Introduction

This tab provides an overview of the experiment, materials, and protocol.

First, plasmids were constructed. Next, plasmids were used to transform E. coli (DH5α and BL21(DE3)) (1). The bacteria were then cultured in a medium containing appropriate antibiotics (2) and the plasmids were collected by Miniprep (3). Finally, electrophoresis (4) and sequence analysis were performed to ensure correct vector incorporation. Plasmid construction was performed using KOD Mutagenesis (5) and NEBuilder (6).

Meanwhile, specialized experiments were performed to characterize each Module: the BIND-PETase Module (BIP Module) and the Electro Count Biosafety Module (ECB Module) .

In the BIP Module, samples prepared by IPTG induction (9), then the functional analysis of BIND-PETase expression was performed through SDS-PAGE (10), Western Blotting(11) and Congo Red Assay (12). The hydrolytic ability of this enzyme was quantitatively measured through pNPB Assay (13), Storage Activity Assay(14), Reusability Assay(15) and PET Degradation (16).

In the ECB Module, chemical properties of pyocyanin, a substance that induces redox reactions in an Electrically inducible promoter (pSoxS Promoter), was determined (17,18). Then, a reporter gene (mrfp1) was introduced and its fluorescence intensity was measured to qualitatively and quantitatively measure changes in the expression of downstream genes during IPTG induction and electrical stimulation. From these steps, the terminator sequence cut out by the Cre/loxP system was determined and the Electrically inducible promoter (pSoxS) function was evaluated (19,20).

Fig. 8.1.1. Flowchart of basic experiments

Fig. 8.1.2. Flowchart of BIP module

Fig. 8.1.3. Flowchart of ECB module

Basic Experiments

1 Transformation

1.1 Overview

Introduce plasmids into the competent cells in order to replicate the plasmid in E. coli.

1.2 Materials

Competent cells, SOC culture, LB agar medium (tryptone 2.0 g, Yeast extract 1.0 g, NaCl 2.0 g, Agarose S 3.0 g/ MilliQ 200 mL)

1.3 Protocol

Bioelegen Technology Co., Ltd. High efficiency DH5α Competent Cell

Dispense 50 µL of competent cell into 1.5 mL microcentrifuge tubes and thaw it on ice.
Add 2~5 µL of plasmid DNA into the microcentrifuge tube of competent cells and mix them well by gently shaking the tubes.
Incubate the cells on ice for 10 minutes.
Heat-shock the cells for 30 seconds in a 42°C water bath.
Add 125 µL of room-temperature S.O.C. Medium and shake the tube at 225 rpm for 1 hour at 37°C.
Spread 100 µL of cells on LB plates which are pre-warmed to 37℃ and contain the appropriate selective antibiotic.
Label and incubate the plates overnight at 37℃.

BioDymamics laboratory Inc.　DynaCompetent Cells JetGia DH5α^[1]

Dispense 50 µL of competent cell into 1.5 mL microcentrifuge tubes and thaw it on ice.
Add 2~5 µL of plasmid DNA into the microcentrifuge tube of competent cells and mix them well by gently shaking the tubes.
Incubate the cells on ice for 5 minutes.
Heat-shock the cells for 30 seconds in a 42°C water bath.
Add 450 µL of room-temperature S.O.C. Medium and shake the tube at 225 rpm for 1 hour at 37°C.
Centrifuge at 800 × g for 5 minutes in a tabletop micro high-speed centrifuge (CT15RE 91560700) and remove 400 µL of supernatant.
Add 100 µL of LB medium and resuspend the cell by pipetting several times.
Spread 100 µL and 200 µL of cells from each transformation reaction on separate LB plates, which are pre-warmed to 37℃ and contain the appropriate selective antibiotic.
Label and incubate the plates overnight at 37℃.

Thermo Fisher Scientific Inc.　BL21(DE3)　Product number：EC0114^[2]
Dispense 50 µL of competent cell into 1.5 mL microcentrifuge tubes and thaw it on ice.

Add 2−5 µL of plasmid DNA into a tube of competent cells. Mix well by gently shaking the tubes.
Incubate the cells on ice for 30 minutes.
Heat-shock the cells for 30 seconds in a 42°C water bath.
Incubate the cells on ice for 2 minutes.
Add 250 µL of room-temperature S.O.C. Medium and shake the tube at 225 rpm for 1 hour at 37°C.
Spread 100 µL and 200 µL of cells from each transformation reaction on separate LB plates, which are pre-warmed to 37℃ and contain the appropriate selective antibiotic.
Label and incubate the plates overnight at 37℃.

New England Biolabs Inc. NEB® 5-alpha Competent E. coli (High Efficiency)　Product number：C2981^[3]
Dispense 50 µL of competent cell into 1.5 mL microcentrifuge tubes and thaw it on ice for 10 minutes.

Add 2 µL of plasmid DNA into a tube of competent cells. Mix well by gently shaking the tubes 4-5 times.
Incubate the cells on ice for 30 minutes.
Heat-shock the cells for 30 seconds in a 42°C water bath.
Incubate the cells on ice for 5 minutes.
Add 950 µL of room-temperature S.O.C. Medium.
Incubate the cells for 1 hour at 37°C. Shake or rotate the tube at 250 rpm.
Pre-warm the LB plates which contain the appropriate selective antibiotic to 37℃.
Invert the tube to mix the cells thoroughly.
Spread 50-100 µL of cells from each transformation reaction on two LB plates.
Label and incubate the plates overnight at 37℃.

2 Liquid culture^[4]

2.1 Overview

Pick colonies from the transformed plates and culture in LB medium.

2.2 Materials

LB medium (tryptone 5.0 g, Yeast extract 2.5 g, NaCl 5.0 g/ MilliQ 500 mL), LB agar medium after transformation

2.3 Protocol

Add 3 mL of LB medium to a 15 mL tube.
Using a crystal tip or toothpick tip, pick up single colonies growing on LB agar medium after transformation.
Drop the tip into a 15 mL tube containing LB medium.
Incubate the 15 mL tubes at 250 rpm, 37°C for 16 hours while shaking.

3 Miniprep^[4]

3.1 Overview

Purify plasmids from E. coli after liquid culture.

3.2 Materials

E. coli culture medium after liquid culture , MilliQ, PureYield™ Plasmid Miniprep System (Cell Lysis Buffer, Neutralization Solution, Endotoxin Removal Wash, Column Wash Solution, Elution Buffer)

3.3 Protocol

Dispense about 1.5 mL of the E. coli culture contained in a 15 mL tube into a 2.0 mL tube and centrifuge (himac, CT15RE) at 21500 × g, 4°C, 30 sec.
Decant the supernatant and add the remaining E. coli culture to the same 2.0 mL tube.
Centrifuge again at 21500 × g, 4°C, 30 sec, and decant the supernatant.
Add 600 µL of MilliQ and resuspend the pellet by Vortex.
Add 100 µL of Cell lysis buffer and mix by inversion 6 times.
Add 350 µL of Neutralization solution and mix by inversion until the solution turns yellow. After the solution turns yellow, invert and mix 3 more times to complete the reaction.
Centrifuge the solution at 15000 rpm, 4°C for 3 min, and decant the supernatant into a Pure YieldTM Minicolumn (column).
Centrifuge at 15000 rpm, 4°C, 15 sec, and discard the solution that has passed through the column.
Add 200 µL of Endotoxin Removal Wash to the column and centrifuge at 15000 rpm, 4°C, 15 sec.
Add 400 µL of Column Wash Solution to the column and centrifuge at 15000 rpm, 4°C, 30 sec.
Set the column in a new 1.5 mL tube, add 30 µL of Elution Buffer to the center of the column, and allow it to stand for 3 minutes.
Centrifuge the 1.5 mL tube at 15000 rpm, 4°C, 15 sec. The plasmid is extracted into the 1.5 mL tube.

4 Electrophoresis

4.1 Overview

The presence of the plasmid and the length of the DNA sample are determined by checking the position of the bands that appear in the electrophoresis. Evaluate the DNA obtained by comparing it to the expected DNA length.

4.2 Materials

sample DNA, MilliQ, 1×TAE, agarose gel (0.8%: agarose powder 0.4 g, 50×TAE 1mL, MilliQ 50 mL, 2.0%: agarose powder 1.0 g, 50×TAE 1 mL, MilliQ 50 mL,), 2×LoadingBuffer, Gene Ladder Fast 2 (Nippon Gene)

4.3 Protocol

Fill the electrophoresis apparatus with 1×TAE.
Move agarose gel to the electrophoresis layer.
Add 4 μL of DNA ladder to the lane.
Add 2 μL of sample DNA plus 5 μL of 2×Loading Buffer to the lane.
Electrophoresis for 20 minutes.
Observe the position of the bands using a UV irradiator (FAS-Digi).

5 KOD mutagenesis^[5]

5.1 Overview

KOD mutagenesis is a plasmid construction method that inserts or removes a specific nucleotide sequence. Plasmids of interest are created by PCR reaction using primers designed to have mutations or new sequences, or primers designed to omit specific regions of the original plasmid.

5.2 Materials

Forward primer、Reverse primer、MilliQ、Plasmid DNA、TOYOBO KOD-Plus-Mutagenesis Kit SMK-101(10×Buffer for iPCR、2mM dNTPs、Plasmid DNA、KOD-Plus-、DpnⅠ、T4 Polynucleotide Kinase、Ligation high)

5.3 Protocol

Adjust the density of Forward and Reverse primer to 10 µM.
Dilute 1 µL of plasmid DNA 50-fold with 49 µL of MilliQ.
Add reagents on the following table from top to bottom on ice to prepare the sample and the negative control.

Table. 8.5.1. The composition of the reagent for inverse PCR

sample		Nagative Control
reagent	amount (µL)	reagent	amount (µL)
MilliQ	16.5	MilliQ	19
10×PCR Buffer for iPCR	2.5	10×PCR Buffer for iPCR	2.5
2 mM dNTPs	2.5	2 mM dNTPs	2.5
Primer fwd (10µM)	0.75	Primer fwd (10µM)	0
Primer rev (10µM)	0.75	Primer rev (10µM)	0
Plasmid vector	1.0	Plasmid vector	1.0
KOD -Plus-	1.0	KOD -Plus-	0.0
Total	25.0	Total	25.0

Repeat the PCR cycle to 25 times on a thermal cycler ( Thermo Fisher Scientific Inc., Applied BiosystemsTM ProFlexTM PCR System). The detail of the PCR reaction is stated in the following table.

Table. 8.5.2. PCR cycle

	Temperature	time
Pre Denature	94 ℃	2 min
Denature	94 ℃	15 sec
Annealing	Average of the Tm of Primer fwd & rev	15 sec/1kbp
Extention	72℃	4 sec

After the PCR reaction, mix 2 µL of the sample reagent with 5 μL of 2xLoading Buffer and start the electrophoresis (4).
At the same time as process 5, add DpnI to the tube containing the sample at a ratio of remain sample:DpnI = 25:1 and mix by tapping.
Centrifugate the sample and incubate for 1 hour at 37℃.
Prepare the reagent for self-ligation in a new PCR tube according to the following table.

Table 8.5.3. The composition of reagent for self-ligation

sample	amount (µL)
Dpn-treated PCR product	2
MilliQ	7
Ligation high	5
T4 polynuclueotide kinase	1
Total	15

Incubate the cell for 1 hour at 16℃.
Transform (1) the E. coli by using the 3 µL of reagent for self-ligation.
Liquid culture (2) the transformed E. coli.
Conduct miniprep(3) after the liquid culture and purify the plasmid.

6 NEBuilder^[6]

6.1 Overview

Multiple types of DNA fragments with overlapping sequences are assembled using NEBuilder to create the desired plasmid.

6.2 Materials

DNA fragments with overlap regions (15-30 nt), NEBuilder HiFi DNA Assembly Master Mix, MilliQ, E. coli (NEB 5-α).

6.3 Protocol

Prepare the PCR reaction mixture in a PCR tube according to the composition in Table 8.6.1.

Table. 8.6.1. The composition of the PCR reaction mixture

Reagent	Amount (µL)
MilliQ	33-X
10x PCR Buffre for KOD- Plus-Neo	5
2mM dNTPs	5
25mM MgSO4	3
10uM Primer Fwd	1.5
10uM Primer rev	1.5
Template DNA	X
KOD-Plus-Neo(1U/uL)	1
Total	50

Thoroughly mix the PCR reaction mixture.
Perform 30 PCR cycles using a thermal cycler (Thermo Fisher Scientific Inc., Applied Biosystems™ ProFlex™ PCR System). Each cycle follows the parameters listed in Table 8.6.2.

Table. 8.6.2 PCR cycle

	Temperature	Time
Pre Denature	94 ℃	2 min
Denature	98 ℃	10 sec
Extention	Avererage of the Tm of Primer Fw/Rv	30sec/1kbp

Add 1 uL of DpnI to 15 uL of the PCR product, and mix by tapping.
Incubate the PCR product at 37°C for 1–3 hours.
Inactivate DpnI by incubating at 80°C for 20 minutes.
On ice, prepare the NEBuilder Assembly mixture in a 0.6 mL PCR tube. The composition is listed in Table 8.6.3. The molar ratio of vector to insert DNA fragments depends on the number of DNA fragments used, but in this project, assembly was performed using 2–3 fragments, with a vector ratio of 1:2.

Table. 8.6.3. The coposition of the NEBuilder Assembly mixture

Reagent	Amount (µL)
Total DNA	X (0.03-0.2 pmol)
NEBuilder HiFi DNA Assembly Master Mix	10
MilliQ	10-X
Total	20

Incubate the prepared reaction mixture at 50°C using a thermal cycler. The incubation time is 15 minutes.
Remove from the thermal cycler and store on ice or at −20°C.
Perform transformation (1) using NEB-5α.
Perform liquid culture (2).
After liquid culture, perform Miniprep (3) to purify the plasmid.

Plasmid Construction

7 BIND-PETase plasmid

7.1 List of plasmids

The plasmids created to verify the various mutants of BIND-PETase are listed in Table 8.7.1. Each plasmid codes a BIND-System (See Design tab) with various PETase mutants. We use abbreviations to call these plasmids. Abbreviations are also listed in Table 8.7.1.

Table. 8.7.1. Plasmids used in expression of PETase

Plasmid name	Abbreviation 1	Abbreviation 2	Explanation
pMAL-c4X-RBS-csgA-BamHI_linker-PETase(WT)-6xHis	pMAL-c4X-BIND-PETase(WT)	BIND-PETase(WT)	This plasmid codes fusion protein of CsgA and PETase(WT) downstream of the IPTG-inducible promoter called Ptac. IsPETase (WT) is displayed in a fiber-linked manner on the Curli Fiber of E. coli. The XbaI recognition sequence, which is the Linker between CsgA and PETase, codes Gly-Ser, a common amino acid sequence used for Linker.
pMAL-c4X-RBS-csgA-BamHI_linker-PETase(E. coli optimized)-6xHis	pMAL-c4X-BIND-PETase(E. coli optimized)	BIND-PETase(E. coli optimized)	This plasmid codes fusion protein of CsgA and PETase(E. coli optimized) downstream of the IPTG-inducible promoter called Ptac. IsPETase (E. coli optimized) is displayed in a fiber-linked manner on the Curli Fiber of E. coli.
pMAL-c4X-RBS-csgA-BamHI_linker-PETase(5 mut.)-6xHis	pMAL-c4X-BIND-PETase(5 mut.)	BIND-PETase(5 mut.)	This plasmid codes fusion protein of CsgA and PETase (5 mut.) downstream of the IPTG-inducible promoter called Ptac. IsPETase (5 mut.) is displayed in a fiber-linked manner on the Curli Fiber of E. coli.
pMAL-c4X-RBS-csgA-BamHI_linker-duraPETase-6xHis	pMAL-c4X-BIND-duraPETase	BIND-duraPETase	This plasmid codes fusion protein of CsgA and duraPETase downstream of the IPTG-inducible promoter called Ptac. DuraPETase is displayed in a fiber-linked manner on the Curli Fiber of E. coli.

Table. 8.7.2 lists each of the parts included in the plasmid.

Table. 8.7.2. List of parts used in plasmids^[7]

Abbreviation Name	Detailed Name	Parts No.	Explanation
IsPETase (WT)	PETase EcCO WT	BBa_J428065	This is PETase originated in Ideonella sakaiensis. PETase is the enzyme that is capable of breaking ester bonds in PET structure and degrading PET. This sequence has not been optomized for E. coli.
IsPETase (E. coli optimized)	IsPETase-W159H-S238F with C-terminal Hexahistidine Tag	BBa_K2910000	This is the sequence that has two amino acid mutants in IsPETase(WT). However, we found no mutants in IsPETase (E. coli optimized) according to sequence analysis, and codon optimization for E. coli was done. Which means that the sequence of iGEM Parts BBaK2910000 is incorrect.
IsPETase (5 mut.)	IsPETase-T88F-I208Y-S238F-S245Y-R280A with C-terminal Hexahistidine Tag	BBa_K2910003	This is the sequence that has five amino acid mutants in IsPETase(WT) Codon optimization for E. coli was done.
duraPETase	Designed based on a previous study (PETase(WT) L117F-Q119Y-T140D-W159H-G165A-I168R-A180I-S188Q-S214H-R280A)	BBa_K5436030	For duraPETase, the sequence was converted to a nucleotide sequence based on a previous study by Yinglu Cui (2021). It was then codon-optimized for E. coli.
csgA	csgA	BBa_K5436006	A sequence encoding CsgA, the major extracellular protein that makes up the Curli Fiber, a fibrous structure formed by E. coli on its own membrane.
RBS for BIND-PETase	RBS	BBa_K5436005	RBS optimized for BIND-PETase expression. This RBS adjusts the appropriate expression levels of BIND-PETase in E. coli.

The possible functions of the plasmid were described in the Design tab. The actual functional analysis was performed on the Result page.
Each plasmid map is shown below.

Fig. 8.7.1. Plasmid map of BIND-PETase(WT)

Fig. 8.7.2. Plasmid map of BIND-PETase(E. coli optimized)

Fig. 8.7.3. Plasmid map of BIND-PETase(5 mut.)

Fig. 8.7.4. Plasmid map of BIND-duraPETase

7.2 Design of each plasmid

We will explain the design process for each of the plasmids shown in 7.1.

BIND-PETase(WT)

This plasmid was designed based on Zhu et al. (2022)^[8] and was ordered through GenScript's free fragment synthesis service. For the backbone, pMAL-c4X was employed because it was similar to pBbE1a used in a previous study in copy number and antibiotic resistance. In addition, this backbone has a promoter being IPTG-induced in the sequence as pBbE1a and can control the expression level.
In this plasmid, the PETase connected to CsgA is a wild-type sequence, with no codon optimization for E. coli.
The linker between CsgA and PETase was the XbaI recognition sequence, which was used in a previous study. XbaI recognition sequence code Gly-Ser, and this sequence codes the common amino acid sequences used for the linker.
The RBS was optimized for BIND-PETase with RBS calculator based on the expression efficiency of a common CsgA overexpression plasmid. The sequence of RBS was CGGTCGGTTCCGGGCCCTATTCAT.

BIND-PETase(E. coli optimized)　BIND-PETase（5 mut.）

IsPETase (E. coli optimized) (Detailed name: IsPETase-W159H-S238F with C-terminal Hexahistidine Tag, BBa_K2910000) was inserted and it replaced the IsPETase(WT) sequence in BIND-PETase(WT) with NEBuilder.
Note that, as mentioned above, this sequence did not have the two mutations but was just optimized for E. coli.

BIND-PETase (5 mut.) was created by the same procedure as BIND-PETase (E. coli optimized) using IsPETase (5 mut.) (Detailed Name: IsPETase-T88F-I208Y-S238F-S245Y-R280A with C-terminal Hexahistidine Tag, BBa_K2910003).
For primers, NEBuilder_PETasemut_fwd and NEBuilder_PETasemut_rev were used to amplify mutant PETase sequences. NEBuilder_pMAL-c4x_fwd and NEBuilder_pMAL-c4x_rev were used to amplify the portion csgA (pMAL-c4X) other than the mutant PETase sequence. Each primer is listed in Table 8.7.3. The obtained fragments had homologous sequences and could be assembled.
Sequence confirmation showed no mutation in E. coli optimized and only codon optimization for E. coli.

BIND-iePETase

Waseda-Tokyo has designed various PETase mutants to replace BIND-PETase using in-silico simulation. This design is based on the idea of directed evolution and aims to find a better PETase mutant for BIND-PETase. We call this iePETase (directed evolution PETase).

The details are explained in Modeling and Simulation (refer to Model and Simulation). For each mutant generated by the protein language learning model, we also performed in silico structural simulation-based screening and carefully selected sequences to be verified in Wet experiments. The process and policy of the design and simulation are described in detail on the Modeling & Simulation page.

The iePETases used are numbered by ID and are shown in Table 8.7.3 below. (eg.PETase(ID1)) We handled a total of 15 iePETases , including duraPETase, a iePETase that had already been discovered in a previous study.

Next, we describe the construction of BIND-iePETase. First, cpMAL-c4X-cgsA, the portion of BIND-PETase (WT) minus IsPETase (WT), was amplified by PCR. Then, iePETase fragments ordered from IDT, GenScript and Twist free fragment synthesis service were inserted into it by NEBuilder. For primers, Oneday_csgA_fwd , Oneday_csgA_rev were used to amplify vector parts other than the mutant PETase sequence.

Table. 8.7.3. The information of each iePETase^[7]

Name	Parts No.	Explanation
duraPETase	Undecided	The sequence that has ten amino acid mutants in IsPETase(WT) , which is designed to function stably at higher temperatures and under harsher conditions than regular PETase. The binding to PET molecules and the degradation rate is also improved. This is designed based on previous work by Yinglu Cui (2021). The detailed name; IsPETase (WT) L117F-Q119Y-T140D-W159H-G165A-I168R-A180I-S188Q-S214H-R280A
PETase(ID1)	BBa_K5436007	A sequence created by simulation prediction, in which random mutations are added to a gene to extract mutations that improve a specific function of the protein to obtain a protein with the desired function. See the Model page for details.
PETase(ID2)	BBa_K5436008	Same as above
PETase(ID3)	BBa_K5436009	Same as above
PETase(ID4)	BBa_K5436010	Same as above
PETase(ID5)	BBa_K5436011	Same as above
PETase(ID6)	BBa_K5436012	Same as above
PETase(ID22)	BBa_K5436014	Same as above
PETase(ID23)	BBa_K5436016	Same as above
PETase(ID24)	BBa_K5436015	Same as above
PETase(ID25)	BBa_K5436017	Same as above
PETase(ID26)	BBa_K5436018	Same as above
PETase(ID27)	BBa_K5436019	Same as above

The primers used in the above plasmid creation are listed in Table 8.7.4 below. NEBuidler_PETasemut_fwd/rev were used to create BIND-PETase (2 mut.), BIND-PETase (5 mut.), and BIND-duraPETase. They were used to amplify the backbone fragment csgA (pMAL-c4X).
Oneday_csgA-fwd/rev was used to create the csgA (pMAL-c4X) fragment for loading the PETase designed by Waseda-Tokyo.

Table. 8.7.4. Primers used in plasmid construction

primer name	sequence
NEBuilder_PETasemut_fwd	GTACGGATCCATGAATTTTCCTCGCGCTTC
NEBuilder_PETasemut_rev	TGCCAAGCTTTCAGTGGTGGTGGTGGTG
NEBuilder_pMAL-c4x_fwd	CCACCACTGAAAGCTTGGCACTGGCCGT
NEBuilder_pMAL-c4x_rev	GAAAATTCATGGATCCGTACTGATGAGCGG
Oneday_csgA_fwd	TGAAAGCTTGGCACTGGCCGTC
Oneday_csgA_rev	GTACTGATGAGCGGTCGCGTTGTTAC

7.3 Plasmid construction results

BIND-PETase(WT)(pMAL-c4X)

Plasmids ordered by GenScript were transformed into BL21(DE3) competent cells, liquid cultured, and miniprepped, and the resulting product was subjected to electrophoresis. The results are displayed in Fig. 8.7.5. Table. 8.7.5 shows the correspondence between each lane number and sample.

Fig.8.7.5. Electrophoresis Result of BIND-PETase(WT)

Table. 8.7.5. Lane number correspondence in Fig. 8.7.5

Lane number	Sample name
1〜3、5〜7	BIND-PETase(WT)
4	Gene Ladder Fast2

BIND-PETase(WT) (pMAL-c4X) has 6829 bp. In (2), three different bands could be observed. Since the band was found close to the theoretical value (6829bp), we conducted sequence analysis and confirmed that the sequence was completely identical to the sequence we intended to design.

Plasmids including PETase (WT), PETase (E. coli optimized), and PETase (5 mut.)

To replace BIND-PETase(WT) with other mutants, fragments of PETase (E. coli optimized) and PETase (5 mut.) in the Distribution Kit, which are mutant PETases, were amplified and NEBuilder wad performed. The plasmids containing PETase (WT) were only amplified and not used for actual construction. Their backbone was pSB1C5C.

Each resulting product was subjected to electrophoresis and the results are shown in Fig. 8.7.6. Fig. 8.7.6 shows the correspondence between each lane number and sample.

Fig. 8.7.6. Electrophoresis results of amplified plasmids containing PETase (WT), PETase (E. coli optimized), and PETase (5 mut.)

Table. 8.7.6. Lane number correspondence in Fig. 8.7.6

Lane number	Sample name
1	Gene Ladder Fast2
2	PETase (WT)( pSB1C5C )
3	PETase (E. coli optimized) pSB1C5C
4	PETase (5 mut.)( pSB1C5C )

The base pair numbers of PETase (WT), PETase (E. coli optimized) and PETase (5 mut.) are 2943bp, 2937bp and 2937bp. From the figure, apparent bands were observed at positions with fewer base pairs than we expected. However, sequencing analysis confirmed that each of the bands was a normal sequence. Therefore, it can be considered that the miniprep product formed a supercoil.

Fragments created by KOD Mutagenesis, csgA (pMAL-c4X) and IsPETase(WT) (pMAL-c4X)

We constructed a plasmid for control csgA expression against BIND-PETase and a plasmid for expression of IsPETase (WT).

The results are shown in Fig. 8.7.7. Table. 8.7.7 shows the correspondence between each lane number and sample.

Fig. 8.7.7. Electrophoresis results of csgA (pMAL-c4X) and PETase (pMAL-c4X)

Table. 8.7.7. Lane number correspondence in Fig. 8.7.7

Lane number	Sample name
1,10,11	Gene Ladder Fast2
2〜7	csgA(pMAL-c4X)
8〜9,12~15	IsPETase(WT)(pMAL-c4X)

The base pair numbers of csgA (pMAL-c4X) and IsPETase(WT) (pMAL-c4X) are 5929bp and 6375bp. In both cases, apparent bands were observed at positions with fewer base pairs than we expected. Sequence analysis was performed with the samples which showed the most normal bands. We selected (3) for csgA (pMAL-c4X) and (12) and (13) for PETase (pMAL-c4X) with fewer nonspecific bands. As a result, csgA(pMAL-c4X) and PETase(pMAL-c4X) were confirmed to be normal sequences.

BIND-duraPETase (pMAL-c4X)

BIND-duraPETase (pMAL-c4X) created by NEbuilder and pMAL-c4X-ptac, an empty vector without iePETase, were transformed into BL21(DE3) competent cells, liquid cultured, and minipreped, and the resulting product was subjected to electrophoresis. The results are shown in Fig. 8.7.8. Table. 8.7.8 shows the correspondence between each lane number and sample.

Fig 8.7.8. Electrophoresis results of BIND-duraPETase (pMAL-c4X) and pMAL-c4X

Table. 8.7.8. Lane number correspondence in Fig. 8.7.8

Lane number	Sample name
1	Gene Ladder Fast2
2~3	pMAL-c4X-ptac
4~6	BIND-duraPETase (pMAL-c4X)

The base pair number of BIND-duraPETase (pMAL-c4X) is 6829 bp. Sequence analysis was performed on the sample in which the most normal band was found. We selected (2) for pMAL-c4X and (4) for BIND-duraPETase (pMAL-c4X) with fewer nonspecific bands. As a result, pMAL-c4X and BIND-duraPETase(pMAL-c4X) were confirmed to be normal sequences.

BIND-PETase(ID1) (pMAL-c4X)

PMAL-c4X-cgsA was amplified by PCR. The PETase (ID1) fragment ordered from IDT, GenScript and Twist's free fragment synthesis service was inserted into pMAL-c4X-cgsA by NEBuilder. The completed plasmid was transformed into BL21(DE3) competent cells, cultured in liquid culture and minipreped, and the resulting product was subjected to electrophoresis. The results are shown in Fig. 8.7.9. In addition, Table. 8.7.9 shows the correspondence between each lane number and sample.

Fig 8.7.9. Electrophoresis results of BIND-PETase (ID1) (pMAL-c4X)

Table. 8.7.9. Lane number correspondence in Fig. 8.7.9

Lane number	Sample name
1	Gene Ladder Fast2
2~7	BIND-PETase(ID1) (pMAL-c4X)

The base pair number of BIND-PETase(ID1) (pMAL-c4X) is 6829bp. Sequence analysis was performed on the sample in which the most normal band was found. We selected (3) for BIND-PETase (ID1) (pMAL-c4X) with fewer nonspecific bands.
Sequence analysis confirmed that BIND-PETase(ID1) (pMAL-c4X) is a normal sequence.

BIND-PETase(ID2) (pMAL-c4X) 、BIND-PETase(ID3) (pMAL-c4X)

PMAL-c4X-cgsA was amplified by PCR. The PETase (ID2) fragment and PETase (ID3) fragment ordered from IDT, GenScript and Twist's free fragment synthesis service was inserted into pMAL-c4X-cgsA by NEBuilder. The completed plasmid was transformed into BL21(DE3) competent cells, cultured in liquid culture and minipreped, and the resulting product was subjected to electrophoresis. The results are shown in Fig. 8.7.10. Table. 8.7.10 shows the correspondence between each lane number and sample.

Fig 8.7.10. Electrophoresis results of BIND-PETase(ID2) (pMAL-c4X) and BIND-PETase(ID3) (pMAL-c4X)

Table. 8.7.10. Lane number correspondence in Fig. 8.7.10

Lane number	Sample name
1,6,11	Gene Ladder Fast2
2~5	BIND-PETase(ID2) (pMAL-c4X)
7~10	BIND-PETase(ID3) (pMAL-c4X)

The base pair number of BIND-duraPETase (pMAL-c4X) is 6829 bp. Sequence analysis was performed on the sample in which the most normal band was found. We selected (2) and (3) for PETase(ID2) (pMAL-c4X) and (7) for BIND-PETase(ID3) (pMAL-c4X) with fewer nonspecific bands.
As a result, PETase(ID2) (pMAL-c4X) and BIND-PETase(ID3) (pMAL-c4X) were confirmed to be normal sequences.

BIND-PETase(ID4) (pMAL-c4X)、 BIND-PETase(ID5) (pMAL-c4X)

PMAL-c4X-cgsA was amplified by PCR. The PETase (ID4) fragment and PETase (ID5) fragment ordered from IDT, GenScript and Twist's free fragment synthesis service was inserted into pMAL-c4X-cgsA by NEBuilder. The completed plasmid was transformed into BL21(DE3) competent cells, cultured in liquid culture and minipreped, and the resulting product was subjected to electrophoresis. The results are shown in Fig. 8.7.11. Table. 8.7.11 shows the correspondence between each lane number and sample.

Fig 8.7.11. Electrophoresis results of BIND-PETase(ID4) (pMAL-c4X) and BIND-PETase(ID5) (pMAL-c4X)

Table. 8.7.11. Lane number correspondence in Fig. 8.7.11

Lane number	Sample name
1,10	Gene Ladder Fast2
2~5	BIND-PETase(ID4) (pMAL-c4X)
6~9	BIND-PETase(ID5) (pMAL-c4X)

The base pair number of BIND-PETase(ID4) (pMAL-c4X) and BIND-PETase(ID5) (pMAL-c4X) is 6829 bp.
Sequence analysis was performed on the sample in which the most normal band was found. We selected (2) for PETase(ID4) (pMAL-c4X) and (7) for BIND-PETase(ID5) (pMAL-c4X) with fewer nonspecific bands.
As a result, PETase(ID4) (pMAL-c4X) and BIND-PETase(ID5) (pMAL-c4X) were confirmed to be normal sequences.

BIND-PETase(ID6) (pMAL-c4X), BIND-PETase(ID7) (pMAL-c4X), BIND-PETase(ID8) (pMAL-c4X)

PMAL-c4X-cgsA was amplified by PCR. The PETase (ID6) fragment, PETase (ID7) and PETase(ID8) fragment ordered from IDT, GenScript and Twist's free fragment synthesis service was inserted into pMAL-c4X-cgsA by NEBuilder. The completed plasmid was transformed into BL21(DE3) competent cells, cultured in liquid culture and minipreped, and the resulting product was subjected to electrophoresis. The results are shown in Fig. 8.7.12. Table. 8.7.12 shows the correspondence between each lane number and sample.

Fig. 8.7.12. Electrophoresis results of BIND-PETase(ID6) (pMAL-c4X), BIND-PETase(ID7) (pMAL-c4X) and BIND-PETase(ID8)

Table. 8.7.12. Lane number correspondence in Fig. 8.7.12

Lane number	Sample name
1,11	Gene Ladder Fast2
2~4	BIND-PETase(ID6) (pMAL-c4X)
5~7	BIND-PETase(ID7) (pMAL-c4X)
8~10	BIND-PETase(ID8) (pMAL-c4X)

The base pair number of BIND-duraPETase (pMAL-c4X) is 6829 bp. Sequence analysis was performed on the sample in which the most normal band was found. We selected (3) for PETase(ID6) (pMAL-c4X). BIND-PETase(ID7) (pMAL-c4X) and PETase(ID8) (pMAL-c4X) had some unexpected bands, so we didn’t do sequence analysis. As a result, PETase(ID6) (pMAL-c4X) was confirmed to be normal sequences.

BIND-PETase(ID22) (pMAL-c4X) 、 BIND-PETase(ID23) (pMAL-c4X)、BIND-PETase(ID24) (pMAL-c4X)

PMAL-c4X-cgsA was amplified by PCR. The PETase (ID22) fragment, PETase (ID23) and PETase(ID24) fragment ordered from IDT, GenScript and Twist's free fragment synthesis service was inserted into pMAL-c4X-cgsA by NEBuilder. The completed plasmid was transformed into BL21(DE3) competent cells, cultured in liquid culture and minipreped, and the resulting product was subjected to electrophoresis. The results are shown in Fig. 8.7.13. Table. 8.7.13 shows the correspondence between each lane number and sample.

Fig. 8.7.13. Electrophoresis results of BIND-PETase(ID22) (pMAL-c4X) , BIND-PETase(ID23) (pMAL-c4X) and BIND-PETase(ID24)

Table. 8.7.13. Lane number correspondence in Fig. 8.7.13

Lane number	Sample name
5,6,15,16,23	Gene Ladder Fast2
1~4,7,8	BIND-PETase(ID22) (pMAL-c4X)
9~14	BIND-PETase(ID23) (pMAL-c4X)
17~22	BIND-PETase(ID24) (pMAL-c4X)

The base pair number of BIND-PETase(ID22) (pMAL-c4X), BIND-PETase(ID23) (pMAL-c4X) and BIND-PETase(ID24) (pMAL-c4X) are 6829bp. Sequence analysis was performed on the sample in which the most normal band was found. We selected lane 3 for PETase(ID22) (pMAL-c4X), lane 9 for BIND-PETase(ID23) (pMAL-c4X) and lane 17 for PETase(ID24) (pMAL-c4X) with fewer nonspecific bands.
As a result, BIND-PETase(ID22) (pMAL-c4X) , BIND-PETase(ID23) (pMAL-c4X) and BIND-PETase(ID24) (pMAL-c4X) were confirmed to be normal sequences.

BIND-PETase(ID25) (pMAL-c4X), BIND-PETase(ID26) (pMAL-c4X), BIND-PETase(ID27) (pMAL-c4X)

PMAL-c4X-cgsA was amplified by PCR. The PETase (ID25) fragment, PETase (ID26) and PETase(ID27) fragment ordered from IDT, GenScript and Twist's free fragment synthesis service was inserted into pMAL-c4X-cgsA by NEBuilder. The completed plasmid was transformed into BL21(DE3) competent cells, cultured in liquid culture and minipreped, and the resulting product was subjected to electrophoresis. The results are shown in Fig. 8.7.14. Table. 8.7.14 shows the correspondence between each lane number and sample.

Fig. 8.7.14. Electrophoresis results of BIND-PETase(ID25) (pMAL-c4X) , BIND-PETase(ID26) (pMAL-c4X) and BIND-PETase(ID27)

Table. 8.7.14. Lane number correspondence in Fig. 8.7.14

Lane number	Sample name
1,5	Gene Ladder Fast2
2	BIND-PETase(ID25) (pMAL-c4X)
3	BIND-PETase(ID26) (pMAL-c4X)
4	BIND-PETase(ID27) (pMAL-c4X)

The base pair number of BIND-PETase(ID25) (pMAL-c4X), BIND-PETase(ID26) (pMAL-c4X) and BIND-PETase(ID27) (pMAL-c4X) are 6829bp. Sequence analysis was performed on the sample in which the most normal band was found. We selected (2) for PETase(ID25) (pMAL-c4X), (3) for BIND-PETase(ID26) (pMAL-c4X) and (4) for PETase(ID27) (pMAL-c4X) with fewer nonspecific bands. As a result, PETase(ID25) (pMAL-c4X), BIND-PETase(ID26) (pMAL-c4X) and PETase(ID27) (pMAL-c4X) were confirmed to be normal sequences.

8 Electro Count Biosafety Module

8.1 List of plasmids

The plasmids created for the Electro Count Biosafety Module experiment are listed in Table. 8.8.1.

Table. 8.8.1. Plasmids used in two-step electric reaction

Plasmid name	Explanation
pUC19-placIq-lacI-placUV5-cre	Cre expression by IPTG induction
pUC19-Pcon-soxR-pSoxS-cre	Cre expression by voltage application
pBbAW4k-pW4-loxP-TT-loxP-mrfp1	Red fluorescence expression when Cre-loxP system is activated
pBbAW4k-pW4-loxP-mrfp1	Red fluorescence constant expression
pBbAW4k-Pcon-loxP-TT-loxP-mrfp1	Increased promoter strength of PW4 -loxP-TT-loxP- mrfp1
pBbAW4k-Pcon-loxP-mrfp1	Increased promoter strength of pBbAW4k-pW4-loxP-mrfp1
pBbAW4k-pSoxS-mrfp1	Red fluorescence expression by voltage application
pET-3a-pSoxS-loxP-TT-loxP-sfgfp	Green fluorescence expression when voltage is applied after Cre-loxP system is activated

Table. 8.8.2 lists each of the parts included in the plasmid.

Table. 8.8.2. List of parts used in plasmids^[9]^[10]

Parts	Explanation	References
placIq	Promoter which initiates the expression of lacI protein	BBa_K3257003
lacI	Gene encoding Lac repressor	Sheets M. et al. 2020
placUV5	Promoter activated by IPTG induction	Sheets M. et al. 2020
Pcon	Constant expression promoter	BBa_J23100
SoxR	Transcriptional activators of pSoxS	BBa_K554003
pSoxS	Electrically inducible promoter	BBa_K4216006
Cre	Protein that cuts out the sequence between two loxP sequence	BBa_I718007
PW4-loxP-TT-loxP-mRFP1	Parts that express red fluorescence when the Cre-loxP system is activated	Sheets M. et al. 2020
sfGFP	Improved green fluorescent protein	Amplified from Addgene (Plasmid #133872, Silverman et al. 2020)

The possible functions of the plasmid were described in the Design tab. The actual functional analysis was performed on the Result page. Each plasmid map is shown below.

Fig. 8.8.1. Plasmid map of pUC19-placIq-lacI-placUV5-cre

Fig. 8.8.2. Plasmid map of pUC19-Pcon-soxR-pSoxS-cre

Fig. 8.8.3. Plasmid map of pBbAW4k-pW4-loxP-TT-loxP-mrfp1

Fig. 8.8.4. Plasmid map of pBbAW4k-pW4-loxP–mrfp1

Fig. 8.8.5. Plasmid map of pBbAW4k-Pcon-loxP-TT-loxP-mrfp1

Fig. 8.8.6. Plasmid map of pBbAW4k-Pcon-loxP–mrfp1

Fig. 8.8.7. Plasmid map of pBbAW4k-pSoxS–mrfp1

Fig. 8.8.8. Plasmid map of pET-3a-pSoxS-loxP-TT-loxP-sfgfp

8.2 Design of each plasmid

pUC19-placIq-lacI-placUV5-cre

Fragment placIq-lacI (ordered by Twist), fragment placUV5-Cre (ordered by Twist), pUC19 (pUC19 control DNA) were combined by NEBuilder. Primers used for pUC19 amplification PCR were pUC19-amplification- fwd, and pUC19-amplification-rev (Table. 8.8.3). Homologous sequences for binding were provided at both ends of each fragment at the design stage.

pUC19-Pcon-soxR-pSoxS-cre(pUC19)

Fragment Pcon-SoxR (ordered by TWIST), fragment pSoxS-Cre (ordered by TWIST), pUC19 (pUC19 control DNA) were combined by NEBuilder. Primers used for pUC19 amplification were pUC19-amplification-fwd, pUC19-amplification-rev (Table. 8.8.3). Homologous sequences for binding were provided at both ends of each fragment at the design stage.

pBbAW4k-pW4-loxP-TT-loxP-mrfp1

Ordered from Addgene (Plasmid #134405, Sheets M. et al. 2020)^[9].

pBbAW4k-pW4-loxP-mrfp1

KOD Mutagenesis was performed to eliminate the loxP-TT sequence from pBbAW4k-pW4-loxP-TT-loxP-mrfp1. The primers used were pBbAW4k-pW4-loxP-mrfp1-create-fwd and pBbAW4k-pW4-loxP-mrfp1-create-rev (Table. 8.8.3).

pBbAW4k-Pcon-loxP-TT-loxP-mrfp1

KOD Mutagenesis was performed to change PW4 of PW4 -loxP-TT-loxP- mrfp1 to Pcon. The primers used were PW4-to-Pcon-fwd and PW4-to-Pcon-rev (Table. 8.8.3).

pBbAW4k-Pcon-loxP-mrfp1

KOD Mutagenesis was performed to change PW4 of PW4 -loxP-mrfp1 to Pcon. The primers used were PW4-to-Pcon-fwd and PW4-to-Pcon-rev (Table. 8.8.3).

pBbAW4k-pSoxS-mrfp1

KOD Mutagenesis was performed to change PW4-loxP-TT-loxP of pBbAW4k-pW4-loxP-TT-loxP-mrfp1 to pSoxS. The primers used were pSoxS-create-fwd and pSoxS-create-rev (Table. 8.8.3).

pET-3a-pSoxS-loxP-TT-loxP-sfgfp .

The full-length order was placed by GenScript.
Table. 8.8.3 shows the primers used in the plasmid construction.

Table. 8.8.3. Primers used in plasmid construction

Primer name	Sequence
pUC19-amplification-fwd	gtcatagctgtttcctgtgt
pUC19-amplification-rev	actggccgtcgttttac
pBbAW4k-pW4-loxP-mrfp1-create-fwd	gaaggagatatacatatggcgagtag
pBbAW4k-pW4-loxP-mrfp1-create-rev	atacgaagttatttcgccgtgtcc
PW4-to-Pcon-fwd	ctaggtacagtgctagctactagagaatcttacagccatcgagagg
PW4-to-Pcon-rev	gactgagctagccgtcaacctataggttagactttaatgcaatactc
pSoxS-create-fwd	ttgaggaattatactccccaacagatgaattttaagaaggagatatacatatggcg
pSoxS-create-rev	gttaacttgaggtaaagcgatttctcaaagggcctcgtg

8.3 Plasmid construction results

pUC19-placIq-lacI-placUV5-cre and pUC19-Pcon-soxR-pSoxS-cre(pUC19)

The plasmid constructed by NEBuilder was transformed (1) into DH5α competent cells (NEB5α), liquid cultured (2), and minipreped (3), and the resulting product was subjected to electrophoresis (4). The results are shown in Fig. 8.8.9. In addition, Table. 8.8.4 shows the correspondence between each lane number and sample.

Fig.8.8.9. Electrophoresis Result of pUC19-placIq-lacI-placUV5-cre and pUC19-Pcon-soxR-pSoxS-cre

Table. 8.8.4. Lane number correspondence in Fig. 8.8.9

Lane number	Sample name
1	Gene Ladder Fast2(Nippon Gene)
2~5	pUC19-placIq-lacI-placUV5-cre
6	Gene Ladder Fast2
7~10	pUC19-Pcon-soxR-pSoxS-cre

The base pair numbers of pUC19-placIq-lacI-placUV5-cre and pUC19-Pcon-soxR-pSoxS-cre are 5115 bp and 4454 bp. From Fig. 8.8.10, we considered that the miniprep product formed a supercoil because the band appeared darker at a lower base pair number than expected. Therefore, XbaI restriction enzyme treatment was performed and electrophoresis was conducted again. The results are shown in Fig. 8.8.10. Also shown is the correspondence Table. 8.8.5 between each lane number and sample.

Fig. 8.8.10. Electrophoresis Result of pUC19-placIq-lacI-placUV5-cre and pUC19-Pcon-soxR-pSoxS-cre after XbaI restriction enzyme treatment

Table. 8.8.5. Lane number correspondence in Fig. 8.8.10

Lane number	Sample name
1	Gene Ladder Fast2
2	pUC19-placIq-lacI-placUV5-cre XbaI (-)
3	pUC19-placIq-lacI-placUV5-cre XbaI (+)
4	pUC19-Pcon-soxR-pSoxS-cre XbaI (-)
5	pUC19-Pcon-soxR-pSoxS-cre XbaI (+)

The sample after XbaI restriction enzyme treatment was considered a success for NEBuilder because the band was identified in the expected position. Sequence analysis of the Miniprep product confirmed the success of the pUC19-placIq-lacI-placUV5-cre and pUC19-Pcon-soxR-pSoxS-cre constructions.

pBbAW4k-pW4-loxP-TT-loxP-mrfp1

Plasmids ordered in full length by Addgene were transformed (1) into DH5α competent cells (DynaCompetent Cells JetGia DH5α), liquid cultured (2), and miniprepped (3). The resulting product was then subjected to XbaI, BamHI, KpnI, and PstI restriction enzyme treatments, and electrophoresis (4) was performed. The results are shown in Fig. 8.8.11. Also shown is the correspondence Table. 8.8.6 for each lane number and sample.

Fig. 8.8.11. Electrophoresis results after restriction enzyme treatment of pBbAW4k-pW4-loxP-TT-loxP-mrfp1

Table. 8.8.6. Lane number correspondence in Fig. 8.8.11

Lane number	Sample name
1	Gene Ladder Fast2
2	Gene Ladder 100(Nippon Gene)
3	pBbAW4k-pW4-loxP-TT-loxP-mrfp1 XbaI (+)
4	pBbAW4k-pW4-loxP-TT-loxP-mrfp1BamHI (+)
5	pBbAW4k-pW4-loxP-TT-loxP-mrfp1 KpnI (+)
6	pBbAW4k-pW4-loxP-TT-loxP-mrfp1 PstI(+)
7	pBbAW4k-pW4-loxP-TT-loxP-mrfp1

The base pair number of pBbAW4k-pW4-loxP-TT-loxP-mrfp1 is 3445 bp. The plasmid synthesis was considered successful because the products of restriction enzyme treatment showed a band at the expected position. When the plasmid was not cut by restriction enzyme, the band appeared at 10000 bp, which is considered to be due to the plasmid being structurally specific and difficult to be phased. Sequence analysis confirmed that the plasmid was indeed pBbAW4k-pW4-loxP-TT-loxP-mrfp1 . The product treated with KpnI showed a band at a lower base pair position than those treated with other restriction enzymes. This is because there are two KpnI cleavage sites in the plasmid, and cleavage occurred at both sites, resulting in the excision of a portion of the plasmid.

pBbAW4k-pW4-loxP-mrfp1 and pBbAW4k-pSoxS-mrfp1

KOD mutagenesis was performed using pBbAW4k-pW4-loxP-TT-loxP-mrfp1 , transformed (1) into DH5α competent cells (DynaCompetent Cells JetGia DH5α), liquid cultured (2) and miniprepped (3) . The obtained products were subjected to electrophoresis (4). The results are shown in Fig. 8.8.12. Also shown is the Table. 8.8.7, which shows the correspondence between each lane number and the sample.

Fig. 8.8.12. Electrophoresis results of pBbAW4k-pW4-loxP-mrfp1 and pBbAW4k-pSoxS-mrfp1

Table. 8.8.7. Lane number correspondence in Fig. 8.8.12

Lane number	Sample name
1,6,11	Gene Ladder Fast2
2~5	pBbAW4k-pW4-loxP-mrfp1
7~10	pBbAW4k-pSoxS-mrfp1

The base pair numbers of pBbAW4k-pW4-loxP-mrfp1 and pBbAW4k-pSoxS-mrfp1 are 3214 bp and 3189 bp. However, in Fig. 8.8.12, a band was found at a position showing a smaller base pair number than expected. Sequence analysis confirmed that the pBbAW4k-pW4-loxP-mrfp1 and pBbAW4k-pSoxS-mrfp1 constructs were successful. We considered that the bands were found at positions that showed smaller base pair than expected, because the Miniprep product formed a supercoil.

pBbAW4k-Pcon-loxP-TT-loxP-mrfp1 and pBbAW4k-Pcon-loxP-mrfp1

KOD mutagenesis was performed using pBbAW4k-pW4-loxP-TT-loxP-mrfp1 and pBbAW4k-pW4-loxP-mrfp1, transformed (1) into DH5α competent cells (DynaCompetent Cells JetGia DH5α), liquid cultured (2), and miniprepped (3). Then, the resulting product was subjected to electrophoresis (4). The results are shown in Fig. 8.8.13. Also shown is the Table. 8.8.8, which shows the correspondence between each lane number and the sample.

pET-3a-pSoxS-loxP-TT-loxP-sfgfp

The plasmids ordered in full length by GenScript were transformed (1) into DH5α competent cells (DynaCompetent Cells JetGia DH5α ), liquid cultured (2), and miniprepped (3) , and the obtained products were electrophoresed (4). The results are shown in Fig. 8.8.13. Also shown is the correspondence table 8.8.8 between each lane number and sample.

Fig. 8.8.13. Electrophoresis results of pSoxS-loxP-TT-loxP-sfgfp, pBbAW4k-Pcon-loxP-TT-loxP-mrfp1, and pBbAW4k-Pcon-loxP-mrfp1

Table. 8.8.8. Lane number correspondence in Fig. 8.8.13

Lane number	Sample name
1,6	Gene Ladder Fast2
2~3	pSoxS-loxP-TT-loxP-sfGFP
4~5	pBbAW4k-Pcon-loxP-TT-loxP-mrfp1
7~8	pBbAW4k-Pcon-loxP-mrfp1

The base pair numbers of pET-3a-pSoxS-loxP-TT-loxP-sfgfp , pBbAW4k-Pcon-loxP-TT-loxP-mrfp1 and pBbAW4k-Pcon-loxP-mrfp1 are 5517 bp, 3488 bp and 3257 bp. In Fig. 8.8.13, a band was found at a position showing a smaller base pair number than expected. Sequence analysis of the Miniprep product confirmed that constructions of three plasmids were successful. We considered that the band seen in Fig. 8.8.13 at the position showing a smaller base pair number than expected was due to the Miniprep product forming a supercoil.

BIND-PETase Module^[8]

9 IPTG induction

9.1 Overview

IPTG induction is the process to induce expression of various mutations of BIND-PETases by adding IPTG to E. coli BL21 (DE3) in which various BIND-PETases (pMAL-c4X) have been transformed.

9.2 Materials

YESCA medium (10 g/L casamino acids, 1 g/L yeast extract, 100 mg/L ampicillin), 100 mM IPTG solution

9.3 Protocol

Pick colonies of E. coli BL21(DE3) transfected with BIND-PETase (pMAL-c4X) from LB agar medium.
Cultivate the colonies in YESCA medium at 37℃ and 225 rpm overnight.
Measure OD600 using 1 mL of the culture solution.
Inoculate the cells in fresh YESCA medium with the initial OD600 of 0.05 to a total volume of 25 mL and cultured about 3 hours at 30℃ and 225 rpm.
Measure OD600 using 1 mL of the culture solution.
Confirm the OD600 to be 0.5 and divide the sample into two 12 mL portions. Add 96 µL of 100 mM IPTG solution to one of the portions.
Incubate samples prepared in 6 for 22 hours at 25°C, 225 rpm.

10 SDS-PAGE

10.1 Overview

SDS-PAGE is the process to confirm whether csgA-PETase is expressed or not. CsgA is depolymerized before SDS-PAGE.

10.2 Materials

E. coli suspension, Hexafluoroisopropanol(HFIP) ※Only when using HFIP, Sample Buffer, MilliQ, 2-Mercaptoethanol, Running Buffer, Protein Molecular Weight Marker, CBB, Sensitizer

10.3 Protocol

We conducted two experiments. They are different in the way of depolymerization, by HFIP or by sonication.

To depolymerize CsgA, add 100 μL of HFIP(Hexafluoroisopropanol) to 1.5 mL of E. coli suspension in a 2.0 mL tube. ※Only when using HFIP
Boil HFIP by heatblock or waterbath at 45℃ for 45 minutes and dry E. coli suspention at 60℃ for 10 minutes. ※Only when using HFIP
Add 50 μL of Sample buffer and 50 μL of MilliQ to 2.0 mL tube.
Do sonicasion. ※Only when conducting sonicasion
Add 2-Mercaptoerhanol to 2.0 mL tube.
Incubate E. coli suspension by heatblock at 95℃ for 10 minutes.
Put a precast gel electrophoresis device.
Pour 2 μL of Protein Molecular Weight Marker and 10 μL of sample into well and do electophoresis at 150 V, 1.5 mA for 1.5 hour 〜 2 hours.
Put gel on the tray and do shaking washing with MilliQ for 5 minutes. Do this three times.
Do overnight staining with CBB.
Dispose of CBB. Add the same mass of MilliQ and shake for an hour.
Add one tenth of MilliQ of Sensitizer and shake for an hour.

11 Western Blotting

11.1 Overview

In Western Blotting, target proteins are specifically detected among the proteins that have been phased by SDS-PAGE. BIND-PETase (WT) and BIND-bearPETase have his-tag and therefore were detected using his-tag antibody. This protocol describes the post-transcriptional operations after SDS-PAGE.

11.2 Materials

SDS-PAGE with PVDF membrane, methanol, 1×Transfer buffer, filter paper, 5% Skim milk, 1×TBS-T buffer, primary antibody (MBL Anti-His-tag mAb), secondary antibody (cosmobio Goat anti-mouse IgG(H+L) antibody, HRP conjugate, chemiluminescence reagent), ImmunoStar LD(FUJIFILM)

11.3 Protocol

Immerse the PVDF membrane in methanol for 1~3 minutes, then replace with 1×Transfer buffer.
Place 2 sheets of filter paper on top of the PVDF membrane and soak in 1×Transfer buffer.
Stack the gels after SDS-PAGE in the order of “2 filter papers - PVDF membrane - gel”.
Add 2 sheets of filter paper in the order of “2 sheets of filter paper - PVDF membrane - gel - 2 sheets of filter paper” and soak in the buffer.
Remove air from the “filter paper-PVDF membrane-gel”.
Set the gel in the buffer and transfer the gel (150 mA, 90-120 min).
After transfer, cut the PVDF membrane to an appropriate size and wash it in 1×TBS-T buffer for 5 min.
Discard 1×TBS-T buffer and replace with 5% skim milk solution.
Add primary antibody (MBL Anti-His-tag mAb) solution (primary antibody: 2.5% skim milk = 1 : 5000) and react with antigen-antibody in O/N while shaking.
Wash with 1×TBS-T buffer for 3 times, 10 min.
Add a secondary antibody (cosmobio Goat anti-mouse IgG(H+L) antibody, HRP conjugate) and incubate for 1 hour with shaking.
Transfer the PVDF membrane to a new case and wash it with 1×TBS-T buffer three times for 10 minutes.
Drain off the water from the PVDF membrane and place it on plastic wrap with the protein adsorbed side up.
Spread ImmunoStar LD(FUJIFILM) over the entire membrane by placing a pipette-man on a corner of the PVDF membrane and let it stand for 20~60 seconds.
Remove the water from the PVDF membrane, and detect with a ChemiDoc Touch MP.(Bio Rad)

12 Congo Red Assay

12.1 Overview

CsgA in BIND-PETase forms curli fibers which can be stained by Congo Red. Therefore, we stained BIND-PETase with Congo Red to confirm whether the curli fibers are formed successfully.

12.2 Materials

MilliQ, phosphate-buffered saline(PBS), Congo Red staining agent, Samples of expressed BIND-PETase

12.3 Protocol

Centrifuge 2.0 mL of E. coli and 10.5 mL of E. coli mixture in a 15 mL tube at 9000 g for 15 minutes at 22℃ to make a pellet and remove medium.
Resuspend in phosphate-buffered saline (PBS) and adjust the OD to as close to 2.7 as possible. At this time, be sure to record the OD. (BIND-PETase suspension)
Add 700 µL of ★BIND-PETase suspension to a 1.5ml tube.
Add 7 µL of 25 mM Congo Red and mix by inversion. (Final concentration is 0.025 mM)
Incubate at 25°C, 260 rpm for 10 minutes
Centrifuge the E. coli suspension at 15000g, 6min, 22℃
Using a spectrometer (NanoPhotometer NP80), dilute the supernatant of the product in 6. 2-fold with MilliQ and measured at 490 nm wavelength. Use MilliQ as a blank.
Correct the measured absorbance by dividing it by the OD of the ★BIND-PETase suspension to evaluate the amount of Congo Red bound to the Curli Fiber.

13 pNPB assay

13.1　Overview

pNPB assay examines and quantifies the enzyme activity of the prepared BIND-PETase by the hydrolysis reaction of pNPB. pNPB is decomposed into p-nitrophenol and butyric acid by the catalysis of PETase. Thus, the enzyme activity was quantified and evaluated under λ=405 nm absorbance, which is the absorption wavelength of p-nitrophenol.

13.2　Materials

pNPB, DMSO, PBS, BIND-PETase suspension

13.3　Protocol

Centrifuge 10.5 mL of the E. coli mixture in a 15 mL tube at 9000 g for 15 minutes at 22°C to make a pellet and remove the medium.
Add PBS and resuspend the cell (★BIND-PETase suspension). Make sure that the OD600 of the suspension nearly-equals to 2.7, and make a record of the OD on a notebook.
Prepare 2 mM pNPB/DMSO solution on a 1.5 mL microcentrifuge tube by mixing 7 µL of pNPB and 1 mL of DMSO.
Add 190 µL of PBS and 10 µL of pNPB/DMSO solution, 10 µL of ★BIND-PETase solution into a 1.5 mL microcentrifuge tube. 200 µL of PBS and 10 µL of pNPB/DMSO as the blank during the measurement of absorbance.
The hydrolysis decomposition was implemented at room temperature for 30 minutes after pipetting. Immediately transfer to ice when the reaction is complete.
Dilute the reaction solution 2-fold with MilliQ and measure absorbance at 405 nm.

14 Storage Activity Assay

14.1 Overview

This assay investigates the enzyme activity when BIND-PETase is stored.　We determine activity by performing a pNPB assay on stored BIND-PETase.

14.2 Materials

pNPB, DMSO, PBS, BIND-PETase suspension

14.3 Protocol

Store BIND-PETase suspension at 4°C and room temperature, respectively, shielded from light.
Perform pNPB Assay (see 13) on days 5 and 11 of storage.
Determine the ratio of enzyme activity to the activity on the first day of expression.

15 Reusability Assay

15.1 Overview

This assay verifies the reusability of BIND-PETase recovered after use and confirms the activity of BIND-PETase when the pNPB assay is performed for three cycles.

15.2 Materials

pNPB, DMSO, PBS, BIND-PETase suspension

15.3 Protocol

Measure the OD600 of BIND-PETase suspension.
Add 10 µL of 2 mM pNPB/DMSO solution to 400 µL of BIND-PETase suspension in a 1.5 mL tube and allow it to react for 10 minutes at room temperature. (cycle1)
Centrifuge at 15000 g, 22℃ for 6 min.
Take 200 µL of the supernatant, dilute it with 200 µL MilliQ and measure absorbance at 405 nm.
Carefully remove the remaining supernatant and wash the BIND-PETase pellet with 100 µL of PBS.
Centrifuge at 15000 g, 22℃ for 6 min.
Carefully remove the supernatant, resuspend in 400 µL of PBS, and measure OD600.
Add 10 µL of 2 mM pNPB/DMSO solution to the solution of 7 and allow it to react for 10 minutes at room temperature. (cycle2)
Do 3~8 again. (cycle3)
Correct the measured absorbance results at 405 nm with the OD of the BIND-PETase suspension at each cycle to determine the enzymatic activity of BIND-PETase at cycles 2 and 3 relative to cycle 1.

16 PET Degradation(PET powder and pellets)

16.1 Overview

This assay was used to determine the extent to how active BIND-PETase is in degrading PET under pH 7 and 9 conditions, respectively. Three types of PET substrates were used: powder and two types of pellets. When the substrate was powder, the degradation activity was measured by detecting the TPA produced by degradation using HPLC, and when the substrate was pellets, the degradation activity was measured by gravimetric analysis.

16.2 Materials

(powder) IPTG induced sample (see 9), PBS(pH7), Glycine NaOH(pH9),
MilliQ, formic acid, acetonitrile, PET powder, terephthalic acid
(pellets) IPTG induced sample (see 9), PBS(pH7), Glycine NaOH(pH9),
PET pellets(PET 100% pellets, Composite plastic pellets consisting of PET, polyethylene(PE) and polypropylene(PP))

16.3 Protocol

(powder)

Centrifuge the expression-induced samples as described in “9. IPTG Induction” at 9000 xg, 15 min, 22°C to pellet and remove the supernatant.
Resuspend the BIND-PETase pellet in PBS or glycine NaOH to achieve an OD600 to 2.7
Prepare the following in 1.5 mL tubes: PET powder is prepared by sanding plastic bottles.
1. pH7：10 mg of PET powder + 500 µL of BIND-PETase resuspended in PBS +PBS 500 µL
2. pH9：10 mg of PET powder + 500 µL of BIND-PETase resuspended in Glycine NaOH buffer + Glycine NaOH buffer 500 µL
Put samples in a rotator and react at room temperature for 3 days.
On reaction days 1 and 3, take 300 µL of each sample and filter through a syringe filter. Dilute pH 7 samples with 600 µL of PBS and pH 9 samples with 600 µL of Glycine NaOH buffer.
Use Eclipse XDB-C18 column (Agilent Technologies, Santa Clara, CA) with nanopure water, 0.1% formic acid, and acetonitrile (v/v=80/20) as mobile phase. Inject 5 mL of the decomposed product into the mobile phase.
Conduct separation at 1 mL/min flow rate.
Use diode-array detector (DAD) and measure the wavelength at 241 nm and obtain molar concentration by comparing calibration curves for TPA.

(pellets)

Centrifuge the expression-induced samples as described in “9. IPTG Induction” at 9000 xg, 15 min, 22°C to pellet and remove the supernatant.
Resuspend the BIND-PETase pellet in PBS or glycine NaOH to achieve an OD600 to 2.7
Prepare the following in 1.5 mL tubes. Each PET pellet weighed differently and was recorded individually. The weight of the 100% PET pellets is about 17 mg, and that of the composite pellets is about 31 mg. Experiments were performed with each pellet in PBS or glycine NaOH for comparison.
1. pH7：PET pellets + 250 µL of BIND-PETase resuspended in PBS
2. pH9：PET pellets + 250 µL of BIND-PETase resuspended in Glycine NaOH buffer
Samples were allowed to stand at room temperature for 5 days.
The pellets were weighed and the percentage of change to the original weight was determined.

Electro Count Biosafety Module^[9]^[11]

17 Cyclic Voltammetry

17.1 Overview

To enable the ElectroCount Biosafety Module, pyocyanin was used as a substance to induce the redox reaction of SoxR. In this experiment, the redox potential of pyocyanin was measured to determine the necessary voltage for voltage application experiments.

17.2 Materials

Milli-Q, pyocyanin/DMSO solution (1000 µM), Na2SO4, LB medium (5.0 g tryptone, 2.5 g Yeast extract, 5.0 g NaCl, 500 mL Milli-Q), potentiostat (ALS/CH Instruments Electrochemical Analyzer Model 650E), working electrode (glassy carbon plate), reference electrode (ALS/CH Instruments RE-1B Reference electrode (Ag/AgCl) 012167), counter electrode (ALS/CH Instruments Platinum counter electrode 23 cm 012961)

17.3 Protocol

Place 0.7 g of Na $_2$ SO $_4$ and 100 µL of pyocyanin solution (1000 µM) are in a graduated cylinder and add MilliQ to make 10 mL of solution. Then transfer to a glass vial.
Prepare two new glass vials, add 4.95 mL of LB medium to each, and add 50 µL of the 1000 µM pyocyanin solution to one of the vials.
Attach each electrode (working electrode, reference electrode, and counter electrode) to a cap, clip, and attach it to the glass vial. Then, connect each electrode to a potentiostat (ALS/CH Instruments Electrochemical Analyzer Model 650E).
Perform cyclic voltammetry with a scanning speed of 50 mV/s, a scanning range of -0.5 V to 0.1 V, and a repetition rate of 6 times (3 round trips).

18 Oxidation Rate Measurement

18.1 Overview

The experiment to demonstrate the ElectroCount Biosafety Module involves E. coli culture using a hot stirrer and an H-type cell. In this experiment, the reaction time of the electrical response of pSoxS was determined by measuring the oxidation rate of pyocyanin.

18.2 Materials

MilliQ, pyocyanin/DMSO solution (10 mM, MgSO4.7H2O,
H-type cell (EC FRONTIER/VB9 B900 flange glass cell), graduated cylinder, micro stirrer bar (Fisher Scientific/ φ1.5 x 8 mm), voltmeter, power supply, Pt mesh working electrode, Pt counter electrode (ALS/CH Instruments Platinum counter electrode (23 cm 012961), reference electrode (ALS/CH Instruments RE-1B Reference electrode (Ag/AgCl) 012167), incubator (37°C), NanoPhotometer NP 80

18.3 Protocol

Measure 6.162 g of MgSO4-7H2O, place in a graduated cylinder, and add MilliQ to make 50 mL of MgSO4 solution. Then, place 1 mL of this solution in a cuvette and use it as a blank.
Draw 225 µL from 45 mL of the adjusted MgSO4 solution and add 225 µL of pyocyanin solution (10 mM). Then add 45 mL of the solution to either side of the H-type cell.
Place an 8-mm stirrer bar into the cell on the side of the cap that has only one hole.
Switch the hot stirrer on at a temperature of 40°C and a rotational speed of 750 rpm.
Assemble the power supply unit and set the voltmeter to a value of +1.3 V. Apply voltage for 30 minutes to turn the pyocyanin on the counter electrode into a reduced form.
After 30 minutes, reverse the working electrode and counter electrode, and set t=0 min at this time. Then, the pyocyanin becomes the oxidizing agent on the working electrode side.
Every t=0,2,4,6,8,10,15,20,30 min, collect 1.5 mL solution from the working electrode side and place them in a cuvette.
Measure the absorbance of the blank and the collected sample solution.

19 Verification of the electro inductive properties

19.1 Overview

Confirmation of gene expression by the electrically inducible promoter is an important process in the ECB module. In order to prove this mechanism and to enable its operation in a form suitable for our project, we conducted an experiment to confirm the electrical response using the reporter gene mRFP1.
The mRFP1 protein has an absorption spectrum peak at 584 nm and a fluorescence spectrum peak at 607 nm. mRFP1 has an absorption spectrum peak at 584nm and a fluorescence peak at 607 nm.
By comparing the constant expression promoter with the pSoxS promoter and measuring the fluorescence intensity per E. coli concentration, we proved that the pSoxS promoter is responsive to electricity depending on the expression level of mRFP1. We also evaluated the performance of pSoxS promoter as a promoter by measuring fluorescence intensity in a time-dependent manner.

19.2 Materials

Reagents: MilliQ, PBS, LB medium (tryptone 5.0 g, Yeast extract 2.5 g, NaCl 5.0 g/ MilliQ 500 mL, Kan 25 µg/mL, Amp 50 µg/mL), LB agar medium (tryptone 2.0 g, Yeast extract 1.0 g, NaCl 2.0 g, Agarose S 3.0 g/MilliQ 200 mL: 10 agar plates, Kan 10 µg/mL, Amp 50 µg/mL),pyocyanin/DMSO solution (10 mM, MgSO4.7H2O)
Equipment: Hot stirrer PC-420D(CORNING), Spectrophotometer NanoPhotomer 80, Fluorescence plate reader Synergy H1, H-type cell (EC FRONTIER/VB9 B900 flange glass cell), graduated cylinder, micro stirrer bar (Fisher Scientific/ φ1.5 x 8 mm), voltmeter, power supply, Pt mesh working electrode, Pt counter electrode (ALS/CH Instruments Platinum counter electrode (23 cm 012961), reference electrode (ALS/CH Instruments RE-1B Reference electrode (Ag/AgCl) 012167), incubator (37°C)

19.3 Protocol

Transformation (1)

Transfect E. coli DH5α strains with a SoxR-expressing plasmid (pUC19-Pcon-soxR-pSoxS-cre) and a fluorescent-expressing plasmid (pBbAW4k-Pcon-loxP-mrfp1, pBbAW4k-pSoxS-mrfp1).

Liquid culture (2)

O/N 25 mL in a 50 mL tube against LB medium under the following conditions: Amp final concentration 20 μg/mL, Kan final concentration 10 μg/mL. Then, culture overnight.

Solution Preparation

Pyocyanin was prepared in LB medium to a final concentration of 10 μM and added to H-type cells.

Reduction of Pyocyanin

A voltage of +1.3 V was applied to the working electrode by a power supply unit to reduce Pyocyanin in the solution. Subsequent operations were performed on a hot stirrer at 40°C and 750 rpm.

Suspension of E. coli

An overnight culture of E. coli was added to the H-type cell to make up 50% of the solution on the working electrode and counter electrode side, respectively. In addition, Amp final concentration of 20 μg/mL and Kan final concentration of 10 μg/mL were added.

Reduction of SoxR

Immediately after the addition of E. coli, the solution was allowed to stand for 30 min.

Voltage application

The electrodes were switched and voltage was applied so that the working electrode was +1.3V. Samples were collected from the working electrode every 30 min from the time the voltage was applied. Samples were collected for up to 3 hours. Negative control was also collected from the counter electrode side at the same time as samples.

OD600 measurement and fluorescence intensity measurement

The sample was centrifuged at 3000 ×g for 5 min, concentrated 4-fold, and the pellet was suspended in PBS. Samples were stored at 4°C for 1 day. 1 day later, OD600 was then measured, followed by fluorescence using a fluorescent plate reader (excitation wavelength: 584 nm, excitation bandwidth: 1 nm, emission wavelength: 607 nm). The output was measured by dividing the fluorescence measurement by the OD600 measurement.

20 Cre Recombination

20.1 Overview

Terminator sequence excision by the Cre-loxP system is an important process in ECB-module. In order to demonstrate this mechanism and to enable its operation in a form suitable for our project, experiments to confirm the cleavage using the reporter gene mRFP1 were peformed.
First, cleavage activity was verified by adding purified Cre protein, followed by experiments using transformed E. coli. Two methods were tested for expression of Cre protein in E. coli: IPTG induction and electrical induction, which is the method we are aiming for in our project. The terminator sequence was confirmed by comparing fragment lengths and measuring fluorescence intensity. In the former method, fragments were amplified by PCR using primers that bind to the pre- and post- predicted cut-out regions, and then electrophoresis was performed to check whether the length of the cut-out sequence was reduced from the original sequence.

20.2 Materials

Reagents: MilliQ, LB medium (tryptone 5.0 g, Yeast extract 2.5 g, NaCl 5.0 g/ MilliQ 500 mL, Kan 25 µg/mL, Amp 50 µg/mL), LB agar medium (tryptone 2.0 g, Yeast extract 1.0 g, NaCl 2.0 g, Agarose S 3.0 g/MilliQ 200 mL: 10 agar plates, Kan 10 µg/mL, Amp 50 µg/mL),pyocyanin/DMSO solution (10 mM, MgSO4.7H2O), IPTG solution (100 mM), Cre recombinase (New England Biolabs, 1000 units/ml)

Equipment: Hot stirrer PC-420D(CORNING), Spectrophotometer NanoPhotomer 80, Thermal cycler Applied BiosystemsTM ProFlexTM PCR System(Thermo Fisher Scientific Inc.), Fluorescence plate reader Synergy H1, H-type cell (EC FRONTIER/VB9 B900 flange glass cell), graduated cylinder, micro stirrer bar (Fisher Scientific/ φ1.5 x 8 mm), voltmeter, power supply, Pt mesh working electrode, Pt counter electrode (ALS/CH Instruments Platinum counter electrode (23 cm 012961), reference electrode (ALS/CH Instruments RE-1B Reference electrode (Ag/AgCl) 012167), incubator (37°C)

Plasmid and Primer
pUC19-placIq-lacI-placUV5-cre, pUC19-Pcon-soxR-pSoxS-cre and pBbAW4k-Pcon-loxP-TT-loxP-mrfp1 were used as plasmids. have the ability to express Cre proteins in an IPTG-induced or voltage-stimulation-dependent manner. pBbAW4k-Pcon-loxP-TT-loxP-mrfp1 contains two consecutive terminator sequences (loxP-TT-loxP) flanked by two loxP sequences between the Promoter and mRFP1 gene, which has the function to express mRFP1 protein when cut out.
Cutout-site-amplification-fwd and cutout-site-amplification-rev were used as primers. They are designed to bind to the upper and lower parts of two loxP sequences as shown in the figure below, and amplify DNA fragments of different lengths before and after the Cre excision in PCR using pBbAW4k-Pcon-loxP-TT-loxP-mrfp1 as the template.

20.3 Protocol

(I) Transformation (1)
Transfect the DH5α strain competent cells with one of the Cre protein expression plasmids (IPTG induction: pUC19-placIq-lacI-placUV5-cre, electrical induction: pUC19-Pcon-soxR-pSoxS-cre) and the Cre protein substrate plasmid (pBbAW4k-Pcon-loxP-TT-loxP-mrfp1). These are carried out according to the protocol for transformation (1) as indicated for the introduction of plasmids, and the amount of plasmid solution added should be prepared so that 50 µL of E. coli suspension contains approximately 100 µg of each plasmid.
(II) Cutting out with purified Cre recombinase

Prepare pBbAW4k-Pcon-loxP-TT-loxP-mrfp1 plasmid extract at a concentration of about 50 ng/µL and prepare a reaction solution with the composition shown in Table 8.17.1 below.

Table. 8.20.1. Composition of reaction solutions for the experiment to confirm the cut-out using Cre recombinase

Reagent	Amount (µL)
Plasmid extract	2
Cre recombinase	1
Cre buffer	1
MilliQ	46

Incubate the reaction solution at 37 °C for 16 hours.
Perform fragment length check (V) using the reaction solution as plasmid extract.

(III) IPTG-induced Cre expression-dependent cutout

Pick up E. coli colonies formed on agar medium.
Incubate in LB medium for Cre Recombination pre-culture at 225 rpm, 37°C with O/N shaking.
Measure the OD600 value of the E. coli suspension after incubation with the spectrophotometer.
Prepare 5 mL of IPTG induction medium (5 mL of LB medium, IPTG concentration 1 mM) by adding 10 mM IPTG solution to LB medium, add E. coli suspension so that the OD600 value reaches 2.0 × 10^-3, and culture at 225 rpm, 37°C with O/N shaking. At the same time, culture the same number of samples using medium without IPTG as a negative control as those with IPTG.
Of the E. coli suspension after IPTG-induced culture, 3 mL is used for fragment length check, 400 µL is used for fluorescence intensity measurement, and 500 µL is used for OD600 measurement.

(IV) Electrically induced Cre expression-dependent cutout

Pick up E. coli colonies formed on agar medium.
Incubate in LB medium at 225 rpm, 37°C with O/N shaking.
Measure the OD600 value of the E. coli suspension after incubation using the spectrophotometer.
Prepare 50 mL of electrical-induction medium (Pyocyanin concentration 20 mM) by adding 10 mM Pyocyanin solution to LB medium, add 20 mL to each side of the H-type cell, and apply a voltage of 1.3 V for 30 minutes to increase the percentage of reduced Pyocyanin in the medium on the cathode side.
Take 10 mL of medium from the cathode side, add 10 mL of E. coli suspension after incubation, and incubate at 37°C. The sample without voltage application is used as the negative control.
Add 10 mL of the E. coli suspension after incubation to the cathode side, and at the same time, take 10 mL of medium from the anode side and add 10 mL of LB medium to the anode side for concentration adjustment. Then, the sample is incubated at a set temperature of 40°C ^*1 while agitated on the hot stirrer at 750 rpm while applying a voltage of 1.3 V. The sample with voltage is defined as the sample with voltage applied.
Immediately after the start of incubation, t = 0 min, and every 30 min in the range from 0 to 180 min, 1.0 mL of each culture medium with and without voltage application is divided and stored at 4 ºC. Of each sample, 400 µL is used for fluorescence intensity measurement and 500 µL for OD600 measurement. In addition, 3 mL of the culture medium at t = 180 min is used for fragment length check.

*1 The temperature of the medium was experimentally confirmed to be 37°C by setting the hot stirrer at 40°C.
(V) Fragment length check

Miniprep (8.3) is performed using E. coli culture aliquots for fragment confirmation to obtain plasmid extracts.
The obtained plasmid extracts, extracts of pBbAW4k-Pcon-loxP-TT-loxP-mrfp1 (Negative control for the cutout), and extracts of pBbAW4k-Pcon-loxP-mrfp1 plasmid (Positive control for the cutout) were each added to the Prepare PCR reaction solutions using Template, cutout-site-amplification-fwd and cutout-site-amplification-rev as primers. The composition of the reagents is the same as that for KOD mutagenesis (5).
PCR is performed on the reaction solution using the thermal cycler (annealing temperature: 57°C, elongation time: 1 min/cycle) to obtain the DNA fragment solution.
The obtained DNA fragment solution is electrophoresed, and the size of the included DNA fragments is estimated from the position of the bands.

(VI) Fluorescence intensity measurement

Dispense 200 µL/well of the E. coli culture solution aliquoted for fluorescence intensity measurement onto a 96 well plate. Use E. coli-free LB medium as a blank.
Fluorescence intensity at 574 nm absorption wavelength and 607 nm emission wavelength^*2 is measured with the fluorescence plate reader.
Divide the obtained fluorescence intensity by the OD600 value to obtain the relative fluorescence intensity.

*2 Although the absorption coefficient of mRFP1 protein is maximal at 584 nm, this measurement condition was chosen due to the limited resolution of the optical filter of the instrument used.

References

DynaCompetent Cells JetGiga DH5α product information, BioDymamics laboratory Inc.
https://www.biodynamics.co.jp/wp/wp-content/uploads/2023/03/ds_ds230_j.pdf ↩︎
BL21(DE3) Competent Cells user guide, Thermoscientific
https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2FMAN0018595_BL21_DE3competent_cells_UG.pdf ↩︎
NEB® 5-alpha Competent E. coli (High Efficiency) protocol, New England Biolabs
https://www.neb.com/ja-jp/products/c2987-neb-5-alpha-competent-e-coli-high-efficiency ↩︎
PureYield™ Plasmid Miniprep System, Promega,
https://www.promega.jp/products/nucleic-acid-extraction/plasmid-purification/pureyield-plasmid-miniprep-system/?catNum=A1223#protocols ↩︎ ↩︎
KOD -Plus- Mutagenesis KitSite-directed mutagenesis kit, TOYOBO
https://www.toyobo-global.com/seihin/xr/lifescience/products/clon_006.html ↩︎
NEBuilder® HiFi DNA Assembly Master Mix/ NEBuilder® HiFi DNA Assembly Cloning Kit INSTRUCTION MANUAL, NEW ENGLAND Biolabs Inc, https://www.neb.com/ja-jp/-/media/nebus/files/manuals/manuale2621_e5520.pdf?rev=120c86ac1f4f48ed95f1eb46990d9d0e&hash=775AF7CE0AC2B91B30CE3F4C616C42D0 ↩︎
Yinglu C. et al. (2021), Computational redesign of a PETase for plastic biodegradation by the GRAPE strategy, ACS Catal, 1340–1350. https://doi.org/10.1101/787069 ↩︎ ↩︎
Zhu B. et al. (2022), Enzymatic Degradation of Polyethylene Terephthalate Plastics by Bacterial Curli Display PETase, Environ. Sci. Technol. Lett. 9(7), 650-657, https://doi.org/10.1021/acs.estlett.2c00332 ↩︎ ↩︎
Sheets M. et al. (2020), Light-Inducible Recombinases for Bacterial Optogenetics, ACS Synth. Biol. 9, 2, 227–235, https://doi.org/10.1021/acssynbio.9b00395 ↩︎ ↩︎ ↩︎
Silverman A. et al. (2020), Design and Optimization of a Cell-Free Atrazine Biosensor, ACS Synth. Biol. 9, 3, 671–677, https://doi.org/10.1021/acssynbio.9b00388 ↩︎
Joshua L. et al. (2022), Synthetic biology and bioelectrochemical tools for electrogenetic system engineering,Science Advances, https://doi.org/10.1126/sciadv.abm5091 ↩︎