Background and Purpose
MOVE is a module designed to deliver RNA pesticides, and its greatest appeal lies in the ability to modify the RNA content, making it applicable to virtually any target. However, this exceptional flexibility cannot be fully realized unless it actually transports (moves) a specific RNA. Through our Integrated Human Practices , we learned that there are pests and diseases difficult to control with current pesticides. During our research, we also discovered that while studies on RNA pesticides against these pests have progressed to some extent, there is a lack of databases that list crops with potential RNA pesticide candidates or compile what kinds of RNA pesticides could be applicable to specific crops.
Our goal is to make MOVE function as a robust RNA pesticide platform by connecting all unintegrated information about crops and RNA pesticides. This information will be beneficial for our future activities, for iGEMers, and for RNA pesticide researchers and companies worldwide. We envision a future where this database serves as a foundation, and DDS platformers like us compete in the field of RNA pesticides. For more details, please see the Implementation Page .
Implementation
Aiming to create a platform for RNA pesticides, we intend to implement a small-scale open database of sequences favorable for RNA interference as a web application that anyone can edit. Users will be able to view, create, edit, and delete content, and the system will manage change histories. Note that this content aims for minimal configuration.
Additional Data to be Included
| Topics | Example |
|---|---|
| Target Species | Pyricularia oryzae |
| Description of Target Species | Pathogen of rice blast disease |
| Target mRNA Sequence | atgctgacaaccatcaaaatggcggacaagctggctttcctcctcttcggagaccaa — followed by 2000 characters |
| Description of Sequence | Used in infection |
| Created ds/shRNA Sequence | Approximately 20 bases for shRNA, approximately 200 bases for dsRNA |
| Reference | Tshitoyan, V., Dagdelen, J., Weston, L., Dunn, A., Rong, Z., Kononova, O., Persson, K. A., Cedar, G., & Jain, A. (2019). Unsupervised word embeddings capture latent knowledge from material science literature. Nature, 571, 95-98. https://www.nature.com/articles/s41586-019-1335-8 |
| Editor | iGEM-scitech |
Coding
- Services Used in Implementation
- Frontend: Vue.js
- Backend: Firebase
- Reference: https://www.bezkoder.com/vue-3-firebase/
We implemented the frontend using Vue.js and hosted it on Firebase, utilizing Firebase Realtime Database.
Features
- You can register new data from “Add” and display a list from “List”.
- Data displayed in “List” can be updated at any time, and the “Status” can be changed.
- In the search box at the top of “List”, you can search by Name, Species, or Author. Matching data can be displayed in real time.
- You can filter by “Status” using the radio buttons below the search box.
Conclusion and Future Prospects
By integrating information on RNA pesticides and building an open database that anyone can access and edit, we have taken the first step in making MOVE function as a true RNA pesticide platform. This database aims to aggregate promising sequence information for RNA interference against pests and diseases that are difficult to control with current pesticides, becoming a valuable resource for researchers, companies, and future iGEM teams.
Through this platform, we expect to promote information sharing and collaboration in the research and development of RNA pesticides, maximizing the modularity and versatility of MOVE. In the future, we plan to collect more information on crop species, pests, and RNA interference sequences to enrich the database. We will also form a community where a wide range of users, including researchers, agricultural workers, and biotechnology companies, can participate, providing a place for information exchange and joint research. In terms of the software itself, we will introduce authentication systems and access controls to ensure data reliability and user privacy, and incorporate tools for predicting RNA secondary structures and off-target effects to assist in sequence design. Additionally, to promote international use, we will work on supporting English and other languages.
The way we created this database could also be useful for other platform-based projects. We strongly hope that this database will accelerate the research and development of RNA pesticides, contribute to the realization of sustainable agriculture, and serve as a reference for similar platform-based projects.