exhibit a greatly enhance rate of recombination over other system while using linearly DNA. In this system, to replace a specific genes on bacteria chromosome, a selectable antibiotic resistant genes that is generated by PCR by using primers with homology extensions. (Those extension is similar to the upstream sequence and downstream sequence of the genes that is expected to knockout). After this PCR product is transformed into the bacteria, the plasmid that encodes Red system is activated so that Red mediated recombination can take place. The target genes on the chromosome is knockout and replaced by the antibiotic genes. After selection, another kind of recombinase is expressed to eliminate the antibiotic genes (This recombinase only act on the directly repeated FRT sites flanking the resistant genes) so that further knockout of other genes can proceed. (References: Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000 Jun 6;97(12):6640-5. doi: 10.1073/pnas.120163297. PMID: 10829079; PMCID: PMC18686.)

Design procedure:

1. Design the primers that contains homology extension of the upstream and downstream genes of acka-pta gene.
   
   The designed primer should be able to amplify the antibiotic genes flanking by FRT sequences that are previously designed in the plasmid pKD4.
   In details:
   Homo Fwd primer (50bp homology extension):
   CTATGGCTCCCTGACGTTTTTTTAGCCACGTATCAATTATAGGTACTTCCGTGTAG
   GCTGGAGCTGCTTC
   
   
   
   Homo Rev primer (50bp homology extension):
   TTATTTCCGGTTCAGATATCCGCAGCGCAAAGCTGCGGATGATGACGAGACATAT
   GAATATCCTCCTTAG
   
   
   Veri Fwd: CTATGGCTCCCTGACGTTTTTTTAG
   Veri Rev: TTATTTCCGGTTCAGATATCCGCAG
   
   This pair of primer are used to amplify the sequence from upstream of Acka-pta gene to its downstream so that we can check whether the Acka-pta gene is knockout after homologous recombination.
   
   
   

   Brief Overview of the protocol

   
   

2. Material needed:
   1). The primer we design.
   2). pkD4 plasmid: The plasmid the contains FLP flanked antibiotic genes.
   3). pKD46: Encoding the recombinase that knockout the target genes and replace it with the FRT flanked antibiotic genes.
   4). Arabinose: A kind of sugar that can activate pKD46 plasmid to express recombinase to initiate the while knockout process.
   5). pCP20 plasmid: Encoding the proteins that can eliminate the antibiotic genes flanked by FRT sequence.
   
3. Using PCR and the primer we design to amplifying the antibiotic gene flanked by FRT sequence on plasmid pKD4.
   
4. Transforming pKD46 into the E. coli.
   
5. Activating pkD46 by adding arabinose to the culture.
   
6. Electroporating PCR product into the cell.
   
7. Using antibiotic selection to select the colony whose acka-pta gene has been knockout.
   
8. Transforming the selected bacteria with pCP20 plasmid to eliminate its antibiotic genes
   
9. Incubating the culture to eliminate the pCP20 plasmid in cells.
   
   
   

   Inspirations

   2019 Nantes
   2019 TU Eindhoven
   2019 Mingdao
   2020 Amsterdam
   2020 NCTU Formosa
   2020 USAFA
   

What should this page contain?

---

Describe the research, experiments, and protocols you used in your iGEM project. These should be detailed enough for another team to repeat your experiments.

If you made Parts this year, please remember to put all information, characterization, and measurement data on the Part’s Main Page on the Registry.