Skip to main content

Experiments

As the main focus of this years project was the creation of a textile 5 subgroups were established in order to do experiments on reaching the optimum requirements for cultivation, the establishment of property defining features through Synbio means and finally the testing of chemical and mechanical properties of all synthesised samples.

Subgroups​

Hemicellulose labgroup

Inducible BC labgroup

Co-culture labgroup

Dye labgroup

Property testing labgroup

Apart from the labgroups, we wanted to investigate the sustainability aspects of bacterial cellulose production. For this, we established a study for LCA, in which key performance indicators were determined.

LCA

General​

In the following two studies we have collected labwork which is unrelated to the studies above.

General tasks

Media creations

Protocols​

In this section, we provide the resources in our eLab of our project. This includes default as well as standardized protocols and few additional contents.

Resources

Oligonucleotide-based gene sythesis

For assembly of plasmids for the inducable Bacteriall cellulose synthesis, we used a sythetic terminator, L3S2P2111. This Terminator itself is with 61 base pairs rather short. Combined with Golden Gate recognition sites and overhangs required for assembly, the complete sequence was composed out of 94 base pairs. To save sythesis budget and primer sythesis budget, we opted to utilize oligonucleotide-based gene sythesis for this part.

PartDNA sequence
Primer 1 (P041 L3S2P21 Term fwd)TATCACCTGCACTAGTAACTCGGTACCAAATTCCAGAAAAGAGGCCT
CCCGAAAGGGGGG
Primer 2 (P042 L3S2P21 Term rev)TATCACCTGCACTATGGACCAAAACGAAAAAAGGCCCCCCTTTCGGG
AGGC
Resulting sequence (IBC 15 / L3S2P21)TATCACCTGCACTAGTAACTCGGTACCAAATTCCAGAAAAGAGGCCT
CCCGAAAGGGGGGCCTTTTTTCGTTTTGGTCCaTAGTGCAGGTGATA

A "classical" self-annealing reaction would result in the following product:

Self annealing

The self-annealing region has a melting temperature of ~61°C (as it is also recommended for classical primers). To backfill the 5' ends of the DNA strand, the usual approach would be to use a T4 polymerase or DNA polymerase I, Large (Klenow) fragment. To avoid additional expense, we opted to combine classical primer self-annealing strategies with standard Q5 PCR setups. The reaction was set up as the following:

Component50µl ReactionFinal Concentration
Q5® High-Fidelity 2X Master Mix 225µl1X
10 µM Primer 1 (P041 L3S2P21 Term fwd)12.5µl2.5µM
10 µM Primer 2 (P042 L3S2P21 Term rev)12.5µl2.5µM

Thermocycler conditions:

StepTemperatureTimeAddtional settings
Initial Denaturation98°C1min / 60s 
28 Cycles98°C1min / 60sΔT/Cylce -1°C
42 Cycles72°C1min / 60sΔT/Cylce -1°C
72°C10s 
26 Cycles30°C1min / 60sΔT/Cylce -1°C
Hold4°C  

After this protocol, the resulting DNA fragment contained the Terminator sequence itself and the required PaqCI recocnicion sequences, as well as overhangs for assembly, and looked like the following:

Product Q5 self annealing

We were able to confirm the correct-sized product by gel electrophoresis and purify it with our standard protocol for PCR clean-ups [insert protocol] at 55.3 ng/µl eluted in 50µl (955,37 nM). With an initial 2.5µM concentration at 50µl, we were able to yield 38.2% of the theoretical maximum yield! We used this fragment for downstream application, and its sequence was additonally confirmed by full plasmid sequencing. All this confirms that if you want to generate short DNA sequences yourself, this is absolutely possible. If you are looking to implement this protocol yourself, we recommend making sure that the primers are not able to dimerise in multiple forms; this can be the case if you want to generate a fragment containing repetitive sequences.
This protocol can be modified to be used for fragment generation with more than two primers; for this, it is absolutely crucial that only the corresponding primer pairs can bind to each other and not all of them at once. If trying to use more than two primers, for example, planning this protocol with four primers, we recommend starting with the innermost two primers and letting this protocol run to completion, and after this, you fill it up to a 100µl reaction (adding 25µl of 2x Buffer + 12.5µl of 10µM Primer 1 + 12.5µl of 10µM Primer 2) and letting it run again; alternatively, you could also start with 25µl and fill it up to 50µl.


Footnotes​

  1. An Expanded Synthetic Biology Toolkit for Gene Expression Control in Acetobacteraceae; Min Yan Teh, Kean Hean Ooi, Shun Xiang Danny Teo, Mohammad Ehsan Bin Mansoor, Wen Zheng Shaun Lim, and Meng How Tan; ACS Synthetic Biology 2019 8 (4), 708-723; DOI: 10.1021/acssynbio.8b00168 ↩

  2. https://www.neb.com/en/products/m0492-q5-high-fidelity-2x-master-mix ↩